ID: 907723776

View in Genome Browser
Species Human (GRCh38)
Location 1:56999760-56999782
Sequence ATCTGATGGCAGGAGTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907723776_907723784 26 Left 907723776 1:56999760-56999782 CCCCAAGACTCCTGCCATCAGAT 0: 1
1: 0
2: 0
3: 19
4: 168
Right 907723784 1:56999809-56999831 TTATGTTTGTATTCTTCCAGTGG 0: 1
1: 0
2: 2
3: 32
4: 406
907723776_907723785 27 Left 907723776 1:56999760-56999782 CCCCAAGACTCCTGCCATCAGAT 0: 1
1: 0
2: 0
3: 19
4: 168
Right 907723785 1:56999810-56999832 TATGTTTGTATTCTTCCAGTGGG 0: 1
1: 0
2: 1
3: 26
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907723776 Original CRISPR ATCTGATGGCAGGAGTCTTG GGG (reversed) Intronic
900644232 1:3701907-3701929 CTCTGAGGTCAGGAGTCCTGGGG - Intronic
901769307 1:11522467-11522489 ATCTGTGGGCAGGAGGCCTGTGG - Intronic
902626439 1:17679322-17679344 CTCTGAGGGCAGGAGTGTTGGGG + Intronic
904382579 1:30121343-30121365 ATCTGAAGGTAGGAGCATTGTGG + Intergenic
907723776 1:56999760-56999782 ATCTGATGGCAGGAGTCTTGGGG - Intronic
908805428 1:67925994-67926016 ATTTGAGGCCAGGAGTTTTGAGG - Intergenic
912369415 1:109162066-109162088 ATTGGATGGCAGGAGACTTGGGG - Intronic
914760912 1:150597537-150597559 ATCTGAGGCCAGGAGTTTTAAGG - Intergenic
914850385 1:151309806-151309828 ATCTGACGGCAGAAGCCATGGGG + Intronic
916660076 1:166915400-166915422 ATCTGATCACAGGAGTCTCCTGG + Exonic
918490084 1:185072094-185072116 AAATGGTGGCAGGAGCCTTGGGG + Intronic
924437114 1:244051139-244051161 AGCTGGTGGCAGGAGTGTAGAGG + Intronic
1068235658 10:54229526-54229548 ATCTCATGGGAGGAAGCTTGTGG + Intronic
1072313868 10:94183003-94183025 ATCTGATGGCAAAGGCCTTGAGG - Intronic
1073875894 10:107920823-107920845 CTCTGATGGCAGGAGACTGGAGG - Intergenic
1073926344 10:108520653-108520675 ACCTGATGGCAGCAGATTTGGGG - Intergenic
1074265667 10:111900746-111900768 TTCTGATGACAGCAGTCTTGAGG + Intergenic
1074418265 10:113286273-113286295 ATCTGAGCTCAGGAGACTTGGGG + Intergenic
1077082159 11:729007-729029 ATCTGGGGGCTGGAGTCTGGGGG - Intergenic
1079137209 11:17782424-17782446 AGCTGCTGTCAGGGGTCTTGGGG - Exonic
1079303516 11:19301167-19301189 ATCTGATGGTAGCTGGCTTGTGG + Intergenic
1081471027 11:43371305-43371327 ATTGGGTGGGAGGAGTCTTGTGG - Intronic
1081991275 11:47338925-47338947 TTCTGAAGGCTGGGGTCTTGAGG - Intronic
1084326284 11:68402130-68402152 ATCTGGTAGCAGGAGGCCTGTGG + Intronic
1093101493 12:15034781-15034803 ATCTGATGGTTTGAGTTTTGGGG - Intergenic
1094330188 12:29282965-29282987 AATTAATGGCAGGATTCTTGAGG + Intronic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1096808905 12:54157458-54157480 CTCTATTGGCATGAGTCTTGAGG - Intergenic
1098820615 12:75222971-75222993 ATCTGATGGGAAGAGGGTTGAGG - Intergenic
1100852510 12:98728063-98728085 ATCTGAGGAAAGCAGTCTTGTGG - Intronic
