ID: 907717578

View in Genome Browser
Species Human (GRCh38)
Location 1:56941672-56941694
Sequence CAAATTATGAAACACGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907717575_907717578 21 Left 907717575 1:56941628-56941650 CCAGATAGCAATTTTAGGAGCCC 0: 1
1: 0
2: 0
3: 5
4: 48
Right 907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 63
907717576_907717578 1 Left 907717576 1:56941648-56941670 CCCAGCATTATTAGCTCTACTTC 0: 1
1: 0
2: 0
3: 12
4: 133
Right 907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 63
907717577_907717578 0 Left 907717577 1:56941649-56941671 CCAGCATTATTAGCTCTACTTCA No data
Right 907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907717578 Original CRISPR CAAATTATGAAACACGTACC TGG Intronic
902566392 1:17314407-17314429 CCATTTATGATACACCTACCTGG - Intronic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
907812605 1:57886503-57886525 CAAATTCTTTACCACGTACCAGG + Intronic
915736237 1:158087382-158087404 CAATTTATTACACACCTACCAGG - Intronic
916294899 1:163207476-163207498 CCAAATATGAAACACTTGCCAGG + Intronic
917361440 1:174180904-174180926 TAAAGCATGAAACAAGTACCAGG - Intronic
918765740 1:188480925-188480947 CAAATGATGAAACCAGTACTGGG - Intergenic
920836992 1:209520206-209520228 CAAAAGATGAAAGACGTAACAGG - Intergenic
921802827 1:219420615-219420637 CAAATTATAAAACAAGTCACTGG - Intergenic
1064664572 10:17637756-17637778 CAAAGTATGAAACTCTTAACAGG - Intergenic
1065507091 10:26439455-26439477 CAAATTATGAAACTTGTGCCTGG - Intronic
1066250309 10:33626608-33626630 CAAATCATGAAATAGGTAACTGG - Intergenic
1067994175 10:51251220-51251242 CAATTTATGAAACAGGTGCCTGG - Intronic
1077948296 11:6926547-6926569 CAATTTATGAAACTCGGAGCCGG + Exonic
1080705995 11:34693337-34693359 CGAATTATGAAATATGCACCTGG - Intergenic
1087295039 11:96362175-96362197 AATATAATGAAACATGTACCAGG + Intronic
1089392899 11:118114228-118114250 CAAATCTTGAAACACACACCAGG - Intronic
1093891867 12:24531360-24531382 CAAATTATGAAAAATGCACAGGG - Intergenic
1096373453 12:51087373-51087395 CAAAGTATAAAACACTTCCCAGG - Intergenic
1111507319 13:89209337-89209359 CAAATTATTAAAAACATACAAGG - Intergenic
1115774854 14:36704172-36704194 CGAATTATGAGACACGGCCCTGG - Intronic
1119280209 14:73400465-73400487 CAAATTATGAAACATATAATTGG + Intronic
1120791551 14:88588392-88588414 CAAAGTATCAAACAAGTACAAGG - Intronic
1127159606 15:56167500-56167522 CTAATTATGAAAAATGTAACTGG + Intronic
1128231498 15:66038690-66038712 CCTATTATGAAACAGATACCAGG + Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1140299722 16:73745251-73745273 CATATTATGAAACAACTACTAGG - Intergenic
1146780756 17:35669582-35669604 CCAGTTATGAAGCACCTACCAGG + Intronic
1162046163 19:8001842-8001864 CAAAATATCAACCACGTGCCAGG + Intronic
941016583 2:160364330-160364352 TAAATTGTGAAACACGTACGAGG - Intronic
941339916 2:164294259-164294281 GAAATTATGAAACACATAAATGG + Intergenic
942422108 2:175818967-175818989 AAAATTATGAAACACATAAGAGG - Intergenic
946812304 2:223538890-223538912 TAAATCATGAAACCCGTGCCAGG + Intergenic
1170823168 20:19771374-19771396 TATATTATGAAACATATACCTGG - Intergenic
1171114595 20:22513705-22513727 CAAACTAGGAAACCCGTTCCAGG - Intergenic
1178760923 21:35402058-35402080 AAAATTCTGAAAGACGTGCCAGG - Intronic
957499391 3:81034367-81034389 CAAATTATTGAACACCTAACTGG + Intergenic
959621211 3:108400360-108400382 CAATTCATGAAACAGGGACCTGG + Intronic
961018397 3:123484412-123484434 CAAATTATTAAACATGTTGCTGG + Intergenic
964786947 3:160407250-160407272 TAAAGTTTGAAACACGAACCAGG + Intronic
971169763 4:24221264-24221286 CAATTTATTGAACACTTACCAGG + Intergenic
971841226 4:31855268-31855290 GAATTTATAAAACACGTACATGG + Intergenic
974500497 4:62694463-62694485 TAAATTATGAAATACTTACATGG + Intergenic
974951844 4:68592331-68592353 CAAAATATGAAAATCCTACCAGG - Intronic
975276745 4:72511159-72511181 CAAATTATGAAACTATTACAAGG + Intronic
981716569 4:147757961-147757983 CAAGCTATGGCACACGTACCAGG - Intronic
982391270 4:154866411-154866433 CAAATTCAGAAATAGGTACCTGG + Intergenic
986487567 5:8254201-8254223 CAAATTATGAAACATCAATCTGG + Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
998439151 5:142141818-142141840 CAATTTATTAAACACCTGCCAGG - Intronic
1004679696 6:17881162-17881184 CAACTTATAAAACTCATACCAGG + Intronic
1004739391 6:18443204-18443226 CATTTTATGAAAAACGTAACAGG + Intronic
1005720311 6:28595036-28595058 CAAGTTATGAAATGTGTACCTGG + Intronic
1010343440 6:74783879-74783901 CAAATTAAAAAACATGTAACTGG + Intergenic
1012189571 6:96262685-96262707 CAAGTTATGAAACTACTACCAGG + Intergenic
1014119364 6:117705472-117705494 CAAGATATGAAGCACGTAACAGG + Intronic
1016382778 6:143501967-143501989 CTATTTATGAAACCCATACCTGG - Exonic
1024217496 7:47259736-47259758 CAAAATAGGAAACATCTACCTGG - Intergenic
1027977857 7:85181822-85181844 AAAATTATGAAACATGAACATGG + Intronic
1038900088 8:31832418-31832440 CAAATTATGAAAAATTTACTGGG - Intronic
1045070494 8:98499337-98499359 CAAATTATGACAGACTTACTTGG - Intronic
1047100945 8:121675273-121675295 CAAATTGTGAGACAGGTACGTGG + Intergenic
1060651495 9:125331186-125331208 AAAATTATAAAACACATATCAGG - Intronic
1188027679 X:25227555-25227577 CAAAATATGAAACTCCTACAAGG + Intergenic
1190845158 X:54183957-54183979 CCAATTAAGAAAGACGTAACTGG + Intergenic
1193954080 X:87836851-87836873 TAAATTATGAAAAAAGAACCAGG - Intergenic
1196518371 X:116640857-116640879 GAAATGCTGAAACACTTACCTGG - Intergenic