ID: 907738554

View in Genome Browser
Species Human (GRCh38)
Location 1:57140327-57140349
Sequence CCTCATCTGTAGAATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1019
Summary {0: 1, 1: 6, 2: 35, 3: 225, 4: 752}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907738554_907738560 -7 Left 907738554 1:57140327-57140349 CCTCCCTCATTCTACAGATGAGG 0: 1
1: 6
2: 35
3: 225
4: 752
Right 907738560 1:57140343-57140365 GATGAGGAAACATAAGGCCAGGG No data
907738554_907738565 23 Left 907738554 1:57140327-57140349 CCTCCCTCATTCTACAGATGAGG 0: 1
1: 6
2: 35
3: 225
4: 752
Right 907738565 1:57140373-57140395 TGTCCTCCTAGAACCTAAAGGGG 0: 1
1: 0
2: 2
3: 91
4: 224
907738554_907738563 21 Left 907738554 1:57140327-57140349 CCTCCCTCATTCTACAGATGAGG 0: 1
1: 6
2: 35
3: 225
4: 752
Right 907738563 1:57140371-57140393 AATGTCCTCCTAGAACCTAAAGG 0: 1
1: 0
2: 0
3: 5
4: 104
907738554_907738559 -8 Left 907738554 1:57140327-57140349 CCTCCCTCATTCTACAGATGAGG 0: 1
1: 6
2: 35
3: 225
4: 752
Right 907738559 1:57140342-57140364 AGATGAGGAAACATAAGGCCAGG No data
907738554_907738561 -6 Left 907738554 1:57140327-57140349 CCTCCCTCATTCTACAGATGAGG 0: 1
1: 6
2: 35
3: 225
4: 752
Right 907738561 1:57140344-57140366 ATGAGGAAACATAAGGCCAGGGG 0: 1
1: 0
2: 3
3: 36
4: 510
907738554_907738564 22 Left 907738554 1:57140327-57140349 CCTCCCTCATTCTACAGATGAGG 0: 1
1: 6
2: 35
3: 225
4: 752
Right 907738564 1:57140372-57140394 ATGTCCTCCTAGAACCTAAAGGG 0: 1
1: 0
2: 0
3: 16
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907738554 Original CRISPR CCTCATCTGTAGAATGAGGG AGG (reversed) Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
901214484 1:7548296-7548318 CCTCTTCTGTAGACTGTGGGAGG + Intronic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
901776319 1:11562884-11562906 TCTCATCTGTAAAATGGGAGTGG + Intergenic
902238427 1:15072889-15072911 CCTCATTAGTAGGATGAGGCCGG + Intronic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902623468 1:17663748-17663770 CCCCATCTGTAAAATGGGGTGGG - Intronic
902689452 1:18101123-18101145 CCTCATCTGTAAAATGGGACTGG - Intergenic
902700218 1:18167348-18167370 CCTCCTCTGTACAATAAGGCCGG - Intronic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902744707 1:18465911-18465933 CCCCATCTGTAAAATGGGTGGGG - Intergenic
902814970 1:18911186-18911208 CCTAATCTGTCAAATGGGGGTGG - Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903230363 1:21918621-21918643 CCTCCTCTATAGAATGAGGGTGG - Intronic
903260783 1:22130666-22130688 CCTCATCTGTAGTAAGAGAAGGG + Intronic
903306708 1:22418000-22418022 CCTCATCTGTAAAGTGGGAGTGG + Intergenic
903366965 1:22811097-22811119 CTTCATTTGTAAAATGAGAGGGG + Intronic
903475137 1:23614316-23614338 CCTTATCTGTAAAATGGGCGTGG - Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903624240 1:24719912-24719934 CCTCATCTGTAAAATAACGATGG - Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903809120 1:26024760-26024782 CCTCATCAGAAAAGTGAGGGAGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903853994 1:26325112-26325134 CCCCATCTGTAAAATGTGAGGGG + Intronic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
903993631 1:27290784-27290806 CCTCATCTGTAAAAGGAAAGAGG - Intronic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904203616 1:28838001-28838023 CCTCCTCTGTACACTGAGGATGG + Intronic
904203666 1:28838450-28838472 CCCCATCTGTAAAGTGAGAGAGG + Intronic
904254954 1:29248980-29249002 CCTCACCTGTAAAATGAGAGTGG - Intronic
904372735 1:30060382-30060404 TCTCATCTGTAAAATGAATGAGG - Intergenic
904424314 1:30413813-30413835 CCTCATCTGTGGGATGAGGGTGG - Intergenic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904807762 1:33143686-33143708 CCTCACCCACAGAATGAGGGAGG - Intergenic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905562080 1:38935489-38935511 CATCATCTGTAAAAGGAGGGTGG + Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906106944 1:43300419-43300441 TCCCATCTGTACAATGAGAGAGG + Intergenic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906730811 1:48079571-48079593 CCTCATCTGTAAAACGATGGTGG - Intergenic
906960335 1:50416089-50416111 CCTCCTCTGTAAAATGGGGCCGG + Intergenic
907046435 1:51302860-51302882 TCTCATCTGTGAAATGGGGGTGG - Intronic
907159387 1:52359659-52359681 CCCTATCTATAAAATGAGGGTGG + Intronic
907394646 1:54180687-54180709 CCTAATCTCTAGAATGAGGGTGG - Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907798077 1:57737457-57737479 CCTCATCTGTTAAATGGTGGTGG + Intronic
907831408 1:58067785-58067807 GTTCATCTGTACAATGAGTGGGG + Intronic
907901509 1:58745865-58745887 CCTCATCTGTAGGATGAAATGGG - Intergenic
907912692 1:58840699-58840721 CCTCACCTGAAGAATGATGGGGG + Intergenic
908061468 1:60354562-60354584 TCTCATCTATAGAGTGAGAGTGG + Intergenic
908129035 1:61056370-61056392 CCTCATCTGTAGAATTGCAGAGG - Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908846807 1:68333023-68333045 CTTCATCTGTAAAATGACGGGGG + Intergenic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909661011 1:78082133-78082155 CCACATCTGTAAAATAAGGTTGG - Intronic
909852106 1:80480383-80480405 CCTCACCTGTATAATGGGGTTGG - Intergenic
