ID: 907724169

View in Genome Browser
Species Human (GRCh38)
Location 1:57003254-57003276
Sequence GCTCGACTACAGCAGCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907724165_907724169 28 Left 907724165 1:57003203-57003225 CCACCGTTTGCAGACTACTCCAC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 907724169 1:57003254-57003276 GCTCGACTACAGCAGCCAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 62
907724168_907724169 1 Left 907724168 1:57003230-57003252 CCTTTAACTATCTATGAATTATG No data
Right 907724169 1:57003254-57003276 GCTCGACTACAGCAGCCAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 62
907724166_907724169 25 Left 907724166 1:57003206-57003228 CCGTTTGCAGACTACTCCACATG No data
Right 907724169 1:57003254-57003276 GCTCGACTACAGCAGCCAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 62
907724167_907724169 9 Left 907724167 1:57003222-57003244 CCACATGTCCTTTAACTATCTAT No data
Right 907724169 1:57003254-57003276 GCTCGACTACAGCAGCCAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907724169 Original CRISPR GCTCGACTACAGCAGCCAAG TGG Intronic
906285891 1:44587601-44587623 GCTAGACTACAGCAGCCTGCGGG - Intronic
907724169 1:57003254-57003276 GCTCGACTACAGCAGCCAAGTGG + Intronic
907950816 1:59181973-59181995 GCTTGAATAAAGCATCCAAGAGG - Intergenic
909667914 1:78156450-78156472 GTTCAACTAAAGCAGACAAGAGG - Intergenic
912957738 1:114167347-114167369 GCTCTGCAGCAGCAGCCAAGAGG + Intergenic
923495753 1:234522791-234522813 GCTGGACTCCACCATCCAAGGGG - Intergenic
924776118 1:247115293-247115315 GCTCCACTCCAGCAGGCATGGGG - Intergenic
1064365160 10:14700937-14700959 GCTGGATTACAGCACCCCAGGGG - Intronic
1067175053 10:43939820-43939842 GCTGAACAAAAGCAGCCAAGGGG + Intergenic
1069439785 10:68417730-68417752 CCTCAATTACAACAGCCAAGGGG + Intronic
1070085690 10:73235196-73235218 GCTCGACTAGAGTCGCCATGGGG - Exonic
1070938343 10:80320005-80320027 GCTCCACTCCAGCTGCAAAGGGG + Intergenic
1076191262 10:128485082-128485104 GATCGGTTACAGCAGCCAAAGGG + Intergenic
1076345204 10:129774693-129774715 GCTGGAGGACAGCAGCCAAAGGG - Intergenic
1086319560 11:85630476-85630498 TACCTACTACAGCAGCCAAGTGG - Intronic
1094478838 12:30864006-30864028 GCTTGACTACTGTAGCCCAGTGG - Intergenic
1098936946 12:76490874-76490896 GCTCTGCTGCAGCATCCAAGTGG - Intronic
1103788542 12:123452124-123452146 GCTGGAGTACAGCAGCATAGTGG - Intergenic
1105572895 13:21620750-21620772 GCTTGACTGCATCAGCAAAGTGG + Intergenic
1107627139 13:42300115-42300137 GCTGGAGTACAGCCTCCAAGAGG - Exonic
1119179820 14:72598199-72598221 GCTCAACTCCGGCAGCCAGGAGG - Intergenic
1125817007 15:42594232-42594254 GCTGGACTGCAGGAACCAAGAGG + Intronic
1132949154 16:2550909-2550931 GCTGGCCCACAGCAGGCAAGTGG - Intronic
1132965434 16:2651219-2651241 GCTGGCCCACAGCAGGCAAGTGG + Intergenic
1134379246 16:13709018-13709040 GCTGGACTCCAGCAGCCAGAAGG - Intergenic
