ID: 907718511

View in Genome Browser
Species Human (GRCh38)
Location 1:56950311-56950333
Sequence CTGCTCTTACAGCCTCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907718511_907718515 -1 Left 907718511 1:56950311-56950333 CCATGAGGAGGCTGTAAGAGCAG No data
Right 907718515 1:56950333-56950355 GTGCAGGTGATGGTTGATGAGGG 0: 1
1: 0
2: 2
3: 20
4: 296
907718511_907718519 21 Left 907718511 1:56950311-56950333 CCATGAGGAGGCTGTAAGAGCAG No data
Right 907718519 1:56950355-56950377 GTCTGGTCTAAGGCAGTGGCTGG 0: 1
1: 0
2: 4
3: 19
4: 184
907718511_907718520 24 Left 907718511 1:56950311-56950333 CCATGAGGAGGCTGTAAGAGCAG No data
Right 907718520 1:56950358-56950380 TGGTCTAAGGCAGTGGCTGGAGG 0: 1
1: 0
2: 1
3: 28
4: 230
907718511_907718514 -2 Left 907718511 1:56950311-56950333 CCATGAGGAGGCTGTAAGAGCAG No data
Right 907718514 1:56950332-56950354 AGTGCAGGTGATGGTTGATGAGG 0: 1
1: 0
2: 1
3: 22
4: 310
907718511_907718516 4 Left 907718511 1:56950311-56950333 CCATGAGGAGGCTGTAAGAGCAG No data
Right 907718516 1:56950338-56950360 GGTGATGGTTGATGAGGGTCTGG 0: 1
1: 0
2: 2
3: 36
4: 429
907718511_907718517 11 Left 907718511 1:56950311-56950333 CCATGAGGAGGCTGTAAGAGCAG No data
Right 907718517 1:56950345-56950367 GTTGATGAGGGTCTGGTCTAAGG No data
907718511_907718518 17 Left 907718511 1:56950311-56950333 CCATGAGGAGGCTGTAAGAGCAG No data
Right 907718518 1:56950351-56950373 GAGGGTCTGGTCTAAGGCAGTGG 0: 1
1: 0
2: 3
3: 27
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907718511 Original CRISPR CTGCTCTTACAGCCTCCTCA TGG (reversed) Intronic
No off target data available for this crispr