910487856 1:87735704-87735726 CCTCAACTATAAAATGAGGGGGG - Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911587977 1:99713189-99713211 ACTCACCTGTAAAATGGGGGTGG - Intronic
912488524 1:110048123-110048145 CCTCCTCTGTAAAATGAATGGGG + Intronic
912556555 1:110520423-110520445 CCTCAGTTGTGGAATGAGGAAGG + Intergenic
912725244 1:112053485-112053507 CCTCATCTATAAAATGTGGTAGG + Intergenic
913174584 1:116262342-116262364 CCTCATCTGTAAGGTGAAGGAGG + Intergenic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
914326443 1:146621511-146621533 CCTTATGTGTAGGTTGAGGGTGG + Intergenic
915364690 1:155308425-155308447 CCTCATCTGTTGAATGAGGGTGG - Intergenic
915718001 1:157962643-157962665 CCGCATCTGTCAAATGAGGTGGG + Intergenic
916418471 1:164614239-164614261 CCTCATTTGTAAAATCAGAGAGG - Intronic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
916744405 1:167673563-167673585 CAACATCTGTAAAATGAGGTGGG - Intronic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
917592316 1:176488985-176489007 TCTCATCTGTATAATAAGGTTGG + Intronic
917801195 1:178572229-178572251 CTTCACCTGTAAAATGAAGGCGG - Intergenic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
917965765 1:180177617-180177639 CCTCTTCTGAAGTCTGAGGGTGG + Intronic
918286147 1:183056657-183056679 CCTCACCTGTATAATGAGCGTGG - Intronic
918324110 1:183393322-183393344 CCTCATCTGTAAAATGGGATTGG - Intronic
918655140 1:187016097-187016119 CCTCATCTCTAAAATGAGAATGG + Intergenic
919354952 1:196510318-196510340 CCTAATCTGTATAATGGAGGTGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920251872 1:204627407-204627429 CCTCGTCTCTGGAATGAGAGGGG + Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920950457 1:210567385-210567407 CCTCATCTGGAAATTAAGGGAGG + Intronic
920971397 1:210746334-210746356 CCTCATCTGTAAAATGAAAGGGG - Intronic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921284832 1:213599972-213599994 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921327896 1:214005889-214005911 AATATTCTGTAGAATGAGGGAGG - Intronic
921549391 1:216515108-216515130 TCTCATCTGTAAAATAAGGCAGG - Intronic
921929702 1:220745296-220745318 CTTCATTTGTAGAATTAGTGAGG - Intergenic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
922249915 1:223839265-223839287 CCTTATCTGTTGAATGAGAGTGG + Intronic
922375116 1:224955945-224955967 TCTTATCGGTAGAATGAAGGAGG - Intronic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923533843 1:234832992-234833014 CCTTATCTGTGCGATGAGGGTGG + Intergenic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923721907 1:236474034-236474056 CCTCATCTATAAAATGGAGGTGG - Intronic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
1063078936 10:2746501-2746523 CCTCAATTGTAAAATGTGGGTGG - Intergenic
1063223713 10:3994498-3994520 CCTTACCTGTAGAAGGAAGGAGG + Intergenic
1064281189 10:13953027-13953049 TCTCTTCTGTAGGATGAGGATGG + Intronic
1064681516 10:17815178-17815200 CCCCATCTGTAAAATAAAGGGGG - Intronic
1064893349 10:20205789-20205811 CCTCATCTGTAAGATGAGGTGGG - Intronic
1065041976 10:21706398-21706420 CCTCATCTATAAAGTGAGGGTGG - Intronic
1067185708 10:44025344-44025366 GCCCCTCTGTAGAATGAGGATGG + Intergenic
1067209993 10:44252108-44252130 CCAGATCTGAAGAATGAGGATGG + Intergenic
1067451467 10:46384597-46384619 CCTCATTTGTACAACGGGGGTGG - Intronic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1067585772 10:47475159-47475181 CCTCATTTGTACAATGGGGGTGG + Intronic
1067688231 10:48480750-48480772 TCTCATCTGTAAAATGTGGTTGG - Intronic
1067942089 10:50665763-50665785 CTTCATTTGTAGTCTGAGGGTGG - Intergenic
1068154554 10:53181366-53181388 CCTTACATGTAAAATGAGGGAGG - Intergenic
1068528770 10:58161777-58161799 CCTCATTTGTAAAATGAAGGGGG - Intergenic
1068870379 10:61937065-61937087 CCTCATCAGTAAAATGAGAAAGG + Intronic
1068948233 10:62750998-62751020 TCCCATCTGTAGAAGGAAGGAGG + Intergenic
1069932094 10:71889719-71889741 CCTCAGCTCTAAAATGAAGGAGG + Intergenic
1069971564 10:72174816-72174838 CCTCCTCTGTAAAATAAGGGAGG + Intronic
1070486355 10:76935516-76935538 TCTCAACTGTAAAATGAAGGTGG + Intronic
1070678539 10:78432974-78432996 CCTCAGCTGTAGAATGAGTCAGG - Intergenic
1070684426 10:78470450-78470472 CCTCATCTGTGAAATGGGTGGGG - Intergenic
1070773824 10:79098446-79098468 CCTCACCTGTAAAATGGAGGTGG + Intronic
1070778790 10:79125788-79125810 CCTCATCTGTGCCATGAGTGGGG - Intronic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071305072 10:84292499-84292521 CTTCATCTATAAAATGAGGATGG - Intergenic
1071437202 10:85658404-85658426 TTTAATCTGTAAAATGAGGGGGG - Intronic
1071604365 10:86974602-86974624 CCTCATGTGTAGTCTGATGGGGG - Intronic
1071730877 10:88247269-88247291 CCTCATTTGTAGAATCAGAGAGG + Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072630753 10:97144901-97144923 CCTCATCTGTAAAGTGTTGGGGG - Intronic
1072667463 10:97404450-97404472 CATCAACCGTAGAATGAGGCTGG + Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1072772178 10:98151359-98151381 CCTCATTTGTAAAATGGAGGTGG + Intronic
1073125527 10:101146607-101146629 TCTCATTTCTAGAATGAGGTGGG + Intergenic
1073423970 10:103445173-103445195 GCTCATCTGGAAGATGAGGGTGG + Intronic
1073584658 10:104698204-104698226 CCACATCTGTAAAATGGGGCTGG - Intronic
