ID: 907717576

View in Genome Browser
Species Human (GRCh38)
Location 1:56941648-56941670
Sequence GAAGTAGAGCTAATAATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907717576_907717580 24 Left 907717576 1:56941648-56941670 CCCAGCATTATTAGCTCTACTTC 0: 1
1: 0
2: 0
3: 12
4: 133
Right 907717580 1:56941695-56941717 AATTGTTAAGTGACTTGCCAAGG 0: 1
1: 0
2: 4
3: 62
4: 397
907717576_907717578 1 Left 907717576 1:56941648-56941670 CCCAGCATTATTAGCTCTACTTC 0: 1
1: 0
2: 0
3: 12
4: 133
Right 907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907717576 Original CRISPR GAAGTAGAGCTAATAATGCT GGG (reversed) Intronic
902348085 1:15833900-15833922 GAGGTAAAGCTCATAATGATAGG - Intergenic
907497129 1:54852613-54852635 GGAGTAGAGCTCAGACTGCTGGG + Intronic
907717576 1:56941648-56941670 GAAGTAGAGCTAATAATGCTGGG - Intronic
913992564 1:143628055-143628077 GAATACTAGCTAATAATGCTAGG + Intergenic
914864507 1:151415331-151415353 GAAGTGGAGGTAACAATGCCAGG + Intronic
915199076 1:154213009-154213031 GAAGTAGGTCTAATGAAGCTGGG + Intronic
918815508 1:189175500-189175522 CATCTAGAGATAATAATGCTTGG - Intergenic
920020707 1:202954362-202954384 AAAGAAGAGCAAATAATACTAGG + Intronic
921724297 1:218507312-218507334 GAAGTAGAGCAAAAAAAGTTTGG + Intergenic
922963641 1:229668958-229668980 GAAATGGAGGTAATAATGATTGG + Intergenic
1066611114 10:37249412-37249434 TAAATAGAGCTAAGAATGCCTGG + Intronic
1067070806 10:43130140-43130162 CCAGTAGAGCTAATAAGGATGGG - Exonic
1067248213 10:44564426-44564448 GAAATAGAACTCATAATGTTTGG - Intergenic
1068729421 10:60339762-60339784 GAAGTGGAGGTAAAAATACTAGG + Intronic
1071691664 10:87826531-87826553 GAAGAAATGCTAATAATTCTTGG + Intronic
1072014398 10:91332437-91332459 AAAGTAGAGCTAAAAATTTTTGG - Intergenic
1074486301 10:113885551-113885573 AAAGTAGAGCAAATAAGGCAGGG - Intronic
1076326628 10:129628713-129628735 CAAGTAGAGCTCAGACTGCTGGG + Intronic
1078016525 11:7619686-7619708 GAAGTAGAATTAATAAAGCTTGG + Intronic
1080043364 11:27783053-27783075 GAAGTGGGTCTCATAATGCTGGG + Intergenic
1080456141 11:32421136-32421158 GAACTGGAGCTAAAAATACTGGG + Intronic
1084761268 11:71272658-71272680 GAAGTAGAGCTAGGACTGATCGG + Intergenic
1085587751 11:77727424-77727446 GTAAGAGAGCTAATATTGCTAGG + Intronic
1085970829 11:81588672-81588694 GAAAGAGAGCTAACAATACTTGG - Intergenic
1087264877 11:96049641-96049663 GAAGTAAGGCCAATAATACTTGG + Intronic
1087430059 11:98042173-98042195 TTAGTAGAGTTAATAATTCTAGG - Intergenic
1088215355 11:107501951-107501973 GAAGTCAAGCTGATACTGCTTGG - Intergenic
1088933031 11:114371503-114371525 GAAGTAGAAGGAATACTGCTGGG - Intergenic
1093423125 12:18997983-18998005 GGACTAGAGCTACTAATGCTGGG - Intergenic
1095264812 12:40142970-40142992 TAAGTTGAGCTAAATATGCTTGG + Intergenic
