ID: 907714356

View in Genome Browser
Species Human (GRCh38)
Location 1:56913674-56913696
Sequence TAAAATGATGGCAAAATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907714349_907714356 30 Left 907714349 1:56913621-56913643 CCAATTCCTAAGCTCCCACTTTT 0: 1
1: 0
2: 1
3: 61
4: 831
Right 907714356 1:56913674-56913696 TAAAATGATGGCAAAATGTATGG No data
907714352_907714356 16 Left 907714352 1:56913635-56913657 CCCACTTTTTCAGGCACATAAAA 0: 1
1: 0
2: 1
3: 38
4: 290
Right 907714356 1:56913674-56913696 TAAAATGATGGCAAAATGTATGG No data
907714351_907714356 24 Left 907714351 1:56913627-56913649 CCTAAGCTCCCACTTTTTCAGGC No data
Right 907714356 1:56913674-56913696 TAAAATGATGGCAAAATGTATGG No data
907714353_907714356 15 Left 907714353 1:56913636-56913658 CCACTTTTTCAGGCACATAAAAC 0: 1
1: 0
2: 2
3: 24
4: 237
Right 907714356 1:56913674-56913696 TAAAATGATGGCAAAATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907714356 Original CRISPR TAAAATGATGGCAAAATGTA TGG Intronic