1073692142 10:105820867-105820889 CCTCATGAGTAGTATAAGGGGGG + Intergenic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074297817 10:112207305-112207327 CCTTATCTGTAGAATGTGTTAGG - Intronic
1074526194 10:114265478-114265500 CCTCCTCTGTAAAATAAGGGAGG - Intronic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074889927 10:117727155-117727177 CCTCATCTATAAAATGGGGCAGG + Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075462715 10:122629255-122629277 CCTCATCAGAAAAATGAGAGTGG - Intronic
1075545779 10:123353378-123353400 TCCCATCTGTAAAATGAGGGTGG + Intergenic
1075551275 10:123394505-123394527 CCTCATCTGGGGAACGAGGTTGG + Intergenic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1075813618 10:125247111-125247133 CCTCATCTGTAAAATGATCCAGG + Intergenic
1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG + Intronic
1076111261 10:127861446-127861468 CCTCATCTGTAAAATGGAGTGGG - Intergenic
1076161755 10:128249333-128249355 CTTCATCTGTTGAATGAAGAAGG + Intergenic
1076823887 10:132957685-132957707 CCTCATCTGAGGACCGAGGGAGG + Intergenic
1076823925 10:132957869-132957891 TCTCATCTGAAGACCGAGGGAGG + Intergenic
1076823933 10:132957916-132957938 CCTCATCTGAGGACTGAGGGAGG + Intergenic
1077540077 11:3142518-3142540 CCTCATCTGTAAAAAGGGAGGGG - Intronic
1077580361 11:3413555-3413577 CCTCATCTATAAAATGGAGGTGG - Intergenic
1077735913 11:4790598-4790620 TCTCTTCTCCAGAATGAGGGTGG + Intronic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078434591 11:11314016-11314038 CCTGATCAGTAAAATGGGGGCGG - Intronic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1078779126 11:14420577-14420599 CCTCATCTGTAGAACAAGGATGG + Intergenic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079307780 11:19338910-19338932 CCTCATCTGCAGAATGGCTGTGG - Intergenic
1079327776 11:19509158-19509180 CCTCTTCTGTAAAATGGGGTTGG + Intronic
1079806991 11:24944290-24944312 CCTCATCTGAATACTGAGGTTGG - Intronic
1080181634 11:29432806-29432828 TCTCATCTGTAAAATGAGCTAGG + Intergenic
1080393090 11:31865984-31866006 GCTGGCCTGTAGAATGAGGGAGG + Intronic
1080582782 11:33657468-33657490 CCTCATCTATACAATGACAGGGG - Intronic
1080682643 11:34490650-34490672 TCTCCTCTGTAGAATGGGGTGGG + Intronic
1080685084 11:34508749-34508771 CCTCAACTGTAAAATGGTGGAGG - Intronic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1080849006 11:36051442-36051464 CCACATCTGTAAAATGAGATAGG + Intronic
1080893717 11:36431601-36431623 CCTCGTCTGAGGGATGAGGGTGG + Intronic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1081607527 11:44536798-44536820 CCTCTTCTGTGGAATGAAAGGGG + Intergenic
1081660806 11:44887249-44887271 CCACATCTGTAAGATGGGGGTGG + Intronic
1081689769 11:45069954-45069976 CCTTTTCTGTAAAATGAGAGAGG - Intergenic
1081722425 11:45300108-45300130 CCTCATCTGTACTATGGGAGGGG + Intergenic
1081800381 11:45854833-45854855 CCTCATCTATAAAATAAGGATGG + Intronic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082226682 11:49715940-49715962 CCTCCTCTATATAATGAGGATGG - Intergenic
1082740671 11:56907631-56907653 CCTCATCTGTAAAATGGATGAGG - Intergenic
1082794841 11:57371454-57371476 GCTCAACTGTAGATGGAGGGCGG + Intergenic
1083186794 11:61022328-61022350 CCTCACCTGTAAAATGAGAGTGG - Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083276166 11:61598219-61598241 CCTCATCTGTCAAATGGGGTGGG - Intergenic
1083622857 11:64057536-64057558 TCTCATCTGTAAAATGGGCGTGG - Intronic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083739096 11:64698478-64698500 CCTCTTCTGCAAAATGAGAGGGG + Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1084237287 11:67796383-67796405 CCTCATCTATAAAATGGAGGTGG - Intergenic
1085260793 11:75203593-75203615 CCTCATCTATAAAAGGAGGGGGG - Intronic
1085395444 11:76204930-76204952 CCTTATCTGTAAAATGGTGGCGG + Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085782628 11:79423298-79423320 CTTCATCTGTACAATGGCGGGGG - Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086337055 11:85810847-85810869 CCTCCTCTGTTAAGTGAGGGAGG - Intronic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1086622743 11:88907141-88907163 CCTCATCTATATAATGAGGATGG + Intronic
1086840726 11:91681014-91681036 TCTCATCTACAGAATGGGGGTGG - Intergenic
1086948880 11:92870937-92870959 CTTTATCTGTAAAATGAGGGTGG - Intronic
1088142054 11:106629353-106629375 CTTAATCTGTCAAATGAGGGGGG - Intergenic
1088455241 11:110026558-110026580 TTTCAACTGTAGAATGAGGGAGG - Intergenic
1088915889 11:114227403-114227425 ACTCTTCTGTAACATGAGGGGGG - Intronic
1088992206 11:114963416-114963438 CCTTAACTGTAGAATGTCGGTGG - Intergenic
1089015038 11:115158633-115158655 CATCATCTGTAAAATGAGGCTGG - Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089775986 11:120836294-120836316 CCTCAGCTGTAAAATGGGGTTGG + Intronic
1090429734 11:126635716-126635738 CCTTATCTGTAAAATGTGGCTGG + Intronic
1090487455 11:127126822-127126844 CCTCATCTGTAGTATAGGGCTGG + Intergenic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1091341910 11:134822701-134822723 CCTCATCTATAAAGTGAGGATGG - Intergenic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092295377 12:7193119-7193141 CCTCATCTATAAAATGGGGGTGG - Intronic