1101781083 12:107836701-107836723 CTGTGATGGAAGGAGTCTTCAGG - Intergenic
1102436231 12:112926143-112926165 ATCTGATGGCAGGAGCCTGTGGG + Intronic
1102482456 12:113233164-113233186 ATCTCATGGCAGGGGGCCTGAGG - Intronic
1105620266 13:22059843-22059865 ATCTGAAGACAGGAGACTAGAGG + Intergenic
1105999683 13:25709965-25709987 ATCTGCTGCCAAGAGTCTTCAGG + Intronic
1106114871 13:26808786-26808808 ATCTGAAGTGGGGAGTCTTGTGG - Intergenic
1106388174 13:29308249-29308271 ATCAGATGGCTGGAGGCATGTGG - Intronic
1109142025 13:58725306-58725328 AGCTGGTGGCAGGAGTGTGGAGG + Intergenic
1110055845 13:70969879-70969901 AACTGGTGTCAGGTGTCTTGAGG + Intergenic
1112589549 13:100750735-100750757 GTCTGCTGGCAGGAGACTGGAGG - Intergenic
1113769607 13:112899655-112899677 ACCTGGGGCCAGGAGTCTTGGGG - Intronic
1117846044 14:59912895-59912917 ATCTGGTGGGAGGAGTCTTTAGG - Intergenic
1118210474 14:63761521-63761543 ATCTAATGGCAGGAAGCTGGAGG + Intergenic
1119189139 14:72668022-72668044 ATCTCATGGGAGTAGTCATGAGG + Intronic
1122157093 14:99756210-99756232 ATCTGATGGCATCAGGGTTGGGG + Intronic
1122706763 14:103626736-103626758 CTCTGAGGGCAGGAGTCCTCAGG - Intronic
1124619184 15:31264487-31264509 CTCGGATGGCAGGGGTGTTGGGG - Intergenic
1127090605 15:55462951-55462973 ATTTGAGGTCAGGAGTTTTGAGG + Intronic
1128836156 15:70810700-70810722 ATCTGCTGAGAGGAGACTTGAGG + Intergenic
1130379850 15:83362174-83362196 AGCTGCTGCCAGGAGTCATGAGG + Intergenic
1131242237 15:90756507-90756529 ATCTGAACACAGCAGTCTTGAGG + Intronic
1131615988 15:94017893-94017915 ATGAGATGGAGGGAGTCTTGAGG + Intergenic
1133606788 16:7395272-7395294 ATCTGATGACAGGTGTGTTGGGG - Intronic
1138124755 16:54429575-54429597 ATCTGCTGCCAGCACTCTTGTGG + Intergenic
1139303327 16:65963231-65963253 ATCAAATTGCAGGAGTCTGGGGG + Intergenic
1140119665 16:72072623-72072645 TTCTGATGGCAAGAGACATGAGG - Intronic
1144274291 17:13650324-13650346 ACCGGAAGGCAGGAGTCCTGGGG + Intergenic
1146000363 17:29126946-29126968 ATCTGGCAGCAGGACTCTTGAGG - Intronic
1147050730 17:37792718-37792740 AAGAGATGGCAGGAGTTTTGAGG - Intergenic
1147911649 17:43859648-43859670 GTCTGATGTCAGGAGTCCTCTGG + Intronic
1150031065 17:61735907-61735929 CTCTGATTGCAGCAGTTTTGTGG + Intronic
1151536565 17:74742209-74742231 ATGGGAGGGCAGGAGTCATGTGG - Intronic
1151695162 17:75711543-75711565 ACCTGAGGTCAGGAGTTTTGAGG - Intergenic
1153179393 18:2415992-2416014 ATTTGATAGCAGGAGGCTGGGGG - Intergenic
1155531862 18:26775561-26775583 CTCTGATGACAGAAGTCATGGGG + Intergenic
1158391735 18:57050366-57050388 AGCTGAAGGAAGGAGTCTTCTGG - Intergenic
1158448370 18:57540949-57540971 GTGTGATGGCAGGAATCTAGGGG - Intergenic
1161143469 19:2663155-2663177 ATCTGCTTGGAGGAGTCATGTGG - Intronic
1161678084 19:5664279-5664301 AACTGAAGGCAGGAGACCTGCGG - Intronic
