ID: 907731297

View in Genome Browser
Species Human (GRCh38)
Location 1:57068714-57068736
Sequence TCGCCTTCACACCCATGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907731295_907731297 0 Left 907731295 1:57068691-57068713 CCATGGCAGAAGGAGGCAGAGCT No data
Right 907731297 1:57068714-57068736 TCGCCTTCACACCCATGCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907731297 Original CRISPR TCGCCTTCACACCCATGCCT GGG Intronic
900210542 1:1453680-1453702 GCGCCGTCACACTCAAGCCTGGG - Intronic
900309596 1:2027284-2027306 CAGCCTTCACACCCAGGCCCTGG - Intronic
901519197 1:9769595-9769617 TCTCCTTCACTCCCAAGCCCTGG - Intronic
901631268 1:10649329-10649351 GCGCCTTCACGGCCTTGCCTAGG + Exonic
902678752 1:18028449-18028471 TTGCCTTCCCACCCCAGCCTGGG + Intergenic
905141411 1:35848087-35848109 TCTCCTTCACTCCCAGCCCTTGG + Intronic
907731297 1:57068714-57068736 TCGCCTTCACACCCATGCCTGGG + Intronic
907936341 1:59045627-59045649 TCTCCTCCACACCCATGCTGGGG + Intergenic
915295507 1:154918579-154918601 ACGCCATCACACTCCTGCCTCGG + Intergenic
917421711 1:174870418-174870440 TCTCCTTCACACACATACATAGG - Intronic
918114948 1:181487791-181487813 TTGCCTTCACACCCGTGACCTGG - Intronic
923457625 1:234178243-234178265 TCTCCTTACCACCTATGCCTCGG - Intronic
1063537952 10:6903453-6903475 ACGCCTTCACACTCCAGCCTGGG + Intergenic
1063568431 10:7192882-7192904 ACGCCTTCACACCCAGTCTTTGG + Intronic
1067503958 10:46833630-46833652 TCGCCTTTGCACCCCAGCCTGGG + Intergenic
1072041494 10:91611179-91611201 TCCCCTTCCCACCCCTGCCATGG - Intergenic
1077287676 11:1775040-1775062 TCCCCTTCACACCCCTGGCTAGG - Intergenic
1078477103 11:11640424-11640446 GCTCCTTCATTCCCATGCCTTGG - Intergenic
1080703804 11:34669078-34669100 TGGCCTCCAAATCCATGCCTGGG + Intergenic
1080877880 11:36293060-36293082 TCCCCATCACACCCAGCCCTAGG + Intergenic
1085339242 11:75720484-75720506 TTACCTTCACTCCCAAGCCTGGG - Intronic
1085554931 11:77411537-77411559 TCCCCTTCACACCCTTCCCTGGG + Intronic
1085752969 11:79178027-79178049 TCACCTTCACACCCTCACCTTGG - Intronic
1088536547 11:110867874-110867896 ACGCCTCACCACCCATGCCTTGG + Intergenic
1089737071 11:120556905-120556927 TCGCCTTGTCACCCTTACCTGGG + Intronic
1090077494 11:123588354-123588376 TCTCCCCCACACCCATGCCAAGG - Intronic
1090473461 11:127000080-127000102 TCTCCTTCAGACCCAGGCCAGGG - Intronic
1090945083 11:131422298-131422320 TCTCCATCACACCCTTGCCGGGG + Intronic
1096884823 12:54706655-54706677 TCTCCTTCCCACCCCAGCCTCGG - Intergenic
1097226598 12:57480222-57480244 TCGCCATCACACTCCAGCCTGGG - Intronic
1101324371 12:103702207-103702229 CAGACTTCATACCCATGCCTTGG + Intronic
1102341525 12:112125687-112125709 TCGCCCACACACCCCTCCCTTGG - Exonic
1102957946 12:117071675-117071697 TCTCCTGCACACCCATCCCCAGG - Intronic
1105837926 13:24226673-24226695 GCTCCTTCCCACCCATCCCTGGG + Intronic
1107977479 13:45704115-45704137 CCTCCTTCACACCCACCCCTAGG - Intronic
1113676531 13:112210771-112210793 TCTGCCTCACACCCATGCCCAGG - Intergenic
1124363009 15:29052813-29052835 TCACCTTCTCACCTCTGCCTTGG - Intronic
1124441473 15:29689076-29689098 GCGCGTGCACACCCAAGCCTCGG - Intergenic
1124606640 15:31174377-31174399 TCACTTTCTCACCCATGTCTGGG + Intergenic
1126284499 15:46996110-46996132 TCTGGTTCACTCCCATGCCTGGG + Intergenic
1127329106 15:57921633-57921655 ACCACTTCCCACCCATGCCTGGG + Intergenic
1129336658 15:74856076-74856098 CCAGCTTCACAGCCATGCCTGGG + Intronic
