ID: 907717577

View in Genome Browser
Species Human (GRCh38)
Location 1:56941649-56941671
Sequence TGAAGTAGAGCTAATAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907717577_907717580 23 Left 907717577 1:56941649-56941671 CCAGCATTATTAGCTCTACTTCA No data
Right 907717580 1:56941695-56941717 AATTGTTAAGTGACTTGCCAAGG 0: 1
1: 0
2: 4
3: 62
4: 397
907717577_907717578 0 Left 907717577 1:56941649-56941671 CCAGCATTATTAGCTCTACTTCA No data
Right 907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907717577 Original CRISPR TGAAGTAGAGCTAATAATGC TGG (reversed) Intronic
No off target data available for this crispr