ID: 907727838

View in Genome Browser
Species Human (GRCh38)
Location 1:57036423-57036445
Sequence CTCCAAAGGTTGCCCCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907727838_907727843 7 Left 907727838 1:57036423-57036445 CCTGTTTGGGGCAACCTTTGGAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 907727843 1:57036453-57036475 GTGCACTTCCTCCAGCCAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 128
907727838_907727842 6 Left 907727838 1:57036423-57036445 CCTGTTTGGGGCAACCTTTGGAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 907727842 1:57036452-57036474 AGTGCACTTCCTCCAGCCAGTGG 0: 1
1: 0
2: 1
3: 21
4: 211
907727838_907727844 8 Left 907727838 1:57036423-57036445 CCTGTTTGGGGCAACCTTTGGAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 907727844 1:57036454-57036476 TGCACTTCCTCCAGCCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907727838 Original CRISPR CTCCAAAGGTTGCCCCAAAC AGG (reversed) Intronic
901643324 1:10704144-10704166 CTCCTCAGGATGCCCCAAGCTGG - Intronic
907596442 1:55724690-55724712 TACTAAAGGTTGCCCCAAATGGG + Intergenic
907727838 1:57036423-57036445 CTCCAAAGGTTGCCCCAAACAGG - Intronic
909607115 1:77518763-77518785 CCCCAAAGGTCTCCCCAGACAGG - Intronic
912563448 1:110566703-110566725 CAGCAAAGGTTTCCCCAAAATGG - Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
916656551 1:166881694-166881716 CTCCAAAGGTATCACCAGACTGG - Intergenic
919530540 1:198713528-198713550 CTCCCAAGATTACACCAAACTGG - Intronic
920926303 1:210344665-210344687 CCCCAAAGGCTCCCCAAAACGGG - Intronic
1064639692 10:17403112-17403134 CCCCACAGATTACCCCAAACAGG + Intronic
1073286982 10:102395398-102395420 ATCCCAAGGTTGCTCCAGACCGG + Intronic
1074916629 10:117962891-117962913 CCCCAAATGATGCCCCAAATGGG - Intergenic
1076215838 10:128692903-128692925 CTCCAAAGGTTGCTCCTCAGAGG + Intergenic
1076484478 10:130807313-130807335 CACCAAAGCATGCCCCAAGCAGG + Intergenic
1076844035 10:133060407-133060429 CTCCACAGCTGGCACCAAACTGG + Intergenic
1077224250 11:1433209-1433231 CACAAAAGATGGCCCCAAACAGG - Intronic
1084052197 11:66607216-66607238 CTACAAACTTTGCCCCAAGCTGG + Intergenic
1085585271 11:77697574-77697596 CTTCAAAGGTTGCCTGAATCAGG - Intronic
1091783266 12:3227336-3227358 CTCCAAAGCCTGCCCCCAGCAGG - Intronic
1102429192 12:112868456-112868478 CTTCAAAGGCTTCCCCAAACAGG + Exonic
1104647267 12:130505883-130505905 CTCCAAACGCTTCCCCAAAGAGG + Intronic
1106083160 13:26517218-26517240 CTGTAAGGGTTACCCCAAACTGG - Intergenic
1106994852 13:35469936-35469958 ATCCAAAGGCTCCCCCAAAGGGG + Intronic
1108609175 13:52067571-52067593 GTCCAAAGTATGCCCCAAAAAGG - Intronic
1134440571 16:14297370-14297392 CTTCAAACGGTGTCCCAAACTGG + Intergenic
1137815895 16:51397260-51397282 CTCCAAAGGGTGCAGCAACCAGG - Intergenic
1140192121 16:72826978-72827000 CAACAAAGGCTGCCCTAAACTGG + Intronic
1140778102 16:78268682-78268704 CTCCACAGGCTTCCCCAAACTGG + Intronic
1140807769 16:78548941-78548963 CCCCAAATATAGCCCCAAACTGG + Intronic
1141004015 16:80335318-80335340 CTATGAAGGTTGCCCCAGACAGG + Intergenic
1144010407 17:11143013-11143035 CTCCATGTGTTGCTCCAAACTGG + Intergenic
1147979271 17:44264830-44264852 CACCTAAGGTGGCCCCAGACTGG + Intronic
1153917335 18:9757801-9757823 CTCCACAGGTGGCCTCAAAGAGG - Intronic
1154155100 18:11937822-11937844 CTCCAAAGGATGCCCTAAGGAGG - Intergenic
1156185814 18:34661870-34661892 TTATAAATGTTGCCCCAAACTGG - Intronic