1092407954 12:8233976-8233998 CCTCATCTATAAAATGGAGGTGG - Intergenic
1092831711 12:12450292-12450314 CTTCATCTGTAAAAGGAAGGAGG - Intronic
1093652170 12:21657982-21658004 CCTCATCTGGAGGGTGGGGGAGG - Intronic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1095552912 12:43465358-43465380 CCTCATCTGTAAATTGAGAGTGG + Intronic
1096121759 12:49093174-49093196 TCTCAGATGTAAAATGAGGGTGG + Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096802492 12:54120386-54120408 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1096844158 12:54396227-54396249 CCTTTTCAGTAGAATGAGGGTGG + Exonic
1096978819 12:55716750-55716772 CCTCATCTCTAAAATGAAAGAGG + Intronic
1097152339 12:56988142-56988164 TCTCATCTTTATAACGAGGGAGG + Intergenic
1097915598 12:65017629-65017651 TCTCATCTGTAAAATGATGCTGG + Intergenic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1100059976 12:90563109-90563131 CCACATCTATAAAAAGAGGGAGG - Intergenic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1100483003 12:94997311-94997333 CTTCATCTGTGAAATGGGGGCGG + Intronic
1100585257 12:95973417-95973439 CCTTATCTGTGAAATGAGGAAGG + Exonic
1101013277 12:100473212-100473234 CCTCATCTGTAGAATGGATATGG - Intergenic
1101136341 12:101747654-101747676 CTTCATCTGTAGGAGGAGGCAGG + Intronic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101398915 12:104371692-104371714 CCTCAGCTGGAAAATGGGGGTGG + Intergenic
1101815898 12:108146012-108146034 CCTCGACTGGAGAAGGAGGGGGG + Intronic
1101827447 12:108231507-108231529 CCTCATCTGTAAAATGGGTTGGG - Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102185064 12:110941429-110941451 GCTCATCTGTGAAACGAGGGTGG - Intergenic
1102187911 12:110964327-110964349 CCACATCTGTAGAATGGAGATGG - Intergenic
1102516556 12:113452617-113452639 CTTCATCTGAAGTATGTGGGTGG - Intergenic
1102568566 12:113813199-113813221 TCTAATCTGTAAAATGATGGGGG + Intergenic
1102799826 12:115722427-115722449 CCTAATCTGTAGAAGAAGGTAGG - Intergenic
1102801690 12:115740670-115740692 CTCCATCTGTAAAATGGGGGTGG + Intergenic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1103165107 12:118763666-118763688 CCTCTTCTGTAGAATATGGTAGG - Intergenic
1103236075 12:119373686-119373708 CCTTATCTGTAAAATGAGATGGG + Intronic
1103290215 12:119839470-119839492 CCTGATCTTTGGCATGAGGGAGG + Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104946403 12:132416756-132416778 CCTCATCCCTAGAGGGAGGGGGG + Intergenic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1106327922 13:28711902-28711924 TCTCATCTGTAAAATGGGCGTGG - Intronic
1106656464 13:31752243-31752265 AGTCATCTGAAGAAGGAGGGGGG + Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107811058 13:44200069-44200091 CCTCCTCTGTAGAATGTGAGTGG - Intergenic
1108186490 13:47893106-47893128 CCTCATCTGTAAAGTGAGTGAGG + Intergenic
1108713339 13:53055685-53055707 CCACAACTGGGGAATGAGGGGGG - Intergenic
1109862170 13:68214238-68214260 CTTCATCTGTAAAATGAAGTGGG + Intergenic
1110210697 13:72968769-72968791 CCTCATATGTGAAATGAGAGTGG + Intronic
1112329605 13:98467060-98467082 TCTCATCTGTAGAATGGAGGTGG + Intronic
1114267215 14:21079942-21079964 CCTCATCTATAGAATGCGGATGG + Intronic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1115227177 14:31115830-31115852 CCTAATCTATAAAATGAGAGTGG - Intronic
1115378977 14:32711878-32711900 CTTCATCTGTAAAGTGAGGGGGG + Intronic
1116419009 14:44711749-44711771 TCTCATCTGTAGCATAAGGAAGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1117117837 14:52534640-52534662 ATTCATGTCTAGAATGAGGGTGG - Intronic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1117653546 14:57931080-57931102 CTTCCTCTGTAAAATGAGGGAGG - Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1119643736 14:76333978-76334000 CCCCATCTGTAAAATGGGGCAGG + Intronic
1119895321 14:78214976-78214998 CTTCGTCTGTAAAATGGGGGTGG + Intergenic
1119902496 14:78273292-78273314 CCTTATCTGTAAAATGAGTGTGG + Intronic
1119951887 14:78753670-78753692 CCTCTTCTGTAAAATGCTGGAGG - Intronic
1119996950 14:79263587-79263609 TCTCCTCTGTAAAATGAGGGAGG + Intronic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120575761 14:86179063-86179085 CCTTATTTGTAGAATGAGAGAGG + Intergenic
1120845668 14:89122811-89122833 CCTCCTCTGAAAAATGGGGGAGG - Intergenic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121248468 14:92482164-92482186 CCTCATCTGTTAAATGAGAAAGG - Intronic
1121450466 14:94004051-94004073 TCTCATTTGTAAAATGAGTGTGG - Intergenic
1121562671 14:94886592-94886614 CCTCATCTGTGAAATGGAGGTGG + Intergenic
1122146395 14:99691397-99691419 CCTCATCTGTAAACTGGGTGGGG + Intronic
1122151930 14:99730330-99730352 CCCCATCTGTGAAATGGGGGTGG - Intergenic
1122167571 14:99840452-99840474 CTTCATCTGTGGCATGAGGGTGG + Intronic
1122242094 14:100375881-100375903 CCTCATCTGTGGAATGGGCATGG + Intronic
1122570222 14:102693169-102693191 CCTGATCTGCAGAATTAAGGAGG - Intronic
1122886320 14:104712014-104712036 CCTCATCTATACAATGAGGGAGG - Intronic
1123114645 14:105889192-105889214 CCTCATCTTTAGAGGGAGTGCGG + Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1124783308 15:32656273-32656295 CGTCATCTGGAAAAAGAGGGAGG + Intronic