1130837054 15:87661658-87661680 CTACCTCCACACCCATGCCTAGG - Intergenic
1131831197 15:96355628-96355650 TCACCCCCACCCCCATGCCTAGG + Intergenic
1132930203 16:2455162-2455184 TGGGCTTCACACCCAGACCTGGG + Intronic
1133385303 16:5365008-5365030 TCGCATTCAAATCCATGTCTCGG - Intergenic
1134068334 16:11244710-11244732 TCTCCTTCACCCCCGTGCCCTGG + Intergenic
1134300899 16:12989875-12989897 TCGGCTTCACACCCAGGCGACGG - Intronic
1137489879 16:48923567-48923589 TCCCCTTCCCACCCATGCTATGG + Intergenic
1140904971 16:79402312-79402334 TCTCCTTCTCACCCACACCTGGG - Intergenic
1141000129 16:80299988-80300010 TGGCCTCCACACCATTGCCTAGG - Intergenic
1144231234 17:13206255-13206277 CTGCCTTCACACCCATTTCTTGG + Intergenic
1147203622 17:38821162-38821184 TTGCCCTCACACGCCTGCCTTGG - Intronic
1152138643 17:78523196-78523218 TCGCCATCACACTCCAGCCTGGG - Intronic
1152454067 17:80402751-80402773 CCGCCTTCACACCCTCCCCTTGG + Intergenic
1155514770 18:26613500-26613522 TTGCTTTCACACCCATGTCAAGG - Intronic
1156394078 18:36682224-36682246 CCTCCTTCACACCCATCCCCTGG + Intronic
1157279463 18:46336036-46336058 TCCCCCTCACCCCCATGGCTAGG - Intronic
1158697930 18:59719117-59719139 TCTCCTTCCCACCCAGTCCTGGG - Intergenic
1159771726 18:72553945-72553967 TAGCCTTCATTGCCATGCCTGGG + Intronic
1160371424 18:78375327-78375349 TCGCCATCAAATCCATGTCTGGG + Intergenic
1161558691 19:4958508-4958530 GCGCCTTCACACCGATGCACAGG - Intronic
1164751123 19:30655574-30655596 TTCCCTTCCCACCCATGTCTTGG - Intronic
1166556624 19:43704427-43704449 GTTCCTTCACACCCATACCTTGG - Intergenic
1166776299 19:45315039-45315061 TCTCCACCACACCCATGTCTTGG + Intronic
927096687 2:19752632-19752654 TGGCCTTCAGCCCGATGCCTAGG + Intergenic
927513026 2:23656370-23656392 TCGCCTTCCCTCACATCCCTCGG - Intronic
927567290 2:24123853-24123875 TCCCCGTCGCACCCGTGCCTCGG + Intronic
928314448 2:30234876-30234898 TTTCCTTCCCAGCCATGCCTGGG + Intronic
928325284 2:30314830-30314852 TCACCTACACACCCATTCCCTGG + Intronic
930720838 2:54636105-54636127 TTGCTTTCTAACCCATGCCTTGG + Intronic
932656719 2:73616946-73616968 TCTCCATCACACACCTGCCTGGG + Intergenic
934951174 2:98576663-98576685 TCCCCTTCCAAGCCATGCCTGGG - Intronic
937669229 2:124521031-124521053 TTGCCTTGAAACCCATGCCTGGG + Intronic
938057820 2:128230409-128230431 TCCCCCCCACACCCCTGCCTTGG + Intergenic
1169513134 20:6286895-6286917 TTGTCTGCACACCCATGGCTTGG - Intergenic
1170937496 20:20822897-20822919 ACGCCTTAATATCCATGCCTTGG + Intergenic
1172189530 20:33053708-33053730 ACGCCTTCACTCCCACTCCTGGG + Intergenic
1175036170 20:56003740-56003762 TCGCCTTCCCAAATATGCCTGGG - Intronic
1175146338 20:56899145-56899167 TTGCCTTCCCACCAATGCTTTGG - Intergenic
1175233823 20:57494514-57494536 TCATAATCACACCCATGCCTTGG + Intergenic
1178560760 21:33637483-33637505 TCACCTTCACCTCAATGCCTGGG + Intronic
1182070375 22:27459265-27459287 TTGCCTTCACATCCCTGTCTTGG + Intergenic
1183986086 22:41571423-41571445 TGGGCTCCACACCCAGGCCTGGG - Intronic
1184401573 22:44277565-44277587 TCCCCTCCACATCCCTGCCTAGG - Intronic
1185094895 22:48800806-48800828 CCTCCTTCACCTCCATGCCTGGG - Intronic
953558619 3:43967138-43967160 TCTCCTTGACACACATTCCTGGG + Intergenic
956959618 3:74383526-74383548 TTGCCATCACACTCCTGCCTGGG - Intronic
958134320 3:89467982-89468004 TCCCCTTCAGACCAATGTCTGGG + Intronic
960423959 3:117483406-117483428 CCTCCCTCACACTCATGCCTCGG - Intergenic
