ID: 907734479

View in Genome Browser
Species Human (GRCh38)
Location 1:57098475-57098497
Sequence TTGTGTGTCTGGAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 497}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907734473_907734479 0 Left 907734473 1:57098452-57098474 CCCATTACCATCTAATTGGAGTC 0: 1
1: 0
2: 1
3: 5
4: 106
Right 907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG 0: 1
1: 0
2: 4
3: 65
4: 497
907734475_907734479 -7 Left 907734475 1:57098459-57098481 CCATCTAATTGGAGTCTTGTGTG 0: 1
1: 0
2: 0
3: 2
4: 105
Right 907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG 0: 1
1: 0
2: 4
3: 65
4: 497
907734474_907734479 -1 Left 907734474 1:57098453-57098475 CCATTACCATCTAATTGGAGTCT 0: 1
1: 0
2: 0
3: 4
4: 125
Right 907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG 0: 1
1: 0
2: 4
3: 65
4: 497
907734471_907734479 2 Left 907734471 1:57098450-57098472 CCCCCATTACCATCTAATTGGAG 0: 1
1: 0
2: 2
3: 14
4: 207
Right 907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG 0: 1
1: 0
2: 4
3: 65
4: 497
907734472_907734479 1 Left 907734472 1:57098451-57098473 CCCCATTACCATCTAATTGGAGT 0: 1
1: 0
2: 0
3: 2
4: 110
Right 907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG 0: 1
1: 0
2: 4
3: 65
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907734479 Original CRISPR TTGTGTGTCTGGAGGGCAGA AGG Intronic
900092641 1:927101-927123 TTGTGTGTCAGGTGGGCACATGG - Intronic
900266941 1:1762154-1762176 TTGTGTGGCTGCTGGGCAGATGG - Intronic
900288110 1:1911455-1911477 TGGTGTGTTGGAAGGGCAGAGGG - Intergenic
900303353 1:1989080-1989102 TTGTGTGGCTGCAGTGCAGCAGG - Intronic
900461524 1:2804348-2804370 TCAGGTGTCTGGAGGGCAGGGGG - Intergenic
900906042 1:5558489-5558511 TTGTTAGTGTTGAGGGCAGAAGG - Intergenic
900977679 1:6027264-6027286 GTGTGTGTGTGGACGGCTGAAGG + Intronic
901745404 1:11369800-11369822 TTATCTGTCTGGAGGGCGGGTGG + Intergenic
901810205 1:11763075-11763097 TGGTGTGTGTGGAGGACAGTGGG + Intronic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
902562212 1:17284641-17284663 TTGGGAGGGTGGAGGGCAGAGGG - Intergenic
902744504 1:18464456-18464478 GTGTGTGTGTGCAGAGCAGAGGG - Intergenic
902868457 1:19296860-19296882 TTGGGTATCTGGAGGCCAGTGGG - Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
904128374 1:28258714-28258736 GAGAGTGTCTGGAGGGAAGAGGG + Intergenic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
905289981 1:36914653-36914675 TTGTGTGTCTCTAGTGCACAGGG - Intronic
905527263 1:38648504-38648526 GTGAGTGTCTGGAGTGCAGATGG - Intergenic
905933460 1:41806149-41806171 GTGTTTGTCTGGAGAGCAGAGGG - Intronic
906091381 1:43182314-43182336 TATTGTGTCTCGAGGGCAAAAGG + Intronic
906106732 1:43299162-43299184 TTGAGAGTGGGGAGGGCAGATGG + Intergenic
906144979 1:43554589-43554611 TGGGTTTTCTGGAGGGCAGAGGG + Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906306981 1:44725598-44725620 TTGTGTGTGTGGAGGGGGAAGGG + Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907045660 1:51298645-51298667 TTGTGTGGCAGAAGGGCAGGGGG - Intronic
907190088 1:52641062-52641084 TTGTGTGATTGGAGACCAGATGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
907918145 1:58889369-58889391 TTGTGTGTCTGGGGAACAGAGGG - Intergenic
911043164 1:93607881-93607903 TGCTGTGTCTGGTGGGCGGATGG - Intronic
911067946 1:93808668-93808690 TTTTGTTTTTGGAGGGCAGCTGG + Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
913241679 1:116835327-116835349 GTGTGTGTCTGGGGTGCGGAGGG + Intergenic
913330516 1:117663312-117663334 TCTTGTATCTGGAGGGCAGTGGG - Intergenic
913444298 1:118933445-118933467 TTTTGTGGGTGGGGGGCAGAGGG - Intronic
913968114 1:143393487-143393509 TCTTGTGTCTTGAAGGCAGAAGG - Intergenic
914062495 1:144219077-144219099 TCTTGTGTCTTGAAGGCAGAAGG - Intergenic
914116655 1:144747277-144747299 TCTTGTGTCTTGAAGGCAGAAGG + Intergenic
914889953 1:151612992-151613014 TACTTGGTCTGGAGGGCAGAAGG - Intronic
915217510 1:154349909-154349931 GTGTGTGTGTTGGGGGCAGAGGG - Exonic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
916217408 1:162409245-162409267 TTGTGTCTCTGGACGGGAGACGG - Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916339987 1:163722527-163722549 TTGTGTGTCTGCAAGTCAGTGGG + Intergenic
916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG + Intronic
916745409 1:167681311-167681333 TAATGTGCCTGGAGGGCAGACGG + Intronic
917052981 1:170945329-170945351 TTCAGTGTCTGTAGGTCAGAAGG - Intronic
918139103 1:181705231-181705253 ATGTGTGCCTGGAGGGATGAGGG - Intronic