1158451080 18:57565946-57565968 CTGCAAAGGGAACCCCAAACTGG + Intronic
1158947294 18:62458051-62458073 TTCCAAAGGCTGGCTCAAACTGG - Intergenic
1160895795 19:1401281-1401303 CTCCAAAGGTAGCCCCCGCCCGG - Exonic
1161593550 19:5139919-5139941 CTCCAAGGGGTTCCCCAAAGGGG - Intronic
1162028327 19:7906421-7906443 CTCCAGAGGTTCCCCCAGGCTGG - Intronic
1165371391 19:35408585-35408607 CCCAAAAGGTTACCCCAAGCTGG - Intergenic
1166387771 19:42391620-42391642 CGCCAAAGTTTCCCCCCAACAGG + Intergenic
930901877 2:56517059-56517081 CTTCCAAGGTTCCCCCAACCAGG + Intergenic
936234855 2:110733507-110733529 CTCCAAAGCATGCCTCCAACTGG - Intronic
938755083 2:134372075-134372097 CTCCAACAGGTGCTCCAAACAGG + Intronic
940433476 2:153622028-153622050 CTATAAAGGAAGCCCCAAACTGG + Intergenic
942447345 2:176086564-176086586 TCCCAAAGGCTGCGCCAAACCGG + Intergenic
945772635 2:214063431-214063453 CTCCATAGGATGCACCAAAAGGG - Intronic
946876270 2:224132826-224132848 TTCCAAGGTTTGCCCCAACCTGG - Intergenic
947782723 2:232784142-232784164 TTCCAACTGTTGCCCTAAACAGG - Intronic
1182095877 22:27625353-27625375 CTCCAAAGGAGGCTCCAAAAAGG - Intergenic
1182598583 22:31441773-31441795 CTTCCAAGTTTGCTCCAAACTGG - Exonic
1183000244 22:34850895-34850917 CTCCAGAGGTTACCCCAAGGTGG - Intergenic
949555373 3:5148001-5148023 CTCCAAACGTTGACCCCAAATGG - Intronic
950206637 3:11085852-11085874 CTCCAGAGGGTGGCCAAAACTGG - Intergenic
951708373 3:25566443-25566465 CTGCAAAGGCTGCTCCAAATTGG + Intronic
952195688 3:31073434-31073456 CTCCAAAGGAGGCCCCAAGTAGG + Intergenic
952200957 3:31126858-31126880 CTCCCACTATTGCCCCAAACTGG + Intergenic
952474451 3:33692358-33692380 ATTCAAATGTTGGCCCAAACAGG + Intronic
954342995 3:49970797-49970819 CTCCTGAGGTTGCACCACACTGG - Intronic
957532547 3:81459380-81459402 ATTCAAAGGTAGCCTCAAACAGG + Intergenic
960135417 3:114099251-114099273 TTCCAAATGTTGCTCCAAAAAGG - Intergenic
968913345 4:3486577-3486599 CTCCCAGGGCTGCCCCCAACGGG - Intronic
969585193 4:8087527-8087549 CTCTACAGGTTCCCCCAAAGGGG + Intronic
971871460 4:32245610-32245632 CTCCAAATCTTGCCATAAACTGG + Intergenic
972579931 4:40386125-40386147 CTCCAAAGTTTGCACCCAACTGG - Intergenic
979671176 4:123361539-123361561 CTACAAAGATTGCCCAAATCTGG + Intergenic
989443791 5:41504722-41504744 CTCCAAAGCTTTCCCAAAACAGG + Intronic
996028487 5:118678727-118678749 TTCCAAAGGGTGCCTCACACGGG + Intergenic
1003138090 6:3448437-3448459 GTCCTGAGGTTGCCACAAACTGG - Intronic
1003694505 6:8389973-8389995 CCCCAAAACTTGCCCCAAAATGG - Intergenic
1019763587 7:2832428-2832450 CTCCACTGACTGCCCCAAACAGG + Intronic
1021605655 7:22406776-22406798 CTCCAAAGTTTTCCCAAATCTGG + Intergenic
1022885665 7:34640800-34640822 CTCCCAAGCTTCCCCCAAAAAGG + Intergenic
1029309048 7:99644262-99644284 CCCCAAATGCTACCCCAAACAGG - Intergenic
1030359028 7:108575974-108575996 CTCCAGAGGTTGCCCTAATGTGG + Intergenic
1037350675 8:17951723-17951745 CTCCAAAGGTAACCCCAACCTGG - Intronic
1046769047 8:118100422-118100444 CTCCAAATGTTACCCTCAACTGG + Intronic
1056554386 9:87676746-87676768 CTCCAAAGGGTGCCCTATTCAGG + Intronic
1057225125 9:93289130-93289152 CTCCAGAGGCTGCCTCAACCAGG + Exonic
1057571435 9:96207107-96207129 CTCCAAGGGACTCCCCAAACTGG - Intergenic
1059035564 9:110750454-110750476 CTCCAAAAGATGTCTCAAACAGG - Intronic
1196580346 X:117371985-117372007 CTCCAAAATGTGCCCCAAAAGGG + Intergenic
1196685310 X:118505536-118505558 CTCCAGATGATGCCCCAAAGGGG + Intronic