1166126821 19:40719706-40719728 ACTTGAGGTCAGGAGTCTTGAGG - Intronic
924960133 2:27244-27266 ATCTTATGGCAGCAATCTTGTGG - Intergenic
925335978 2:3099620-3099642 ATCTGATGGCTGGAGGCCAGGGG - Intergenic
926134402 2:10326389-10326411 AGCAGATGGCAGGAGCCCTGTGG + Intronic
927413958 2:22857124-22857146 TGGTGATGGCAGGAGCCTTGTGG - Intergenic
929644596 2:43613995-43614017 ATCAGATGGCAGGATCCTGGAGG + Intergenic
929789902 2:45014483-45014505 GTCTGATCACAGGATTCTTGGGG + Intergenic
930442723 2:51429309-51429331 AGCTGTTGGCAGGAGGCTTCAGG - Intergenic
930916009 2:56689041-56689063 ATGTGAGGGCAGGAGTGTTAAGG + Intergenic
932106858 2:68951544-68951566 TGCTGATGAAAGGAGTCTTGGGG + Intronic
933274525 2:80269196-80269218 GTGTGGTGGCAGGGGTCTTGTGG + Intronic
934561891 2:95317805-95317827 AGCTGAGGGCAGGAGTCGGGCGG + Intronic
935535537 2:104288877-104288899 TTCTGATGCCATCAGTCTTGGGG - Intergenic
936816599 2:116468518-116468540 ATCTCATGGCTAGAGTCCTGAGG + Intergenic
938064145 2:128272026-128272048 ACCTGAAGGCAGGAGCCTGGTGG + Intronic
938275078 2:130012933-130012955 AATTAATGGCAGGATTCTTGAGG - Intergenic
938308621 2:130270276-130270298 ATCTCCTGGGAGGATTCTTGGGG + Intergenic
938326035 2:130403662-130403684 AATTAATGGCAGGATTCTTGAGG - Intergenic
938363907 2:130717803-130717825 AATTAATGGCAGGATTCTTGAGG + Intergenic
938409226 2:131050226-131050248 CTGTGAGGGCTGGAGTCTTGGGG - Exonic
938440294 2:131324348-131324370 AATTAATGGCAGGATTCTTGAGG + Intronic
941955205 2:171196722-171196744 ATCTGAAGGCAGCAGTCTGGAGG + Intronic
942659588 2:178250383-178250405 AACTTAGGGCAGGAGTTTTGAGG - Intronic
943489778 2:188536484-188536506 ATCAGATGGCTGTAGACTTGTGG + Intronic
944812598 2:203342492-203342514 ATCTGCTGGCAGAAAACTTGTGG - Intronic
944861407 2:203819052-203819074 CTGAGATGGCAGCAGTCTTGTGG - Intergenic
1170470408 20:16662853-16662875 AGCTGATGTCTGGAGTCTTCAGG + Intergenic
1171148845 20:22809451-22809473 ATGTGATGGCAGGAGCCTAGGGG - Intergenic
1172968894 20:38859118-38859140 TTCTGATGGCAGGAGTTTGATGG + Intronic
1173259505 20:41421112-41421134 ATCTGATGACAGGTTTCTTTTGG + Exonic
1173615276 20:44399381-44399403 ATTTGATGTCAGGAGACCTGGGG - Intronic
1174176521 20:48648857-48648879 ATCTGCTGGCAAGAGCCTCGTGG + Intronic
1174378078 20:50139447-50139469 ATGTGTTTCCAGGAGTCTTGGGG - Intronic
1177355266 21:19998783-19998805 ATCTCCTGCCAGGAGTCATGGGG + Intergenic
1177781814 21:25630116-25630138 ATCTGAAGGCTGGAGTCTGAAGG - Intergenic
1178843815 21:36157626-36157648 ACCTAATGGCAGCAGACTTGTGG - Intronic
1179017538 21:37606138-37606160 CTCCGGTGGCAAGAGTCTTGGGG + Intergenic
1182346349 22:29668519-29668541 ATGGGCTGGCAGGAGTCTTTTGG + Intronic
1182758727 22:32703712-32703734 AACTGATGGCAAAAGTCTTGAGG + Intronic
950019475 3:9777004-9777026 AAGTGATGGCAGGAGCTTTGTGG - Intronic