919404106 1:197154670-197154692 TTGTTTGTTTTGAGGGTAGAGGG - Exonic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919866941 1:201789631-201789653 TTGTGATTCTGGAGGGCATCTGG - Intronic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
921257951 1:213359444-213359466 GTGTGTCTCTGCAGGGGAGATGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924073847 1:240312188-240312210 GTGGGTGGCTGGAGAGCAGAGGG - Intronic
924942845 1:248824560-248824582 TTGTGTGTCTGAAGTGCTGATGG - Intronic
1063588972 10:7377970-7377992 TTGTGTGTGTGGGGGGGAGGTGG + Intronic
1063727810 10:8658109-8658131 TTGTGTGTGTGGAGGGGTGTGGG + Intergenic
1065853985 10:29814893-29814915 TGGTGTGGCTGGAGCTCAGATGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067584324 10:47466482-47466504 TTGGGTGACTCTAGGGCAGAGGG - Intronic
1068803059 10:61163320-61163342 TTGGAGGTCTGCAGGGCAGAAGG + Intergenic
1069900406 10:71703635-71703657 TTGTTTGTCAGGATGCCAGAGGG + Intronic
1070537070 10:77387185-77387207 TTTAGTGTTTGGAGAGCAGAGGG - Intronic
1070776341 10:79112047-79112069 TGGTGTGGCTGGAGTGTAGAGGG + Intronic
1071017477 10:81015054-81015076 ATGTGTGTGAGGGGGGCAGAGGG + Intergenic
1071124446 10:82318058-82318080 CTTTGTGTCTGGTGGGCAGGGGG + Intronic
1071290656 10:84186395-84186417 GTGTGTGTGTGGTGTGCAGAGGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071665431 10:87551184-87551206 TTGTGTGTGTTGGGGGCAGAGGG + Intronic
1071827027 10:89335531-89335553 TTTTTTTTTTGGAGGGCAGAAGG - Intronic
1072576277 10:96703461-96703483 TTGTGTGTGTTGAGGGTGGAGGG - Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1074154536 10:110786827-110786849 TTGAGTGTCAGGTGGGCAGGGGG + Intronic
1074374379 10:112927217-112927239 TCTTGTGTCTGGAGGGCAATTGG + Intergenic
1074909324 10:117893281-117893303 TTGTGTGTTTGTGTGGCAGAAGG + Intergenic
1075879698 10:125840265-125840287 TTGTATGCCTGAAGGGCAGTGGG - Intronic
1076599144 10:131645869-131645891 GTGTGTGCCTTGAGGGGAGAGGG + Intergenic
1076783475 10:132737228-132737250 GTGTGTGTCCAGAGGGCAGGTGG + Intronic
1078333377 11:10444384-10444406 ATGTGTGTGTGGTGGGCAGGTGG + Intronic
1078670959 11:13364633-13364655 TTGTATGTCTGGAAGGCAGTGGG + Intronic
1079601113 11:22314371-22314393 TTGGGTGGCTGGATGGCACAAGG + Intergenic
1079874388 11:25838576-25838598 TTTTGTTTCTGGAAAGCAGAGGG + Intergenic
1081432961 11:42996691-42996713 GTGTGTGTGTGGAGGGCGGGGGG - Intergenic
1081611799 11:44567383-44567405 GTGTGTGTATGTAGGGCAGGGGG + Intronic
1081626076 11:44655977-44655999 GTGTGTGTGTTGGGGGCAGAGGG + Intergenic
1081659584 11:44879804-44879826 ATAAGTGTCTGGAGGCCAGATGG + Intronic
1081702524 11:45161194-45161216 CTGTGTGTCTGCATGGCACATGG - Intronic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082269781 11:50157397-50157419 TGGTGTGGCTGGAGGGGGGAGGG + Intergenic
1083776000 11:64894638-64894660 TTCTGTGTCTGGGGGGAGGAGGG - Exonic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1084537060 11:69763536-69763558 TTGCAGTTCTGGAGGGCAGAAGG - Intergenic
1084743340 11:71152940-71152962 TTGTTTGTCTGAAATGCAGATGG - Intronic
1086105104 11:83138967-83138989 TAGTGTGTCTGGTGGGCAAGGGG - Intergenic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087293532 11:96343667-96343689 ATGTGTGTGTTGAGGGCGGAAGG + Intergenic
1087307672 11:96504470-96504492 TTGTCTGACTGGATGGTAGAGGG - Intronic
1088018745 11:105092816-105092838 ATGTGTCTCTGCAGGGCAGGAGG + Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1089610475 11:119665912-119665934 TTGTCTGCCTGCAGGGCACAGGG + Intronic
1090568476 11:128021573-128021595 ATGTGTGTCTGCTGGGCAGCAGG + Intergenic
1090645380 11:128763132-128763154 TTGTGTCTCTGGTGGGAAGGAGG + Intronic
1090668813 11:128931874-128931896 ATGTGTGTCTGGAGAACACAGGG - Intergenic
1090780220 11:130001665-130001687 TCGCGTGGCTGGAGGGCAGACGG + Intronic
1091184869 11:133638043-133638065 TTTTGTGTCTGGTGGGCGAAGGG + Intergenic
1091671581 12:2456010-2456032 TACTGTGTCTGGAGGTCAGTGGG - Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092833111 12:12464250-12464272 TTGAGTGCCTGCAGGGCAGGAGG - Intronic
1093010358 12:14100982-14101004 TTGTTTGAGTGGAGGGCAGAGGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1095214929 12:39537140-39537162 GTGTGTGTCTAGAGTGCGGAGGG - Intergenic
1095533382 12:43217530-43217552 TTGGGTGTTTAGGGGGCAGAGGG - Intergenic
1096236782 12:49933884-49933906 TGGTGTGTCTGGAGATCACACGG + Intergenic
1096752682 12:53772052-53772074 TTGTGTGTGGTGAGGGCAGGGGG - Intergenic
1096812056 12:54177031-54177053 TAGTGTTTCTGGATGGCACACGG + Intronic
1097025856 12:56054965-56054987 ATGGGTGACTGGAGGGCAAATGG + Intergenic
1097182578 12:57179732-57179754 TTGGGTGTCTGCAGGGCAGTGGG - Intronic