1095547656 12:43390092-43390114 GAAGCAGAGCCAATAATGTGGGG + Intronic
1095703575 12:45215725-45215747 GACGTGGAGCTAATAATGGGGGG - Intergenic
1100676828 12:96877890-96877912 GGAGTAGACCTCATAATACTTGG - Intergenic
1102990975 12:117315828-117315850 GAGGTAAAGCTTATAATACTTGG + Intronic
1108906738 13:55484958-55484980 GAAGTAGAGATTAGAATGGTGGG - Intergenic
1109792516 13:67268351-67268373 GAAGTAGAGAGTATAATGTTAGG + Intergenic
1110798418 13:79667362-79667384 GAAGTAGAGCTAAAACTTATTGG + Intergenic
1113016980 13:105838613-105838635 GGAGTGGCCCTAATAATGCTTGG + Intergenic
1113420948 13:110170941-110170963 GAAAAAGAGCTCAGAATGCTAGG + Intronic
1115938345 14:38580425-38580447 GAATTAGAGCTAGTGATACTTGG + Intergenic
1117121713 14:52574806-52574828 GAAATAGATCTAATAATGGTGGG - Intronic
1126572572 15:50168053-50168075 GAAGTAGAAGACATAATGCTAGG + Intronic
1136580039 16:31145904-31145926 GAAGTGGAGCTAAGGCTGCTGGG - Exonic
1141055926 16:80813982-80814004 AAAGTAGAGCAAATAATACAAGG + Intergenic
1141457489 16:84153269-84153291 GAGGAACAGCTAATGATGCTAGG + Intronic
1143090313 17:4446043-4446065 GAAGAAGAGCCAAGAATACTGGG - Exonic
1147252647 17:39162595-39162617 GAAATAGAGATTATAATGGTCGG - Intronic
1148936973 17:51170884-51170906 GTAGTACAGCAAAAAATGCTAGG + Intronic
1149406377 17:56356086-56356108 GAAGTAGAGCTGATAGTACTTGG + Intronic
1149931116 17:60756554-60756576 GAACTGGAGCTAATTATGTTAGG - Intronic
1153375954 18:4379293-4379315 GGAGTAGAGCTAAAAAGCCTGGG - Intronic
1158738266 18:60108628-60108650 GAAGCAGAGCTTATAATGGTTGG + Intergenic
1158994438 18:62903217-62903239 GAAGCAGAAATAATGATGCTGGG - Intronic
1163930551 19:20386693-20386715 GAAGAAGAAATAAAAATGCTGGG + Intergenic
1163936348 19:20448040-20448062 GAAGAAGAAATAAAAATGCTGGG + Intergenic
1163947881 19:20556955-20556977 GAAGAAGAAATAAAAATGCTGGG - Intronic
1164021738 19:21313416-21313438 GTAGAAGAGTTAAAAATGCTGGG - Intronic
1164068917 19:21747932-21747954 GAGGAAGAAGTAATAATGCTGGG - Intronic
1164094459 19:21994037-21994059 GAAATAGAAATAAAAATGCTGGG - Intronic
1164198163 19:22991355-22991377 GAAATAGAAATAAAAATGCTGGG - Intronic
1164284757 19:23803938-23803960 GAAGAAGAAATAAAAATGCTGGG + Intronic
1165564962 19:36717286-36717308 GAAGTAGAGCTTAAAATGGTAGG + Intronic
926333313 2:11843907-11843929 GAAGGAGACCTAATACTGATTGG - Intergenic
937568611 2:123329141-123329163 GAAGTAGAAATTATAATGATGGG + Intergenic
939543938 2:143529282-143529304 AAAGTAGAGCTCATGAGGCTTGG - Intronic
939659008 2:144864448-144864470 GAAGGAGAGCTGATATTTCTGGG + Intergenic
941215536 2:162703227-162703249 AAAGTAGAGATAATAATGGTAGG - Intronic
943378395 2:187111141-187111163 GTAGAAGACCAAATAATGCTAGG + Intergenic