1125421051 15:39504420-39504442 CTTCCTCTGTAAAATGAGGCTGG - Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126096702 15:45095405-45095427 CCCCATTTGATGAATGAGGGAGG + Intronic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1127330461 15:57934110-57934132 CCTCATCAGTAGAATGACACTGG + Intergenic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1127997006 15:64158961-64158983 CCTGTTCTGTACAGTGAGGGTGG - Intronic
1128148664 15:65347371-65347393 TCTCATCTGTAAAATGGGAGTGG + Intronic
1128487327 15:68106737-68106759 CCTGATCTGTAGAGTGAAGGGGG + Intronic
1128699660 15:69794929-69794951 CCTCATCTATTAAAAGAGGGAGG + Intergenic
1128725703 15:69987023-69987045 CCCCATCTGTGAAATGAGGAGGG - Intergenic
1128752716 15:70160727-70160749 TCCCCTCTGTAAAATGAGGGTGG + Intergenic
1128793005 15:70446893-70446915 CCTCATCTGTAAAACAAGGATGG + Intergenic
1128862306 15:71084095-71084117 TCTCAACTGTAGAAGGAGGTGGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1130132460 15:81155600-81155622 CCTCACCTGTAAAATGACCGGGG - Intergenic
1130519018 15:84648089-84648111 CCTTATCTGTGAAATGAGGGTGG - Intronic
1130743409 15:86625228-86625250 CCCAATCTGTAAAATGAAGGTGG + Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131677273 15:94683318-94683340 CCTCCTCTGTAAAAAGGGGGTGG - Intergenic
1131697367 15:94892500-94892522 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132044107 15:98549353-98549375 GCTCATGTCTATAATGAGGGAGG - Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132406319 15:101543561-101543583 CCTCAGCTGTAGAAGGACGAGGG - Intergenic
1132564180 16:613189-613211 CCTCACCTGTAGAATCAGCAGGG + Intronic
1132653087 16:1030431-1030453 CCGCATCTGTAAAGTGGGGGTGG + Intergenic
1132895431 16:2226959-2226981 CCTCATCTGTAAAATGGGCTGGG - Intronic
1133113117 16:3561496-3561518 CCTCATCAGTAGGAAGAGGGAGG - Intronic
1133348901 16:5088806-5088828 CCTCATCTATAAAATGGAGGTGG - Intronic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133609284 16:7417976-7417998 GCCCATCTGTGGGATGAGGGTGG - Intronic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133921675 16:10159129-10159151 CCTCCTCTCTACAATGAGGGTGG + Intronic
1133921751 16:10159622-10159644 CCTCATCTGTAAAATGGGATTGG - Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134201143 16:12200122-12200144 TTTCATCTGTACAATGAGGTTGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134435122 16:14249625-14249647 CCTCATCTTTAAAATGAAGTTGG + Intronic
1134771506 16:16813233-16813255 CTTCATCTGTATAATGGTGGTGG - Intergenic
1134781032 16:16895718-16895740 TCTCATCTGTGGAATGGCGGCGG - Intergenic
1135051794 16:19199278-19199300 CCTCCTGTGTAGAATGAAGGAGG - Intronic
1135169100 16:20167219-20167241 CCCCATCTGTAAAATGGGGTAGG + Intergenic
1135422915 16:22316774-22316796 CCCCTCCTGTAGCATGAGGGTGG + Intronic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136099156 16:27980567-27980589 CTTCATCTGTAAAATGGGTGTGG - Intronic
1136112043 16:28069737-28069759 CCTCGTCTGTGAAATGAGGGCGG + Intergenic
1136158159 16:28399523-28399545 TCTCATCTGTAAAATAAGGCAGG - Intronic
1136204928 16:28715760-28715782 TCTCATCTGTAAAATAAGGCAGG + Intronic
1136236185 16:28914902-28914924 TCTTATCTCTGGAATGAGGGTGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136536218 16:30901350-30901372 TCTCATCTGTACAATGAATGGGG - Intronic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137413740 16:48252299-48252321 CAACACCTGTAAAATGAGGGAGG + Exonic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137626067 16:49909513-49909535 CCTGATCTGTAGAGTGGGAGTGG + Intergenic
1137801785 16:51268221-51268243 CCCCATGTGTAGACGGAGGGAGG - Intergenic
1137904019 16:52300607-52300629 CCTTCTCTATAAAATGAGGGAGG + Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138156691 16:54712262-54712284 CTTCATCTATAGAAGGAAGGAGG - Intergenic
1138382252 16:56610788-56610810 CCTCATCTGTAGAAAAAAGATGG + Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1138855143 16:60681697-60681719 CCTCCTCTGTAAAATGAAGCAGG + Intergenic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1139400370 16:66676541-66676563 CCTCACCTGTAAAACAAGGGAGG + Intronic
1139656414 16:68389717-68389739 CTTCAACTGTAGCATGAGGCTGG - Intronic
1140007123 16:71089434-71089456 CCTTATGTGTAGGTTGAGGGTGG - Intronic
1140555534 16:75916836-75916858 CTGCATCTGTAGAATCTGGGAGG - Intergenic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141344681 16:83233885-83233907 CCTCATCTATACAAGGAGTGTGG - Intronic
1141513593 16:84528233-84528255 CCCCATCTGTAAGATGTGGGTGG + Intronic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141638747 16:85329237-85329259 GTTCATCTGTAAAATGGGGGTGG + Intergenic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1142215916 16:88829744-88829766 CCTGATGTGTAGAATGAGTGGGG + Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1142895187 17:2971664-2971686 CCTCATCTGTGAAATGATGATGG + Intronic
1143011826 17:3870208-3870230 CCTCCTCTGTCAAATGAGAGAGG - Intronic
1143385852 17:6530073-6530095 CCTCATCTGTAGAATGGCAAGGG - Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144620047 17:16812703-16812725 CCTCATCAGTTCAAGGAGGGAGG + Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144764888 17:17727253-17727275 CCTCTTCTGTCAAAGGAGGGAGG - Intronic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144889811 17:18488160-18488182 TGTCATCTGTAGAATGAGCATGG + Intronic