1097468450 12:59957378-59957400 TTGTGTGTCTGGAAGTAAAATGG + Intergenic
1097533747 12:60839101-60839123 TACTGTGTCTGCATGGCAGAAGG + Intergenic
1097625239 12:61992157-61992179 TTATGTGTCTGGATTTCAGAAGG - Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1097967616 12:65597567-65597589 TTGGGTACCTGGAGGGCAGCAGG + Intergenic
1098590698 12:72208175-72208197 GTGTGTGTATAAAGGGCAGAGGG - Intronic
1098651010 12:72969078-72969100 TTGTGTGTCTGGAGAGTACATGG - Intergenic
1098933584 12:76450789-76450811 TTTTGTTTTTGGAGGGGAGAAGG - Intronic
1101745540 12:107538720-107538742 GTGTCTGTCTGGAGGACAGCGGG - Intronic
1101858455 12:108463388-108463410 TTGGGATTCTGGAGGGCAGGTGG - Intergenic
1104423193 12:128653888-128653910 TTGGCTGTCCGGAGGCCAGAAGG + Intronic
1104460718 12:128953661-128953683 TTGTGTGTGTGGAGTGAGGAAGG + Intronic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104717873 12:131028606-131028628 TTCTGTGTCTGCAGTGCAGTAGG + Intronic
1104859445 12:131916864-131916886 ATGTGTGTCTGGCCTGCAGAGGG + Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105708303 13:22982233-22982255 TTGTGTGCATGGTGGGCACATGG + Intergenic
1107229965 13:38097060-38097082 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1107298919 13:38945613-38945635 TTTTGGCTCTGGAGGACAGATGG - Intergenic
1107298935 13:38945706-38945728 TTTTGGCTCTGGAGGACAGATGG - Intergenic
1107921228 13:45210306-45210328 ATGTGTGCCTGGAGGGCTCATGG - Intronic
1108852926 13:54757504-54757526 TTGTGTTTTTGGAAGACAGAAGG - Intergenic
1110160628 13:72373972-72373994 TTTTGTGTGTGGAGGGATGATGG + Intergenic
1110389274 13:74955293-74955315 TTGTGTGTCTTGAAAGCAGGAGG - Intergenic
1110904011 13:80862717-80862739 GTGTGTGTCTGGAGGGCTAAAGG + Intergenic
1112316847 13:98370566-98370588 TTGAGTGACTGGGGGGGAGATGG + Intronic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1114339319 14:21726641-21726663 CAGTGTGTCTGTAGGGCACATGG + Intergenic
1114731773 14:25000590-25000612 TTGGGTGGCTGTAGGGAAGAAGG - Intronic
1114755255 14:25252609-25252631 TGGTGTGTATGTAGGGCAGCTGG + Intergenic
1116751371 14:48889698-48889720 TTGTGTGGATGGAAGGCAGTAGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120475385 14:84980147-84980169 TTGAGATTTTGGAGGGCAGAAGG + Intergenic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1121372188 14:93369731-93369753 TTGTGTTTCTGGCAGGCAGAGGG + Intronic
1202889612 14_KI270722v1_random:143671-143693 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1202889625 14_KI270722v1_random:143791-143813 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202889638 14_KI270722v1_random:143911-143933 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1123633736 15:22281194-22281216 TTTTGTGTGTGGGGGGGAGAGGG - Intergenic
1124530434 15:30500750-30500772 ATTTGTGTCTGGAGGGCAGGGGG - Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1124768225 15:32506938-32506960 ATTTGTGTCTGGAGGGCAGGGGG + Intergenic
1125054368 15:35340265-35340287 TTGTGTTTCTGTAGGCGAGATGG + Intronic
1125333488 15:38604865-38604887 GTGTGTGTCGGGGGGGCATATGG + Intergenic
1127077626 15:55343439-55343461 TTGTGTGCCTGGAGGGGACGGGG + Intronic
1127110907 15:55669396-55669418 TGATGTGTCTGGAGGGCAGTAGG - Intronic
1127377917 15:58402057-58402079 TTGTGTGTCTGGTGGGGTGAGGG + Intronic
1127540813 15:59937091-59937113 ATGTCTGTCTGGGAGGCAGATGG + Intergenic
1127841315 15:62834630-62834652 TTGTGTGCCAGGTGGGGAGACGG - Intronic
1128866746 15:71120107-71120129 TTTTGTGTCTGAAGGGCACAGGG + Intronic
1129101134 15:73265208-73265230 TTGTTTGTCTGGAGGGGATGAGG + Intronic
1129582253 15:76824359-76824381 TTGTGTGTCAGGAGGACAAAGGG - Intronic
1129731750 15:77936335-77936357 TTGGGTCTCTGGATGGCATATGG - Intergenic
1130055389 15:80519511-80519533 TTTTGTGTCAGGTGAGCAGAAGG + Intronic
1130379904 15:83362654-83362676 TGGGGTGACTGGAGGGCAGAGGG - Intergenic
1130832601 15:87616740-87616762 AAGTCTGTCTGGAGGGCTGATGG + Intergenic
1130921306 15:88347362-88347384 TTGTGAGTCTGGAGGGAACAAGG + Intergenic
1131809925 15:96162473-96162495 ATATTTCTCTGGAGGGCAGAGGG - Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132323439 15:100944631-100944653 TTTTGTGTTTGGAAGGCAGATGG + Intronic
1132360072 15:101204898-101204920 TTGTGTGTGTGGCGGGGGGATGG - Intronic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1132798036 16:1734880-1734902 GTGTGTGTCTGGAATGCAGTCGG + Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133381124 16:5331412-5331434 TCATGTGTCTGGAGGTCAGGTGG + Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136092030 16:27927522-27927544 TTGTGTGGCTGGAGCACAGTGGG - Intronic