943805941 2:192125900-192125922 GAAGAATAGCTAATGATGCTGGG + Intronic
944013061 2:194998164-194998186 GAAATACATCAAATAATGCTTGG - Intergenic
947326686 2:228986619-228986641 GAAGTGGAGTTCACAATGCTTGG + Intronic
1170633052 20:18081625-18081647 GAAGGAGAGATTATAATGCTGGG - Intergenic
1173367765 20:42402679-42402701 GAAAAAGCGATAATAATGCTTGG + Intronic
1177812068 21:25935441-25935463 AAAATATAGCTAACAATGCTTGG + Intronic
1185019960 22:48368520-48368542 GAAATAAAGCTACTAATGCCAGG + Intergenic
953155106 3:40362994-40363016 GAAGTAGAGGGAATAATGATAGG - Intergenic
953176565 3:40558901-40558923 GAAGTCCAGCTAAGAATGCCAGG + Intronic
955389797 3:58513136-58513158 GAAGTGGAGGAAAGAATGCTGGG - Intronic
955529829 3:59861524-59861546 GCAGAAGTGCTAATAATGATGGG - Intronic
957027382 3:75198161-75198183 CAAATTGAGCTAATAATGCCCGG - Intergenic
961225128 3:125237284-125237306 GAAATAGAGCTGGTAAAGCTGGG + Intronic
965601977 3:170463676-170463698 GAAGTAGAGGAAATAGAGCTTGG - Exonic
967516211 3:190372110-190372132 CAAGTATAGCTAATCCTGCTGGG - Intronic
967944683 3:194794623-194794645 TAAGTATAGCTAATCCTGCTTGG + Intergenic
971339084 4:25751358-25751380 GAAGAAGGGCTAATGACGCTTGG + Intronic
971383109 4:26117726-26117748 TAAGGAGAGATACTAATGCTTGG + Intergenic
971635382 4:29050018-29050040 AAACTAGAGATAATAATGATAGG - Intergenic
972229910 4:37059786-37059808 GAAGCAGAGCTTCAAATGCTAGG + Intergenic
972558813 4:40207299-40207321 GAAATACAGCTAATAATTGTAGG + Intronic
973002502 4:44968489-44968511 GAAGTAGTGCCAATAGTACTTGG + Intergenic
976315743 4:83657103-83657125 GAAGTAGATCTGTTAATGCAGGG - Intergenic
976912077 4:90319801-90319823 GAATTAAAGCAAATATTGCTTGG + Intronic
977282687 4:95061690-95061712 GAACTAGAACTAAAAATTCTAGG - Intronic
977346052 4:95817629-95817651 GAAGTAGAGTTGAAGATGCTGGG - Intergenic
980265717 4:130512831-130512853 AAACTAGAGCTTATAATACTGGG + Intergenic
981651473 4:147064125-147064147 GATGTAGATATATTAATGCTGGG - Intergenic
984956049 4:185046534-185046556 AAATTAAAGTTAATAATGCTAGG + Intergenic
986019519 5:3788313-3788335 CAACTAGAGTTAATAATGCTAGG + Intergenic
986434098 5:7710872-7710894 AAAGTAGAGCCAATAAGACTTGG + Intronic
988382107 5:30510853-30510875 GAAGTAGAGCGTAGAATGATTGG - Intergenic
990456336 5:55992479-55992501 GAAGTAGGTCTAATAATAATAGG - Intronic
990774578 5:59291292-59291314 GAAGTGGAGATAATTATGTTAGG + Intronic
994510319 5:100694951-100694973 AAAGTAGAGATAATAATTCATGG - Intergenic
997380661 5:133434215-133434237 GAAGTAGAGTTGATAAGACTTGG + Intronic
998521251 5:142802889-142802911 AAAGTAGAGAAAATAATACTTGG + Intronic
998706173 5:144764053-144764075 GAAGGGGAGATAATAATGGTGGG - Intergenic
1002550726 5:179989397-179989419 TAAGTAAAGCTAATATTACTAGG - Intronic