1144892642 17:18503001-18503023 CCTCATCAGTTCAAGGAGGGAGG - Intergenic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145139572 17:20441286-20441308 CCTCATCAGTTCAAGGAGGGAGG + Intergenic
1145142403 17:20456157-20456179 CGTCATCTGTAGAATGAGCATGG - Intronic
1145249315 17:21288681-21288703 CCTCATCTGCAGACTGAGAATGG + Intronic
1145796318 17:27657414-27657436 CCTCATCAGTTCAAGGAGGGAGG - Intergenic
1145810751 17:27762696-27762718 CCTCATCAGTTCAAGGAGGGAGG - Intronic
1145823345 17:27857542-27857564 CCTCATCAGTAGAATGGGGGTGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146563189 17:33889232-33889254 CTTCATCTGAAAAACGAGGGGGG - Intronic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147039796 17:37709800-37709822 CCTCATCTATAAAATGGGGGCGG - Intronic
1147043591 17:37736434-37736456 CTTCATCTGTAAAATGGAGGTGG - Intronic
1147121148 17:38335810-38335832 GCTCCTCTGCAGAATGAAGGTGG - Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1147442238 17:40454221-40454243 CCTCATCTCCAAAATGAGTGAGG - Intronic
1148335378 17:46837525-46837547 CCTTATTTGTAAAACGAGGGTGG - Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148934585 17:51154691-51154713 CCTCATTTGTAAAATGAAGGGGG + Intronic
1149315457 17:55434276-55434298 TCTCACCTGTAAAATGGGGGAGG + Intergenic
1149346475 17:55741568-55741590 CCTCATCTGTAAAATGAAAGTGG + Intergenic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1150379556 17:64709828-64709850 CCCCATCTGTGGTATTAGGGAGG + Intergenic
1150649312 17:66999680-66999702 CCCCATGTGTTGAAGGAGGGAGG - Intronic
1151461216 17:74255255-74255277 CCCCATCTATAGAATGAGTATGG + Intronic
1151890821 17:76949501-76949523 CCTCAAGTGTAGAGGGAGGGTGG - Exonic
1151994981 17:77602857-77602879 TCTCATCAGTGGCATGAGGGGGG + Intergenic
1151999409 17:77636194-77636216 CCTCTTCTGTAAAACGGGGGTGG - Intergenic
1152101673 17:78305162-78305184 CCTCATCTGGATGATGTGGGTGG + Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153265393 18:3263732-3263754 GCTAATGTGTAGAATGAGGAAGG - Intronic
1153519889 18:5941664-5941686 CCGCATCTGTAAAGTGAGGGTGG + Intergenic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1154999832 18:21675240-21675262 CCTCATCTGTGGAATGAGGTGGG + Intronic
1155185209 18:23381741-23381763 CCTCATCTCTAGAATGGAAGAGG + Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156936046 18:42708534-42708556 CCTTATGTGGAGATTGAGGGAGG + Intergenic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157198834 18:45642003-45642025 CCTCATCTGTAAAATGGGCCAGG - Intronic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1157527037 18:48391631-48391653 CCACAGCTGTAGAAAGAAGGAGG - Intronic
1158479088 18:57804459-57804481 CCTCATTTGTAAAATGAGATTGG + Intergenic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158747520 18:60218454-60218476 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159052042 18:63429418-63429440 CTGCATCTGTAAAATGGGGGTGG + Intergenic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1160117968 18:76099810-76099832 CCTCATCTGTACAGTGAAGAGGG + Intergenic
1160159462 18:76460259-76460281 CCTCGTCTGTGAAATGAGGGTGG - Intronic
1160557995 18:79738437-79738459 CCTCACCTGTGAAATGAGGTAGG + Intronic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1161631843 19:5360925-5360947 CCCCATCTGTAAAATGGGGCTGG - Intergenic
1162048096 19:8014783-8014805 CCTCATCTCTAAAATGGGGGTGG + Intronic
1162918963 19:13889289-13889311 CCTGGTCTGCAGAATGAGGCAGG + Exonic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1163481415 19:17558830-17558852 CCTCATCTGTAACATGGGGGTGG - Intronic
1163595852 19:18220703-18220725 CCTCATCTGTAATATGAGTGTGG + Intronic
1163791037 19:19306209-19306231 CCCCATCTGTAAAATCAGGGTGG - Intronic
1164156001 19:22597580-22597602 TCACATCTGTAAAATAAGGGTGG + Intergenic
1165394542 19:35557263-35557285 CCTCATCTGTAAGATGAGAATGG - Intronic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166774400 19:45303473-45303495 TCTCATCTGCAGAATGGGAGCGG + Exonic
1167145181 19:47677080-47677102 CCTCGTCTGTGAAATGAGGAAGG + Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1168397390 19:56060248-56060270 CCCCATCTGTGAAATGGGGGCGG + Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
1168492289 19:56821160-56821182 CCTCATCTGTAAAATGAATATGG - Intronic
924977051 2:187317-187339 CCTCATCTAAAGACTGAGGAAGG - Intergenic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925671269 2:6312005-6312027 GCTCATTTGTTGAATGAGTGGGG - Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926247589 2:11132533-11132555 CCTCATCTGTAGAATGGCGTTGG + Intergenic
926809012 2:16740075-16740097 CTTCATCTATAAAATGAGGAAGG - Intergenic
926886203 2:17601210-17601232 CCTTATTTGTAAAATGGGGGAGG - Intronic
927562474 2:24083867-24083889 CCTTATCTGTAGAATTAAGATGG + Intronic
927687006 2:25178048-25178070 CCTCATTTGAACAATGGGGGCGG + Intergenic
927856589 2:26531374-26531396 CCCCATCTGTGAAAAGAGGGGGG + Intronic
927916471 2:26939829-26939851 ACTCATCTACAGAATGAGTGTGG - Intronic