1137631894 16:49952447-49952469 TTGGGTGCCTGGAGGGGAGAAGG - Intergenic
1137660898 16:50205197-50205219 TTCTGTGTGGGGCGGGCAGAGGG + Intronic
1138433451 16:56983861-56983883 TTCTGTGGCTGGCGGGTAGAGGG + Intergenic
1139381884 16:66537654-66537676 TTGTGTGTCTAGACCACAGATGG - Intronic
1140002639 16:71040489-71040511 TTGTGTGTGTGGGGGGGAGGGGG - Intronic
1140127133 16:72127050-72127072 TTCTGAGTCTGGAAGCCAGAGGG + Intronic
1140263397 16:73399858-73399880 GTGTGTGTCTAGATAGCAGAGGG + Intergenic
1140675275 16:77322229-77322251 TTGTGTGTCTGGAGAAGAGCAGG - Intronic
1142368440 16:89663685-89663707 GGGTGTGTCTGAAGGGCAGCAGG + Intronic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1144519216 17:15943292-15943314 TTATGCCTGTGGAGGGCAGAGGG + Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144698417 17:17321349-17321371 TAGTGTCTGTGAAGGGCAGAGGG + Intronic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1144830065 17:18126332-18126354 ATGTATGTCTGCTGGGCAGACGG - Exonic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1145758784 17:27412938-27412960 TTTTGTGTCAAGAGGGAAGAAGG - Intergenic
1146206232 17:30907516-30907538 GTTTGTGTCTGGAAGGCAGTGGG + Intronic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146537562 17:33666348-33666370 TTGAGTGTGTGGGTGGCAGAAGG + Intronic
1147562735 17:41518974-41518996 GTGTTTGTCAGGAAGGCAGAAGG - Exonic
1147853074 17:43457507-43457529 TTGAGAGTGTGGATGGCAGACGG + Intergenic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148198118 17:45729372-45729394 TTGTGTGTTGGGAGGGCCAAGGG + Intergenic
1150474627 17:65465535-65465557 TTCTGTCTCTGAAGAGCAGAGGG + Intergenic
1151030093 17:70727499-70727521 TTCTGTGCCAGGAGGGCACACGG + Intergenic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151194023 17:72419207-72419229 TTGTGGGTCTGAATGGGAGATGG + Intergenic
1151201016 17:72468082-72468104 GTGCGTGTCTGGAGGGCGGAGGG - Intergenic
1151484360 17:74389302-74389324 TTGTGTAACTGTAGGGGAGAGGG + Intergenic
1152185347 17:78852844-78852866 TTGTTTCTCTGGAGGACACAGGG + Intergenic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1153979949 18:10300155-10300177 TTGTGTGTCCCTGGGGCAGATGG + Intergenic
1154518709 18:15202485-15202507 TAGTGTGTTTGAAGGGGAGAGGG - Intergenic
1155370045 18:25089329-25089351 TTGTGTGTATTGGGGGCAAAGGG - Intronic
1156061823 18:33086807-33086829 TGGTGTGTGTGAAGGGGAGAGGG + Intronic
1156377630 18:36529039-36529061 GAGGGTTTCTGGAGGGCAGATGG + Intronic
1157529852 18:48410694-48410716 ATGTCTGTCTGGAGCGCAGAGGG - Intronic
1157772193 18:50358932-50358954 GTGTGTGTCCTGATGGCAGAGGG + Intergenic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1159453051 18:68626766-68626788 TTGTGTGTCTGCAGTTCAAAGGG + Intergenic
1159701087 18:71628739-71628761 TTGGATTTCTGGAGGTCAGAAGG + Intergenic
1160018745 18:75164332-75164354 TGCTGTTTCTGGAGCGCAGAGGG + Intergenic
1160632368 18:80255524-80255546 TTGTGTGCCTGAAGGGCTGATGG + Intergenic
1162176932 19:8837570-8837592 TTCTCTGGCTGGAGGGCAGAAGG + Intronic
1163775277 19:19213673-19213695 TTGTGTATCTGGAGGGGCCAAGG + Intronic
1164414697 19:28037278-28037300 TTCTGTGTCCTGAGGGGAGAGGG - Intergenic
1165344241 19:35233813-35233835 TTGTGTGTGGGGAGGGTAGGGGG + Intergenic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1167052315 19:47086733-47086755 CTGTGTGTCTGGGGTGCTGAGGG - Intronic
1167509012 19:49886298-49886320 TTGTTTTTCTTGAGTGCAGATGG + Intronic
1202665014 1_KI270708v1_random:110438-110460 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1202665026 1_KI270708v1_random:110558-110580 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202665039 1_KI270708v1_random:110678-110700 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1202701902 1_KI270712v1_random:170955-170977 TCTTGTGTCTTGAAGGCAGAAGG - Intergenic
925104411 2:1278245-1278267 TATTGTTTATGGAGGGCAGAAGG + Intronic
925357185 2:3250120-3250142 TCTTGGGCCTGGAGGGCAGAAGG - Intronic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926690402 2:15729262-15729284 GTCTGTGACTGGAAGGCAGAAGG + Intronic
927025782 2:19067681-19067703 TTCTGAGCCTGGAGGGAAGAGGG + Intergenic
927097699 2:19760125-19760147 TTCTGTGTCTGGCTGACAGATGG - Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927967893 2:27283020-27283042 TGTTGTGGCTGGAGAGCAGAAGG + Intronic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
928821841 2:35371039-35371061 ATGTGTGTCTGGAGGAGGGATGG + Intergenic
929450013 2:42030536-42030558 TTGTCTCTGTGGAGCGCAGAGGG - Intergenic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
929667992 2:43848668-43848690 TTGTGTGTATGTTGGGCAGGGGG - Intronic