950280798 3:11706281-11706303 AGCAGATGGCAGGTGCCTTGTGG - Intronic
950286675 3:11750660-11750682 TTCTGGTGGCTGAAGTCTTGTGG + Intergenic
950464997 3:13148433-13148455 ATCTTAAACCAGGAGTCTTGAGG + Intergenic
950628746 3:14267394-14267416 AGATGATGGCAGGTGACTTGTGG - Intergenic
950706573 3:14786068-14786090 ACCTGCTGGCAGGAGTCTGGGGG - Intergenic
954921761 3:54197351-54197373 ATATTATGGCAGCAGACTTGAGG - Intronic
954956356 3:54522659-54522681 ATCTCATGGCAGGAGGCTGAAGG + Intronic
957713269 3:83891648-83891670 ATGTGATGGCAGTTCTCTTGTGG + Intergenic
959056329 3:101571387-101571409 CTCAGATGGGAGGATTCTTGAGG + Intergenic
959908069 3:111732328-111732350 ATCAGATGGCAGGACTGTGGGGG - Intronic
961980433 3:131072443-131072465 ATATGATGGTAGGGGTGTTGGGG + Intronic
962455382 3:135560586-135560608 GTCTGATGGGAGGAGGCATGAGG - Intergenic
963561377 3:146870282-146870304 ATCAGATGGCAGTAGGCATGCGG + Intergenic
963732863 3:148989619-148989641 AGCTGATGGCAGGAGGGTTCTGG + Intergenic
964232664 3:154488478-154488500 ATCTGATGCTATGTGTCTTGGGG - Intergenic
966001942 3:174960017-174960039 ATATGATGATGGGAGTCTTGTGG + Intronic
967635339 3:191795293-191795315 ATCTGCTGCCAGGTGTTTTGTGG + Intergenic
972050933 4:34732335-34732357 TTCTGCTGGCAGAAGTCTTCAGG - Intergenic
972736214 4:41844195-41844217 GTCTTGTGGCAGGAATCTTGTGG - Intergenic
973083389 4:46024062-46024084 ACCTGAGGGCAGGAGTTTTCTGG + Intergenic
975814156 4:78200125-78200147 GTCTAATGGCTGGAGTCATGTGG + Intronic
976317684 4:83676302-83676324 ATGTGATGGCAGCAGTTTTTAGG + Intergenic
980516385 4:133867668-133867690 ATTTGAAGGCAGGATTCTTTAGG + Intergenic
980523280 4:133958513-133958535 AACTGATGCCAGGAGTAGTGGGG - Intergenic
982613564 4:157610804-157610826 ATCTGAAGGCAGGAATTTTAGGG - Intergenic
983280747 4:165678073-165678095 AACTGATGGGAGGAGTGCTGAGG + Intergenic
984874666 4:184356610-184356632 ATCTGTTGGCAGCAGTGCTGGGG - Intergenic
985969597 5:3364566-3364588 CTCTGATGCCAGGAGGCTGGGGG + Intergenic
990942855 5:61220774-61220796 ACCAGAGGGCAGGAATCTTGGGG + Intergenic
993450989 5:88071901-88071923 ATCTGATGATTAGAGTCTTGGGG - Intergenic
994970022 5:106724773-106724795 ATTTGAGGGCAGGGGTCTTGTGG - Intergenic
1001848336 5:174941036-174941058 AAGTGATGGGAGGAGTCTGGAGG + Intergenic
1002525799 5:179815604-179815626 ATCTGGAAGCAGGAGCCTTGGGG - Intronic
1003290318 6:4775082-4775104 AACTGGTGGGAGGAGCCTTGTGG + Intronic
1004846368 6:19647555-19647577 ATTTGATGGCAGCAGACTTCTGG + Intergenic
1007074249 6:39056731-39056753 AAATGATGGCAGAAGTCCTGGGG - Intronic
1009394101 6:63177386-63177408 ATATGAGGGCATGAGTCTTTCGG + Intergenic
1010897731 6:81385932-81385954 TTCTGATTGCAAGACTCTTGAGG + Intergenic
1011883454 6:92060166-92060188 ATGTCATGGCAGGAACCTTGTGG + Intergenic
