ID: 907717575

View in Genome Browser
Species Human (GRCh38)
Location 1:56941628-56941650
Sequence GGGCTCCTAAAATTGCTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907717575_907717578 21 Left 907717575 1:56941628-56941650 CCAGATAGCAATTTTAGGAGCCC 0: 1
1: 0
2: 0
3: 5
4: 48
Right 907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907717575 Original CRISPR GGGCTCCTAAAATTGCTATC TGG (reversed) Intronic
907717575 1:56941628-56941650 GGGCTCCTAAAATTGCTATCTGG - Intronic
916912713 1:169368013-169368035 GGGCTCCAAAAGTTGCTGTACGG + Exonic
923766735 1:236899116-236899138 GGTCTCCTAAAATTGATCTATGG + Exonic
1064466409 10:15586626-15586648 AGGCTCACAAAATTGCTGTCTGG + Exonic
1071863291 10:89698422-89698444 GGGCTCATAAAATTGTTGTAAGG - Intergenic
1076794013 10:132790152-132790174 GGGCTCTGAAAATTGCTCTGAGG - Intergenic
1084905292 11:72341437-72341459 AGTCTCCTAAAATTGCTGTGGGG + Intronic
1102175880 12:110874442-110874464 GGGTTCCTTAAATTGCAATCTGG + Intronic
1106886837 13:34195725-34195747 ATGCTACTAAAATTGCTATCTGG + Intergenic
1112310687 13:98315052-98315074 GGGCTCCTTAAATGGCTCTTTGG + Intronic
1112832384 13:103469402-103469424 GAGCTACTTAATTTGCTATCTGG + Intergenic
1115148245 14:30252297-30252319 GGGCTGCCAAGACTGCTATCAGG - Intergenic
1125872906 15:43118383-43118405 GGGATAGTAAAACTGCTATCTGG + Intronic
1131063557 15:89418852-89418874 TGGCTCCTAAAGGTGCTGTCAGG - Intergenic
1149401604 17:56302114-56302136 GGGCTCCTAAAATTACTTACTGG + Intronic
1152163138 17:78682085-78682107 GTCCTCCTAAAATAACTATCTGG + Intronic
1155529815 18:26755469-26755491 GCTCTCATAAAATTGCTATTTGG + Intergenic
1158890259 18:61865998-61866020 TGCCTCCTAAAATTTCTCTCAGG + Intronic
1160597548 18:79987551-79987573 GTCATCCTAAAATTGCTATGAGG + Intronic
1161388292 19:4008227-4008249 GGGCTCCCAGGACTGCTATCTGG + Intronic
927137194 2:20105574-20105596 CGGCTCCAAAAAATGCTAGCAGG - Intergenic
928467361 2:31534899-31534921 TGCCTCCTAAAATTGCTGTGAGG + Intronic
939439673 2:142230464-142230486 GGGCTCCTGAAATCCCTTTCTGG + Intergenic
945711183 2:213297265-213297287 GGGATGCTAAAATTGTCATCTGG - Exonic
1170476591 20:16721143-16721165 GGGCCCCTTTCATTGCTATCGGG + Intergenic
1178519718 21:33278494-33278516 TTGCTCCTATAATTGCTAACTGG + Intronic
953691661 3:45124961-45124983 GGTGTCCTAAAATTACTATTTGG - Intronic
960776027 3:121254378-121254400 GGACTCCCAATATTGCTAACTGG + Intronic
961072370 3:123945328-123945350 GGACTCCTATGATTGCTATAGGG + Intronic
963136579 3:141911029-141911051 TGGATTCTAAAATTTCTATCTGG + Intronic
975601636 4:76106243-76106265 GGGCACCTAGAATTGGTATTTGG + Intronic
979821995 4:125186381-125186403 GTGGTCCTACAATTGCTATGAGG + Intergenic
983986527 4:174066429-174066451 GGGCTCCTTAAAATTCTAACTGG + Intergenic
985080361 4:186258769-186258791 GGCCTCCTAACTTTGCTACCAGG + Intergenic
986999241 5:13642444-13642466 GGGCTCTGAAATCTGCTATCTGG - Intergenic
988384011 5:30537961-30537983 GGGCTCAAAAAATTGGTATTTGG + Intergenic
992806685 5:80344733-80344755 GGGCTCCTAAACAAGCTCTCTGG - Intergenic
998199713 5:140109126-140109148 GGGCTCCTTACATTTCTGTCCGG + Intronic
1009507092 6:64498327-64498349 GGGTTCCAAAAATTGTTTTCAGG - Intronic
1015671929 6:135700339-135700361 GGGCTTATAAAATTGGAATCAGG + Intergenic
1022262277 7:28717980-28718002 AGGCTCTTAAAATTGTTTTCTGG + Intronic
1027981359 7:85227278-85227300 GGTCTCCCAAAATTTCTATGTGG + Intergenic
1028554994 7:92113348-92113370 GTACTCTTAAAATTACTATCTGG + Exonic
1033828591 7:145223974-145223996 AGGCTCATAAAATTGCTGTAGGG + Intergenic
1038937149 8:32265035-32265057 TGTCATCTAAAATTGCTATCAGG + Intronic
1044121457 8:88401555-88401577 TGTCTGCTAAAATTGCTATGTGG + Intergenic
1045720525 8:105104829-105104851 GGGCTCCTAAACATTCTATCAGG - Intronic
1048191925 8:132297794-132297816 CGGCTCCTAAAGCTGCTAACCGG + Intronic
1049291834 8:141807413-141807435 GTGCTCCCAAAATTCATATCTGG - Intergenic
1051694538 9:19753888-19753910 TGGCTCCAAAAATTGGCATCTGG + Intronic
1055828142 9:80351282-80351304 GGACTGCTAAAATTGCTTTTAGG - Intergenic
1057898562 9:98929834-98929856 AGCCACCTAAACTTGCTATCTGG - Intergenic
1188726356 X:33588360-33588382 GGGCTGGTAAAATTACTATCTGG + Intergenic
1197855214 X:130907160-130907182 TGGGGCCTAATATTGCTATCAGG - Intergenic