929763612 2:44826212-44826234 AGATTTGTCTGGAGGGCAGAAGG - Intergenic
929779426 2:44948362-44948384 TTCATTGGCTGGAGGGCAGAAGG + Intergenic
929824288 2:45298338-45298360 TTGGTTGCCTGGAGGACAGAGGG + Intergenic
930612270 2:53555640-53555662 CCGGGTGTCTGCAGGGCAGAGGG + Intronic
930889386 2:56365328-56365350 TTATGTGCCTGGAGTGGAGAAGG + Intronic
931140250 2:59449701-59449723 TTGTATGTCAAGAGGGCAGAAGG - Intergenic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
934172814 2:89554401-89554423 TCTTGTGTCTTGAAGGCAGAAGG - Intergenic
934283128 2:91628754-91628776 TCTTGTGTCTTGAAGGCAGAAGG - Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
935268584 2:101414740-101414762 CTGTCCATCTGGAGGGCAGAGGG - Intronic
935989226 2:108704551-108704573 TGGTGTTCCTGCAGGGCAGAGGG - Intergenic
936522648 2:113220714-113220736 TTGTGTGCATGGGGGGCTGAGGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937028621 2:118719777-118719799 TTGTCTGTCTTGAAGGCAGATGG - Intergenic
937403460 2:121606050-121606072 ATGTGTGTCTGAAGAGCAGCTGG + Exonic
937576446 2:123428209-123428231 TTGATAGTCTTGAGGGCAGAAGG - Intergenic
937891819 2:126944940-126944962 TTGAGGGTCTTCAGGGCAGAAGG + Intergenic
939064692 2:137468612-137468634 TTGTGTGTGTGGAGGGGTGGGGG + Intronic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939129513 2:138217529-138217551 ATATGTGTGTGGAGGGCAGTGGG - Intergenic
940061631 2:149577381-149577403 TGTTGTGGCTGGAGTGCAGAGGG + Intronic
940264957 2:151827582-151827604 TTGTGTGTGTTGGGGGCAGGGGG - Intronic
941004537 2:160234532-160234554 TTGAGTTTCTGGAGGGCCAAAGG + Intronic
941373166 2:164692909-164692931 TTGTGTTTCTGGAAGTCACATGG + Intronic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
943365980 2:186967872-186967894 TTGTGTGGATGGTGGGCAGCAGG + Intergenic
943659460 2:190542897-190542919 TTGTGTGTCTGGAGAGGTCATGG + Intergenic
945805372 2:214483959-214483981 TAGAGTTTCTGGAGGGAAGATGG - Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946586116 2:221189688-221189710 GTGTGTGTTTGGGGGGCAGGGGG - Intergenic
946723127 2:222632514-222632536 TTGCGTTTCTGGAGGTAAGAAGG - Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947746316 2:232509058-232509080 GTTTCTTTCTGGAGGGCAGAGGG - Intergenic
947871005 2:233438006-233438028 TTGTGAATGTGGAGGTCAGATGG + Intronic
947948942 2:234131055-234131077 TCATGTGTGTGGAGGGCAGTGGG + Intergenic
948051911 2:234984991-234985013 TTGTCTTTCTGGAGGCCAGGAGG + Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948627224 2:239276590-239276612 GCCTGTGTCTGGAGAGCAGATGG - Intronic
948722607 2:239911054-239911076 TAGTGGGTCTGCTGGGCAGAGGG + Intronic
948969958 2:241417839-241417861 TTGTGTGTTTAGAGGGCAGATGG - Intronic
1168902129 20:1373926-1373948 TTCTGTTCCTGCAGGGCAGAGGG - Intronic
1168949155 20:1784692-1784714 TTGTGGGGCTGGAAGGCTGAAGG + Intergenic
1168998814 20:2151878-2151900 TTGGGTGCCTGCAGGGTAGAGGG + Intronic
1169189798 20:3651342-3651364 TTGTGTGCCTACAGGGCAGCTGG + Intergenic
1169192715 20:3668329-3668351 GTGTGTGTCGGGGGGACAGAGGG - Exonic
1169234802 20:3922425-3922447 CTGTGTCTCAGGAGGGCTGAGGG + Intronic
1169265160 20:4162978-4163000 TTGTATGCCTGGAGAGCAGAGGG + Intronic
1169602602 20:7278683-7278705 TTGTGTGTCTTGTAGTCAGATGG + Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170857867 20:20074092-20074114 TTGTGAGTAAGGAGGACAGAAGG + Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1172384608 20:34525122-34525144 TTGTTTTTCTGGAAGGCACAAGG - Intronic
1173151769 20:40572213-40572235 TTCTGTGTCTTGAGGGCAATGGG - Intergenic
1174128378 20:48325382-48325404 TAGTGTGTCTGAGGGGCAGGGGG - Intergenic
1174130245 20:48339477-48339499 TTGTGTGTGTGGCGGGGAGCTGG - Intergenic
1174595119 20:51677734-51677756 TACTGTGTCTGGAGGATAGAAGG - Intronic
1175460129 20:59146185-59146207 TTGTGTGTGTGGAGGGTGGTGGG - Intergenic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1179101591 21:38359430-38359452 TTGCGGGTCTGCAGGGCAGTCGG + Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1180331739 22:11487358-11487380 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1180331752 22:11487478-11487500 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1180331765 22:11487598-11487620 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1181315235 22:21966758-21966780 CTGTCTGTCTGGAATGCAGAAGG - Intronic
1181432484 22:22889961-22889983 TGGTGTGTCTGGCTGGCTGATGG + Intronic
1181481905 22:23205225-23205247 TGGTCAGTCTGGAGGGCATAAGG + Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1182124116 22:27804124-27804146 TTCTGTGTCTGGAGGAAATAGGG + Intergenic