1136541623 16:30930465-30930487 GGTCGGATCCAGCAGCCAAGGGG - Exonic
1142044662 16:87918063-87918085 GCCCCACTAGAGGAGCCAAGAGG + Intronic
1151645755 17:75430342-75430364 GCTGGACTCCAGCAGCCAGGGGG + Intergenic
1163286084 19:16348890-16348912 CCTCCAATACAGCAGACAAGAGG - Intergenic
1165864116 19:38925624-38925646 GCTGGACTACAGCAGCCATCTGG + Intronic
928276509 2:29905731-29905753 GCTTGACAAATGCAGCCAAGGGG - Intronic
933112719 2:78424326-78424348 GCTAGAGTACAGCAGCCTCGAGG - Intergenic
937973423 2:127566717-127566739 GCTCTACTACAGCCGCCATATGG + Exonic
937988918 2:127651512-127651534 GCTGCACTACCGCAGCCATGGGG + Exonic
940764286 2:157773001-157773023 TCTGGAGAACAGCAGCCAAGTGG + Intronic
945664332 2:212721935-212721957 GATTGATTACAGCAGCCATGGGG + Intergenic
945957565 2:216100326-216100348 GCTGGACCACAGCAGCGTAGAGG - Exonic
948879745 2:240850661-240850683 GCTGGGCTACAGAAGGCAAGAGG + Intergenic
1169126898 20:3135313-3135335 TGTAGACTACAGGAGCCAAGAGG + Intronic
1169665405 20:8029475-8029497 ACTTCACTTCAGCAGCCAAGTGG + Intergenic
1172636587 20:36414215-36414237 GCTTGAAAACAGCAGCCAAGGGG + Intronic
1175832899 20:61976744-61976766 GCAGGAATTCAGCAGCCAAGCGG - Intronic
1178617838 21:34148898-34148920 GCTCCCCTTCAGCAGCCCAGCGG - Intergenic
953763980 3:45719091-45719113 GCTAGGCTACTGCAGCTAAGGGG - Intronic
958491960 3:94787162-94787184 CCTCTATTACAGCTGCCAAGAGG + Intergenic
962976755 3:140452478-140452500 GCACGACTACAGCATCACAGAGG - Intronic
983525600 4:168757668-168757690 GCCCAGCTACAGCAGCCCAGAGG - Intronic
986172868 5:5327849-5327871 CCTAGAATACAGCAGACAAGAGG - Intergenic
998760991 5:145432266-145432288 GCTAAACTACAACAGCCAAAAGG - Intergenic
1001540263 5:172533003-172533025 TCTCCACTACACCAGCCATGTGG + Intergenic
1006891934 6:37436121-37436143 GCTCGACGGCCGCAGCAAAGAGG - Intronic
1008000221 6:46352497-46352519 CCTCGTGTACATCAGCCAAGGGG - Intronic
1017499793 6:155013170-155013192 GCTGTACTACAGGAGCCATGGGG - Intronic
1018870788 6:167780604-167780626 GTTCCACCACAGCAGACAAGGGG - Intergenic
1021567017 7:22026018-22026040 GCACGACTACAGCATTGAAGGGG + Intergenic
1029617919 7:101671382-101671404 GCTTGCCTACAGCAGACCAGGGG - Intergenic
1030562181 7:111102387-111102409 GCTAAACTCCAGCAGCTAAGAGG - Intronic
1033307570 7:140236261-140236283 GCTGGGCTACAGCAGCCAGCAGG - Intergenic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1048730806 8:137438523-137438545 GCTTGATTGCAGCAGCCATGTGG + Intergenic
1049435679 8:142585172-142585194 GCTCCACTGCAGAAGCCACGTGG - Intergenic
1060665827 9:125431694-125431716 GCTCCATTCCAGCAGCCCAGTGG + Intergenic
1062037848 9:134390638-134390660 GCTCAACGACACCAGCCCAGAGG - Intronic
1062386145 9:136312270-136312292 GTTCTACTCCAGCAGCCGAGTGG - Intergenic
1062678126 9:137760315-137760337 ACTGGCCAACAGCAGCCAAGAGG - Intronic
1200054169 X:153450091-153450113 GCTCCACCACAGCAGACCAGGGG - Intronic