ID: 907717578

View in Genome Browser
Species Human (GRCh38)
Location 1:56941672-56941694
Sequence CAAATTATGAAACACGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907717576_907717578 1 Left 907717576 1:56941648-56941670 CCCAGCATTATTAGCTCTACTTC 0: 1
1: 0
2: 0
3: 12
4: 133
Right 907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 63
907717577_907717578 0 Left 907717577 1:56941649-56941671 CCAGCATTATTAGCTCTACTTCA No data
Right 907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 63
907717575_907717578 21 Left 907717575 1:56941628-56941650 CCAGATAGCAATTTTAGGAGCCC 0: 1
1: 0
2: 0
3: 5
4: 48
Right 907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907717578 Original CRISPR CAAATTATGAAACACGTACC TGG Intronic