1182623760 22:31631405-31631427 TTGCGTGCCTGGAGGGCAGAAGG - Intronic
1183390027 22:37540424-37540446 CTGTGTGTTTGGAGAGCAGTGGG - Intergenic
1184284755 22:43464325-43464347 GTGTGTGTGTGGTGGGCATAGGG + Intronic
1184924195 22:47625930-47625952 GTGGGAGTATGGAGGGCAGAGGG - Intergenic
949562803 3:5218302-5218324 TTGTGGGGCTGGATGCCAGAAGG + Exonic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
949587218 3:5453673-5453695 ATTTGTGTCAGGTGGGCAGAGGG + Intergenic
949747179 3:7308485-7308507 TTATGTGTCTGGAGGGATGGAGG + Intronic
950255920 3:11505748-11505770 TTGTGTGTCCTGGAGGCAGATGG + Intronic
950554430 3:13686580-13686602 TTGTGTGTCTGGTAGGGGGAGGG + Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952796956 3:37247905-37247927 ATATGGGTCTAGAGGGCAGAGGG - Intronic
952849994 3:37719940-37719962 TTATTTTTCTGGAGGGCAGAGGG + Intronic
953421182 3:42754435-42754457 TTGTGTGTCAGGAGGGTAACGGG + Intronic
953748861 3:45594766-45594788 GTGTGTGTGTTGAGGGCAGCGGG - Intronic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
954576977 3:51681727-51681749 CTGAGTGTCTGCATGGCAGAGGG - Intronic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
955937508 3:64115454-64115476 GTGTGTGTCTGCATGGGAGATGG - Intronic
956622796 3:71237901-71237923 TTATGTGTCTGGAGGGGGAAGGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957090880 3:75728906-75728928 ATTTGTGTCAGGTGGGCAGAGGG + Intronic
957090892 3:75729027-75729049 ATTTGTGTCAGGTGGGCAGAGGG + Intronic
957090917 3:75729267-75729289 ATTTGTGTCAGGTGGGCAGAAGG + Intronic
958764961 3:98356754-98356776 TTCTGTCTCAGGAGGGAAGATGG + Intergenic
959907643 3:111728413-111728435 TTGTGTGTGTGTAGGTGAGAGGG + Intronic
961501918 3:127342436-127342458 TTGTGTGCTGGGAGGGCTGAGGG + Intergenic
961616813 3:128188948-128188970 TTGTGAGTCTGTAGGGGAGTTGG + Intronic
961833254 3:129635777-129635799 TCGTGTGTGTGGACGACAGAAGG + Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
963209228 3:142670315-142670337 TTGTGTGACTGGAGCTGAGATGG + Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964835195 3:160930321-160930343 TTGTATGTCTTCAGGGCAAAGGG - Intronic
966203257 3:177378915-177378937 TTGTGCTTCTGAAGGGGAGAGGG + Intergenic
966669344 3:182509337-182509359 TTGTGGGGCTGGAGAGCAAAGGG + Intergenic
966855766 3:184193032-184193054 AGGTGTGGCTGGAGGGCACAGGG + Intronic
967276470 3:187780330-187780352 GTGTGTGTGTAGGGGGCAGAAGG - Intergenic
967676513 3:192305518-192305540 GTGTGTGTCTGGAAGAGAGACGG - Intronic
967844886 3:194035538-194035560 TTGTGTGGGAGGAGGGCAGTGGG - Intergenic
968422302 4:496144-496166 TTTTGTGTGTGGGGGGTAGACGG + Intronic
968917502 4:3503003-3503025 TGGTGTGGCTCGAGGGCAGTGGG - Intergenic
969612833 4:8236686-8236708 TGGCATGTCTGGAAGGCAGAGGG - Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
969892798 4:10275344-10275366 TTGTGAACCTGGAGGGAAGAGGG + Intergenic
970214968 4:13749381-13749403 GTGTGTGTCTGGGGGGGAGTTGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
971555627 4:28011093-28011115 TTGTCTGTCTGCAAGGCAGCTGG + Intergenic
972204615 4:36757362-36757384 TGGTGTGTCTGGAGAGAAGGAGG - Intergenic
973570477 4:52233937-52233959 TTGTGTGTGTGGGGGGGGGAGGG + Intergenic
973638799 4:52883951-52883973 TTGGGTGTCTGGAGACCAGCAGG + Intronic
974023344 4:56711185-56711207 TTCTGAGTCTGGGGGGCAGGGGG - Intergenic
974051595 4:56946983-56947005 TTCTGTCTCTGGTGGGTAGATGG + Intergenic
974218992 4:58941390-58941412 TTATGTTTCTGGAGAGCAGGTGG - Intergenic
974678855 4:65135475-65135497 TTGTGTCTCTGGAGGTGAGGTGG - Intergenic
975660000 4:76679270-76679292 TAGCGTGCCTGGAGGGCAGTGGG - Intronic
976901537 4:90183262-90183284 GTGTGTGTTTGGAGGTCATAGGG - Intronic
977154710 4:93557343-93557365 ATGTGTGTCTGCATGGGAGACGG - Intronic
977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG + Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978448865 4:108807179-108807201 TTGTTTGCCTGGATGGCAGGTGG + Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980582366 4:134771702-134771724 TGGTGTGTGTGGAAGACAGAGGG - Intergenic
980861221 4:138501645-138501667 GTGTGTGTCTGGGGGTCAGGTGG - Intergenic
981362458 4:143863179-143863201 GTGTGTGTCTGGGAGGCAGGAGG + Intergenic
981382284 4:144087217-144087239 GTGTGTGTCTGGGAGGCAGGAGG + Intergenic
981784357 4:148461176-148461198 GTGTGTGTGTTGGGGGCAGAGGG + Intergenic
983415527 4:167448116-167448138 TTGTGTGCGTGGAGTGCAGGGGG + Intergenic
983976220 4:173937233-173937255 TTGTGTGTCAGGAGGTAAGAAGG - Intergenic
984918415 4:184743475-184743497 TTGGGTGAGGGGAGGGCAGAGGG + Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