1011985069 6:93433185-93433207 ATCAGATGGCAGGAGGGTTGAGG - Intergenic
1014369113 6:120583069-120583091 ATCTGATGATATGTGTCTTGGGG + Intergenic
1014965419 6:127742091-127742113 ACCTGATGTCAGGAGTTTTGAGG + Intronic
1014975779 6:127880490-127880512 ATTTGATTTCAGGAGTCCTGAGG + Intronic
1016480671 6:144477766-144477788 ATCTGATGGCATGTGCCTTAAGG + Intronic
1017772226 6:157652244-157652266 ACCTGAAGGCAGTAGTCATGAGG + Intronic
1017859857 6:158385766-158385788 ATCTGATGGCAAGACTATTTTGG - Intronic
1018199678 6:161383510-161383532 ATCGGATGGCAGGAGGCAGGAGG + Intronic
1019162901 6:170080928-170080950 AGCAGATGGCAGGTGTCATGGGG - Intergenic
1020018545 7:4846762-4846784 ACCTGAGGTCAGGAGTTTTGAGG - Intronic
1028337891 7:89680070-89680092 AACTAATGTCAGGAGTCTTGGGG - Intergenic
1029707803 7:102284960-102284982 CCCTGAGGGCAGGAGGCTTGAGG - Intergenic
1030377701 7:108772656-108772678 TTTAAATGGCAGGAGTCTTGTGG + Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034203851 7:149299029-149299051 CTCTGATGGCAGCTGGCTTGGGG + Intergenic
1035330691 7:158095148-158095170 AGCTGATTGCAGGAGGCTTTGGG - Intronic
1037077957 8:14745373-14745395 ATCTGTTGCCAGGAGCCTTGTGG + Intronic
1038768750 8:30455999-30456021 ATCTGAAGGCCAGAGGCTTGGGG + Intronic
1040906503 8:52474578-52474600 GTCTGAGGGCAGGAGGCTTGGGG - Intergenic
1040962606 8:53050795-53050817 ATCTGATGCCTTGTGTCTTGGGG + Intergenic
1041497979 8:58507952-58507974 ATCTGATGGCATGGGGTTTGTGG - Intergenic
1045672636 8:104573393-104573415 ATCTGAAGGCAGGAGCTGTGTGG - Intronic
1049792104 8:144476847-144476869 AGGTGGTGGCAGGAGTCCTGAGG - Intergenic
1052922316 9:33981393-33981415 ATCTGAAGGCTGGAGTGTAGTGG + Intronic
1052942890 9:34144402-34144424 ACCTGAGGTCAGGAGTTTTGAGG + Intergenic
1059204946 9:112455818-112455840 ATCTGATGGCAGGAAGCTGAAGG - Intronic
1059906200 9:118989691-118989713 GTCTGATGGCAGGAGTGTAGGGG + Intergenic
1060511751 9:124239766-124239788 ATCTCATGGCTCAAGTCTTGAGG + Intergenic
1203493439 Un_GL000224v1:128408-128430 AGATGATGGCAGGAGTGTTCTGG - Intergenic
1203506059 Un_KI270741v1:70283-70305 AGATGATGGCAGGAGTGTTCTGG - Intergenic
1185992938 X:4912346-4912368 ATGTGGTGGCAGGAGCCTGGTGG + Intergenic
1187831070 X:23381321-23381343 GCCTGATGGCAGGGTTCTTGCGG + Intronic
1190552754 X:51601789-51601811 ATTTGAGGGCAGGAGACTTCTGG + Intergenic
1192829576 X:74737169-74737191 CTCTGAGGTCTGGAGTCTTGGGG + Exonic
1194329113 X:92559596-92559618 ATCTAATAGCAGAGGTCTTGTGG + Intronic
1194922847 X:99788648-99788670 ATCAGATGGCTGTAGTCATGTGG + Intergenic
1200013549 X:153140210-153140232 GTTTGATGGCAGAAGTTTTGGGG + Intergenic
1200019995 X:153195264-153195286 GTTTGATGGCAGAAGTTTTGGGG + Intergenic
1200026052 X:153259708-153259730 GTTTGATGGCAGAAGTTTTGGGG - Intergenic
1200637815 Y:5678786-5678808 ATCTAATAGCAGAGGTCTTGTGG + Intronic