927973955 2:27323708-27323730 CTGCATCTGTAAAATGAGGGAGG + Intronic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
928216691 2:29367411-29367433 GCTAATCTGTAAAATGAGGGAGG + Intronic
928253972 2:29706118-29706140 CCTCATCTGTAAAATGGAGTGGG + Intronic
928399989 2:30970881-30970903 GCTCATCTGTGGAGTGGGGGCGG - Intronic
928642924 2:33319459-33319481 CATCATCAGTAGAATGTGTGTGG + Intronic
928999352 2:37330372-37330394 CCTTACATGTAAAATGAGGGGGG + Intergenic
929309295 2:40403427-40403449 CCTGTTGTGTAGAAAGAGGGTGG - Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930884907 2:56314391-56314413 CCTCATCTGTGGAATGAGAAGGG + Intronic
931014630 2:57962204-57962226 CCTTATCTGTAGGATGAAGAGGG - Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
931859326 2:66337665-66337687 CCTTATCTGTAATATGAGGAGGG + Intergenic
932192946 2:69756381-69756403 CCTCAACTGTAAAATGAAAGGGG + Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932298372 2:70645356-70645378 CCTCATCTGTAGAATGGAGGAGG + Intronic
932305866 2:70703998-70704020 CCTCATCTGTGGAGTCAGGTTGG + Intronic
932414558 2:71565759-71565781 TATCATCTGTAAAATGAGGGTGG + Intronic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933782254 2:85810912-85810934 CCTCATCTGTAAAACCAGGGCGG - Intergenic
933799769 2:85951579-85951601 CCTTAGCTGTAAACTGAGGGTGG + Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937425008 2:121791363-121791385 TCTCTTCTGTCGAATGTGGGCGG + Intergenic
937593111 2:123639137-123639159 CCTCATCTATCAAATGAGAGTGG - Intergenic
937850111 2:126624370-126624392 CCTCATCTGGAAAATAAGGATGG - Intergenic
938833893 2:135079827-135079849 TCTCATCTATAAAATGAGGTTGG + Intronic
939620493 2:144413025-144413047 CCTCATCTGTAAAATGAGCCAGG + Intronic
939621127 2:144420482-144420504 CTTCAGCTGAAAAATGAGGGTGG - Intronic
940332078 2:152485811-152485833 CTTTACCTGTAGAATGAGAGGGG - Intronic
940598772 2:155829631-155829653 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941172230 2:162153258-162153280 CCTTATTTGTAAAATGAGAGGGG + Intergenic
941203510 2:162543743-162543765 CCTCATCTATAAAATAAGGAAGG + Intronic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
942197397 2:173535078-173535100 CCCCACCTGTTGAAGGAGGGAGG + Intergenic
942202354 2:173583949-173583971 CCTCATCTGTGGAATGGTAGTGG - Intergenic
943272515 2:185825312-185825334 CCTCATCTATAAAATGAGTATGG - Intronic
944477347 2:200120423-200120445 CCTCACCTTTGAAATGAGGGAGG - Intergenic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945034502 2:205692890-205692912 TCTCATCTATAGAATGAGAGGGG - Intronic
945058389 2:205887878-205887900 CCTGATCTGTGGAATGGGGGTGG - Intergenic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945266555 2:207896826-207896848 CCGCAGCTGTAGAAAGAGTGTGG + Intronic
945363152 2:208916771-208916793 CATCTTGTGTAGAATGAGGAAGG - Intergenic
945608271 2:211964228-211964250 CCTCTTCTGGAGAATGAATGGGG + Intronic
945694474 2:213085685-213085707 CATAATCTGTAGAATGAAGGAGG + Intronic
946109778 2:217404492-217404514 TCTCATTTGTAAAATGAAGGTGG - Intronic
947137250 2:226987638-226987660 CCTCATCTGTACCCAGAGGGGGG - Intronic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948243251 2:236456269-236456291 CCTCATCTTAAAAATGAGGTAGG - Intronic
948631983 2:239308154-239308176 CCTCATCTGTGAGATGGGGGTGG + Intronic
948685352 2:239666432-239666454 CCCCATTTGTAGAATGACGATGG + Intergenic
948794928 2:240397628-240397650 CCTCGTCTGTAGAAAGGGGTTGG - Intergenic
1168797274 20:620039-620061 CCTCATCTGTAAAATGAACTTGG - Intergenic
1168826588 20:818447-818469 CCTCATCTGTAGAATGAGTGAGG + Intergenic
1168830635 20:843610-843632 TCTCATCTGTAAAATGGAGGGGG - Intronic
1169304820 20:4480290-4480312 CCTCATCTGGAGACATAGGGAGG + Intergenic
1170009913 20:11711872-11711894 CCTCATCTGTGAAATCTGGGAGG - Intergenic
1170039750 20:12027511-12027533 ACTCACCTGTAAAATGAAGGAGG - Intergenic
1170415011 20:16130263-16130285 CTTCATCTGCAAAATGAAGGTGG - Intergenic
1171009718 20:21502483-21502505 CCTCTTCTGAGGAATGAGAGTGG + Intergenic
1171387800 20:24781851-24781873 CCTCACCTGTGTAATGAGGGTGG - Intergenic
1171794252 20:29554200-29554222 CCTCACCAGTAAAAAGAGGGAGG - Intergenic
1171854221 20:30330191-30330213 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1172123086 20:32609860-32609882 CCTCAGATGGAGAGTGAGGGGGG - Intergenic
1172131563 20:32659495-32659517 GCTCATCTGTACAATGAAGATGG - Intergenic
1172294950 20:33802931-33802953 CCTCAACTGTAAAATGGAGGTGG + Intergenic
1172298332 20:33829998-33830020 CCTCATTTGTAAAATGGGAGTGG - Intronic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1172505522 20:35459213-35459235 CCTTATCTGCAAGATGAGGGGGG + Intronic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1173236277 20:41248702-41248724 CCTCCTCTGTGGAATGAATGTGG + Intronic
1173542393 20:43863877-43863899 CCTCATCTCTAAAACGGGGGTGG + Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173852795 20:46229294-46229316 CCTCAGCTGTAAAATTGGGGGGG - Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1173929564 20:46807484-46807506 TCTCAACTGTAAAATGGGGGTGG - Intergenic
1174200018 20:48800576-48800598 CCTCGTCTGTGACATGAGGGAGG - Intronic