984949298 4:184994816-184994838 GAGTGTGTCTGGAGGTCAGGAGG + Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985733935 5:1566383-1566405 GTGTGTGTCTGGAGGCCAGGTGG - Intergenic
986350834 5:6878142-6878164 GTGAGTGCCTGGTGGGCAGAGGG + Intergenic
986603299 5:9495927-9495949 TAGTGTGTGTGGATGGGAGAGGG - Intronic
986621943 5:9685090-9685112 GTATGTATCTGGAGAGCAGAAGG + Intronic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
987989402 5:25190878-25190900 TCCGGTGTCTGCAGGGCAGAGGG + Intergenic
990149261 5:52798726-52798748 ATTTGTGTCAGGAGGGCAGAGGG + Intronic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
990791697 5:59487966-59487988 CTGTGTGTCTGATGTGCAGAGGG - Intronic
992568400 5:78025598-78025620 TTTTCTGTCTGGAATGCAGATGG + Intronic
992872761 5:81023068-81023090 TTGTGAGTGCGGAGGGTAGAGGG + Intronic
992997741 5:82349048-82349070 TGGTCTCTCTGAAGGGCAGAGGG + Intronic
993204372 5:84861414-84861436 CTGTGTTTCTGGATAGCAGAAGG - Intergenic
994611065 5:102040347-102040369 TTGTGTGTATAGAGGGGAGGGGG - Intergenic
996468835 5:123835603-123835625 TTGTTTATCTGGAGGTGAGAAGG + Intergenic
996566218 5:124881891-124881913 TTGTGTGGCTGCAGGAAAGAGGG - Intergenic
997130044 5:131267515-131267537 ATGTGTGTCTGTTGGGGAGAGGG + Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG + Intronic
999463644 5:151779145-151779167 TGGTGTCTTTGCAGGGCAGATGG + Intronic
1000580221 5:163027036-163027058 TTGTTTGTTTGGAGGGCTGAAGG + Intergenic
1000832005 5:166114021-166114043 TTGTGTGTGTGCATGGCAGGTGG + Intergenic
1001429068 5:171645357-171645379 TTGGGTGGCTGGTGGGGAGAAGG - Intergenic
1001571772 5:172735053-172735075 TTGTGTGTATGGGGGCCAGTTGG + Intergenic
1001681125 5:173557622-173557644 GTGTGTGTATGGGGGGCAGGGGG + Intergenic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002384346 5:178855131-178855153 TTGTGTGTCTGGCAGGGAGAAGG - Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002624798 5:180518495-180518517 TTGTGTGTGTGGGGGGGAGGAGG + Intronic
1004114148 6:12749920-12749942 TTGTGTCTCCGGTGCGCAGAGGG + Intronic
1004418202 6:15444555-15444577 GTGTGTGTCTGGGGGGCGAATGG + Intronic
1004643680 6:17539497-17539519 TTTTGTGTCTGGGAGCCAGAGGG - Intronic
1004980906 6:21022599-21022621 TTGTGTGTGAGGAGGGAAGGGGG + Intronic
1004982229 6:21038269-21038291 TTCTGTGTGTGGAGGCCAGTAGG + Intronic
1005668556 6:28081507-28081529 TTGTGTTTCTCAAGGGCAGGGGG - Exonic
1005909106 6:30292530-30292552 TTTTGTTTCTGGAGGGAAAAGGG + Intergenic
1006058861 6:31404683-31404705 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006071346 6:31499568-31499590 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006347219 6:33492406-33492428 TTGTGGGTCTGGTGGCCACAGGG - Intergenic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007369401 6:41416519-41416541 GTGTGTGTCTGGTGGGTGGAGGG - Intergenic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1007466910 6:42058938-42058960 GTGTGTGGTTGGGGGGCAGAGGG + Intronic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1008878593 6:56356427-56356449 TTGTCTCTTTGGGGGGCAGAGGG - Intronic
1009547605 6:65041295-65041317 TTGTGTGTCTGGCAGGAAGCTGG - Intronic
1009741401 6:67751436-67751458 TGTTGTGTATGGTGGGCAGAGGG + Intergenic
1010917405 6:81637234-81637256 TTGTGTCCCTAAAGGGCAGAGGG + Intronic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011877639 6:91980806-91980828 TTGTGTGTCTGTATGGGAAAGGG - Intergenic
1012033096 6:94098246-94098268 TTGTGTGCCTGCAGGAGAGAGGG - Intergenic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1013452816 6:110301657-110301679 TTGTATGTCTGCAGGTCAGCTGG - Intronic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1013874167 6:114803796-114803818 GTGTGTGTCTGCAGGTGAGATGG + Intergenic
1014554569 6:122830081-122830103 TTATGTGTCTGTGGGGCAGAGGG - Intergenic
1015918647 6:138244664-138244686 TTGAGTATCTGCAGGGCACATGG - Intronic
1016502328 6:144735429-144735451 TCTTGTGCCTGGACGGCAGATGG + Intronic
1016631093 6:146232659-146232681 TTGGGGGGCTGGAGGGCAGGTGG - Intronic
1016892520 6:149020785-149020807 TTGTTTGTCTAGATTGCAGAAGG - Intronic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017642773 6:156510325-156510347 TTGTTTAACTGGAGGGCACAGGG - Intergenic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1019012558 6:168853576-168853598 TTGTATGTTGGGAGGGCACAGGG + Intergenic
1019570264 7:1708124-1708146 TTTTGCATCTGGAGGGCAGGAGG - Intronic
1020052396 7:5090477-5090499 ATTTGTGTCTGGTGGGCAGGGGG + Intergenic
1020621164 7:10520977-10520999 TTGTGTGTTGGAAGGACAGAAGG + Intergenic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1021142726 7:17047676-17047698 TTGTGGGTCAGGGAGGCAGAAGG - Intergenic