963603142 3:147393914-147393936 TCGCCTTCAAAGCCAGGCCCCGG + Intronic
965871636 3:173272055-173272077 TGCCCTCTACACCCATGCCTGGG + Intergenic
968007773 3:195254819-195254841 TCGCCCTCACACCAATGTTTTGG + Intronic
968683592 4:1939803-1939825 TGGCCTTCATACCAATGCCATGG - Intronic
971435659 4:26620209-26620231 GCTCCTTCACACTCATGTCTTGG + Intronic
978943148 4:114461762-114461784 TCTTCCTCCCACCCATGCCTGGG + Intergenic
990469458 5:56101163-56101185 TCTCCTTCAAACCCTAGCCTAGG + Intronic
990988104 5:61659713-61659735 TCCCATTCACTCCCATCCCTGGG + Intronic
998488754 5:142527402-142527424 TCCCATTCACACCCTTGGCTTGG - Intergenic
999327681 5:150653243-150653265 TCACCCTAACAGCCATGCCTGGG - Exonic
1007091017 6:39185082-39185104 GCCCTTTCACACCCATTCCTGGG - Intergenic
1010783676 6:79974735-79974757 TCGCCTGCACATCCATGGCAGGG - Intergenic
1016135902 6:140542644-140542666 TCTCCTTCACAATCTTGCCTGGG - Intergenic
1016555518 6:145332210-145332232 TCCCTGACACACCCATGCCTGGG + Intergenic
1018247624 6:161838004-161838026 TAGCCTTAACCCCCTTGCCTAGG + Intronic
1019083703 6:169454829-169454851 TCCCCTGCACATCCATGGCTGGG + Intergenic
1021802750 7:24324201-24324223 TGGCATTTACATCCATGCCTTGG - Intergenic
1026630510 7:72033778-72033800 GCGCTTTCATACCCAAGCCTGGG - Intronic
1028184928 7:87771672-87771694 ATGCCTTCACCCCCATCCCTGGG - Intronic
1029427256 7:100503581-100503603 TTGCTCTCACACCCATTCCTGGG - Intergenic
1032649049 7:133857800-133857822 GCGCCTCCACACCCACCCCTTGG - Intronic
1032711397 7:134463398-134463420 TCGCATTCACAACCAGGGCTTGG + Intergenic
1033553644 7:142469840-142469862 TCAGCTTCAGCCCCATGCCTGGG - Intergenic
1034392154 7:150795055-150795077 ACCCCTTCACTCCCATGCCATGG + Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035313602 7:157984532-157984554 TGGCATTCACACCCTGGCCTAGG - Intronic
1035618921 8:1023106-1023128 TCGGCATCACGCCAATGCCTGGG - Intergenic
1035840570 8:2808543-2808565 TTGACTTCAAACTCATGCCTAGG + Intergenic
1036824291 8:11964149-11964171 TCACCTTCACACGCATACTTAGG - Intergenic
1038038862 8:23707332-23707354 TAGCCCCCACACCCATTCCTCGG - Intergenic
1044150364 8:88769496-88769518 ACACCTTCACAGCCATGCCCAGG - Intergenic
1048009442 8:130443912-130443934 TCGCCTTCCGCCCCATGCCCCGG + Intergenic
1053403857 9:37853261-37853283 GCACCACCACACCCATGCCTGGG - Intronic
1057047490 9:91897596-91897618 TCGCCTTCACACCTTTGGCCAGG - Intronic
1060003608 9:119980619-119980641 TCACCTTATTACCCATGCCTAGG - Intergenic
1060107985 9:120886288-120886310 TTCCCTGCACACACATGCCTGGG - Intronic
1060918082 9:127403114-127403136 GGGGCTTCAAACCCATGCCTGGG - Intronic
1061643458 9:131979139-131979161 TTTCCCTCTCACCCATGCCTTGG + Intronic
1061881016 9:133568847-133568869 TTGACCTCACACCCTTGCCTCGG - Intronic
1185933139 X:4225276-4225298 TCACCCTCGTACCCATGCCTGGG - Intergenic
1187175051 X:16888695-16888717 TCGCCTTGCCTCCCCTGCCTCGG - Intergenic
1187887845 X:23906169-23906191 TTGGCTTCACTCCCATGTCTGGG - Intronic
1188473859 X:30569298-30569320 TCTCCTTCACTTCCATGTCTGGG - Intronic
1191850493 X:65582459-65582481 TCACCCCCAAACCCATGCCTTGG - Intergenic
1192343437 X:70282102-70282124 TTGGCTTCACACCCAGGCCTGGG - Intronic
1192583797 X:72305200-72305222 TCCCCTTCCCACCCCTGTCTAGG - Intronic
1200696539 Y:6366062-6366084 TCTCCTTCTCAGCCAAGCCTTGG + Intergenic
1201037574 Y:9798637-9798659 TCTCCTTCTCAGCCAAGCCTTGG - Intergenic