1002809139 6:609301-609323 GAAGTAGAGTTAAGAATCATTGG - Intronic
1002966718 6:1973922-1973944 GAAGTAGAGCTAAGGCTTCTAGG + Intronic
1004622171 6:17340584-17340606 TGAGTAGACCTAAAAATGCTAGG + Intergenic
1008106776 6:47447385-47447407 GAATTAGAGATATTAAGGCTAGG - Intergenic
1011802425 6:91032006-91032028 GAAGAATTGCAAATAATGCTAGG - Intergenic
1012760281 6:103292905-103292927 GAATTAGAGGTAAAAGTGCTTGG + Intergenic
1015646438 6:135394674-135394696 GAAATAAAGCTCATAATGGTCGG - Intronic
1016032115 6:139348541-139348563 TAATTAGAGCTAATAATAGTGGG - Intergenic
1017676403 6:156818800-156818822 GACTTAGAGAAAATAATGCTAGG + Intronic
1018660745 6:166084935-166084957 GAATTAGATTTAATACTGCTTGG + Intergenic
1025816085 7:64913314-64913336 GAAGAAGAAGTAAAAATGCTGGG + Intronic
1028890497 7:95982950-95982972 GAATTAAAGCTAAATATGCTGGG - Intronic
1030444367 7:109630561-109630583 GCAGTAGAGATAATACTGGTTGG - Intergenic
1031743445 7:125464728-125464750 AAAGTAAAACTCATAATGCTTGG - Intergenic
1032101831 7:128986203-128986225 GAACTAGAGATATTAAGGCTAGG - Intronic
1033628347 7:143132911-143132933 GCAGTAGGGTTTATAATGCTGGG + Intronic
1033927873 7:146486409-146486431 AATGTAGAGATAATCATGCTAGG + Intronic
1037529879 8:19762609-19762631 AAAGTGGTGCTAAAAATGCTTGG - Intergenic
1042662675 8:71172809-71172831 GAAATACAGATAATTATGCTAGG - Intergenic
1043132991 8:76485055-76485077 GAAATAGAGGAAAAAATGCTGGG + Intergenic
1043293445 8:78634122-78634144 GAAGAAAAGGTAATGATGCTTGG - Intergenic
1046345935 8:112926747-112926769 GAAGGACAGATAATAGTGCTTGG + Intronic
1047821746 8:128528764-128528786 GCAGTAGGCCTAATAATGCATGG + Intergenic
1048422902 8:134294783-134294805 AAAGGAAAGCTAATAAGGCTAGG + Intergenic
1050089000 9:1997125-1997147 TAAATAGAGATAATAATGCCTGG + Intergenic
1053174758 9:35914697-35914719 GAAGTAGAATTGAGAATGCTCGG - Intergenic
1054906116 9:70414984-70415006 GAAAAAGAGCTAAGAATGGTGGG - Intergenic
1054999905 9:71437106-71437128 AAAGTTGAGCTAATAATAATAGG - Intronic
1055940889 9:81648287-81648309 AAAGAAGAGCTAAAGATGCTTGG - Intronic
1060186319 9:121566244-121566266 GGAGTAGAGCAAATGATGCGAGG - Intergenic
1187135858 X:16546488-16546510 GAAGAAGAGCCAACCATGCTGGG - Intergenic
1188098988 X:26058881-26058903 GAAGTAGAGCACATTATGCTAGG + Intergenic
1190974705 X:55387828-55387850 GAAATAGAGTTACTATTGCTAGG - Intergenic
1191075280 X:56446515-56446537 GAAGTAGAGAGAATGGTGCTTGG + Intergenic
1192402276 X:70847837-70847859 AAAGTAGAGCAAACACTGCTAGG - Intronic
1194974607 X:100381018-100381040 GAAATAGATCAAATAATCCTGGG - Intronic
1198557663 X:137812408-137812430 AAAATAGAGCTAATAATACAGGG - Intergenic
1198650883 X:138862863-138862885 GATGAAGACCTAGTAATGCTTGG - Intronic
1198803196 X:140468630-140468652 GAAGTAGAGATAGTAATTGTAGG + Intergenic