1021168135 7:17365567-17365589 GTGTGTGTGTTGGGGGCAGAAGG - Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022795393 7:33727696-33727718 TTGTGTGGCTGCAGGGCACCGGG - Exonic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1025262934 7:57432905-57432927 TTTTGTTTATGGAGGGCAGAAGG - Intergenic
1026035181 7:66825354-66825376 TTGACTGTCTGGAAGGCAAAAGG + Intergenic
1026036965 7:66836793-66836815 TTGACTGTCTGGAAGGCAAAAGG + Intergenic
1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG + Intronic
1028490880 7:91410264-91410286 TTGTTTCTTTTGAGGGCAGAAGG - Intergenic
1029423840 7:100484760-100484782 GTGTGTGTCTGGAGGTCTGTGGG + Intronic
1030772372 7:113490082-113490104 TTGTGGGGCAGGGGGGCAGAGGG + Intergenic
1031117282 7:117681975-117681997 TTGTGACTCTGGAGGGCACAAGG + Intronic
1031363622 7:120876733-120876755 TTGTGTGTCTGTGGTGGAGATGG - Intergenic
1031409965 7:121429884-121429906 TTGTGTGTGTGGGGGGGGGAGGG - Intergenic
1032291059 7:130590928-130590950 TGGTGTGGCTGCCGGGCAGAGGG - Intronic
1032792747 7:135254382-135254404 CTGTGTGTCTGTAGGACAGCTGG - Intronic
1033771470 7:144557392-144557414 TAGTGTGTGTGGAGAGCAGAAGG - Intronic
1034272610 7:149810754-149810776 TTGCCTGGCAGGAGGGCAGAGGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034966275 7:155393172-155393194 TTGTGTGACTGCTGAGCAGAGGG + Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035698611 8:1620944-1620966 TTGTTTGTCTGGAGAGCAGAGGG - Intronic
1037372438 8:18194282-18194304 TGATGTGTCTGTAGGGGAGAGGG + Intronic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1038177651 8:25195530-25195552 TGGTGTGGCTGGAATGCAGAAGG - Intronic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1039064686 8:33598469-33598491 GTGTGTGTCTTGAGGGGAGGGGG + Intronic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1039720473 8:40158934-40158956 TTGTGTGTAAGGAGTACAGAGGG - Intergenic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1041160755 8:55041099-55041121 TTGACTCTCTGGAGGGCTGAAGG - Intergenic
1041513395 8:58675249-58675271 TTCTGTTTCTGAAGGGCAGGAGG + Intergenic
1042053682 8:64739014-64739036 TTCTGTCTCTGGCAGGCAGAGGG + Intronic
1042422299 8:68605952-68605974 TGGTGTGTGTGGGGGGCAGGAGG + Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1045634029 8:104161969-104161991 TTCTCTGACTGGAAGGCAGAAGG - Intronic
1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG + Intronic
1046834782 8:118788279-118788301 ATTTGTGTCTGGTGGGCAGGGGG - Intergenic
1046968645 8:120195383-120195405 AAGTGTGTGTGGCGGGCAGAGGG - Intronic
1047230856 8:122996639-122996661 ATGTGTGTGTGGAGGGCTGTGGG - Intergenic
1048055522 8:130859362-130859384 TTGTGTAAGTGGATGGCAGATGG - Intronic
1048786030 8:138051339-138051361 TTGTGTGTGTGGCGGGGAGTTGG + Intergenic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1050507779 9:6365264-6365286 TTGTGTGTTTGGGTGGCAGGAGG + Intergenic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1052384501 9:27807761-27807783 TTGTTTGACTGGATGGAAGAGGG + Intergenic
1054923219 9:70562602-70562624 TTGTGTGTGTGTTGGGCAGGGGG + Intronic
1057206678 9:93177766-93177788 ATGGGGGTCTGGAGTGCAGAGGG - Intergenic
1057857707 9:98614721-98614743 TTGTTTCTGTGGAGGGAAGAAGG + Intronic
1058797683 9:108514249-108514271 TGGTGTGTCTAAGGGGCAGATGG + Intergenic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1059646655 9:116274835-116274857 GTGTCTGACTGGAGGGCAGAGGG - Intronic
1060025499 9:120167459-120167481 GTGTGTGTCTGGTGTGTAGAAGG + Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060399308 9:123338865-123338887 TTCTTTATCTGGAGGGCAGCTGG + Intergenic
1061244587 9:129394901-129394923 TTGGGGGTCTGCTGGGCAGAGGG - Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1062036606 9:134385321-134385343 TTGTGTGGCTGGAGGGAGGCTGG + Intronic
1062401219 9:136373550-136373572 TGGTGTGTCTGCAGTGCAGGTGG - Exonic
1203486735 Un_GL000224v1:63092-63114 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1203499357 Un_KI270741v1:4992-5014 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1196025134 X:111034027-111034049 TTGTGTGTATGGCAGGGAGAGGG - Intronic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1197357251 X:125450558-125450580 TTGGGTGGGTGGGGGGCAGAGGG + Intergenic
1198621898 X:138521751-138521773 TTGTGTGTGTGAAAGGCAGTAGG - Intergenic
1199772207 X:150982489-150982511 GGGTGTGTCAGGAGAGCAGAGGG + Intronic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1201147059 Y:11070696-11070718 TTGTTTGTCTGAAACGCAGATGG - Intergenic
1201697568 Y:16842670-16842692 TTTTTTGTCTGGTGGGCAGCAGG - Intergenic