1174361574 20:50032070-50032092 CATCAGGTGGAGAATGAGGGTGG + Intergenic
1174362054 20:50035054-50035076 CATCAGGTGGAGAATGAGGGTGG + Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174802618 20:53576828-53576850 CCTCATCTGTAGAACCAAGGCGG - Exonic
1174817015 20:53695969-53695991 CCTCATCTGTGGGATGAGAATGG - Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1176201792 20:63864265-63864287 CCTCATCTGTGGAGTGGGGAGGG + Intergenic
1176230936 20:64032610-64032632 CCTCATCTGTGGGCTGAGGCTGG + Intronic
1176297300 21:5080909-5080931 CCTCATCTGGAGCATAAGGATGG - Intergenic
1177918100 21:27116047-27116069 CCTCTTCTATAAAATGAGGAAGG + Intergenic
1178090695 21:29160068-29160090 GCTCAGATGTAGAGTGAGGGGGG - Intronic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178412819 21:32379664-32379686 TCTCATCTGTAAAATGGGTGTGG - Intronic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1178900080 21:36591596-36591618 CGTCCTCTGCAGAATAAGGGAGG + Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179859729 21:44181039-44181061 CCTCATCTGGAGCATAAGGATGG + Intergenic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1181200960 22:21216747-21216769 CCCCATCTGTAAAATGAGTCAGG - Intronic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181700781 22:24620226-24620248 CCCCATCTGTAAAATGAGTCAGG + Intronic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182086381 22:27563917-27563939 CCCCATCTGTAAAATGAAGAGGG + Intergenic
1182131039 22:27850864-27850886 TCTCATCTATACAATGAGGATGG + Intergenic
1182243021 22:28932267-28932289 CCTCACCTGTAAAATAAGGCCGG + Intronic
1182247554 22:28971615-28971637 CCTCATCTGTAAAATAAGAATGG - Intronic
1182413481 22:30206121-30206143 CCTCATCTGTAAATGGAGGCGGG - Intergenic
1182438552 22:30347364-30347386 CCTCACCAGTATAATGGGGGTGG - Intronic
1182461286 22:30485735-30485757 CCTCATCTGTAGGCTGCGGATGG + Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183442657 22:37831961-37831983 CTGCATCTGCAGACTGAGGGAGG + Exonic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184160567 22:42694943-42694965 CCTCATCTGTAGGGTGGGGGTGG - Exonic
1184469040 22:44685114-44685136 CCTCTTCTGAAAAATGTGGGTGG + Intronic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
1184604360 22:45563652-45563674 CCACATCTGTAAAACGAGAGGGG - Intronic
1184697079 22:46145776-46145798 CCTCATCTCTAAAATGGGGCAGG - Intergenic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
949302126 3:2595924-2595946 CATCATCTGTTGTATGTGGGTGG + Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949807279 3:7969623-7969645 CCTCCTCTGTAAAATGAAGGTGG - Intergenic
949894200 3:8757160-8757182 CCTTATCTGTAGCATGGAGGCGG + Intronic
949943104 3:9169930-9169952 CCTCTCCTGTAAAATGAAGGGGG + Intronic
949982600 3:9511387-9511409 CCTCATTCGTATAATGAGGGTGG - Intronic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950397235 3:12742871-12742893 CCTTATCTGTATAATGGGTGGGG - Intronic
950433183 3:12963172-12963194 TCTCATCTTTAGAAACAGGGAGG + Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950569194 3:13789529-13789551 CCCCATCTGTAGAACAAGGAGGG + Intergenic
950654971 3:14430919-14430941 CCTCATCTGTAAAATGGGCTTGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950706456 3:14785519-14785541 CCTCACCTGTACAATCAGGGAGG - Intergenic
950950311 3:16991900-16991922 CATCATATTTAGATTGAGGGAGG + Intronic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951463610 3:22977700-22977722 CTTTATCTGTACAATGAGGACGG + Intergenic
951698707 3:25472558-25472580 CCTCATCTGTGAAATGGAGGGGG - Intronic
951793122 3:26508484-26508506 CCTCCTGTGTAAAATGAGGTCGG - Intergenic
951935075 3:28014164-28014186 CCTCGTCTGTGAAATGTGGGAGG - Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953359054 3:42278983-42279005 CCCCACCTGTTGAAGGAGGGAGG + Intergenic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
953739001 3:45520507-45520529 CCTCATCTGTAAAATATTGGGGG - Intronic
953928239 3:46993205-46993227 CCTCATCTGTAAAAACAGAGGGG - Intronic
954326027 3:49864498-49864520 CCTCATCTGTAGTGCTAGGGGGG + Intronic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954786093 3:53093583-53093605 CCTCATGTGCAGAATCTGGGTGG - Intronic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
955066815 3:55540600-55540622 CCCCATCTGTAAAACGAAGGAGG + Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955259809 3:57376085-57376107 GCTTATCTGTAAAATGAGGTTGG + Intronic
955842573 3:63128012-63128034 CCTCATCTGTGAAATGAGCATGG - Intergenic
955867801 3:63403545-63403567 TCTCATCTGTTAAATGAGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956536594 3:70283568-70283590 CCTCATCTATACAATGAGCTTGG + Intergenic
956546948 3:70415055-70415077 TGTCAACTGTAAAATGAGGGGGG + Intergenic
956686105 3:71828985-71829007 CTTCATCTTTAAAATGAAGGTGG + Intergenic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
960100450 3:113736988-113737010 CATCATCTGTAAAATGAAGGGGG - Intronic
960576309 3:119233246-119233268 CCCACTCTGTAGAATGAGGGAGG - Intronic
960789597 3:121413870-121413892 TCTTATTTGTAAAATGAGGGGGG - Intronic
960952619 3:123009373-123009395 CTTCTTCTGTGGGATGAGGGAGG + Intronic
960997238 3:123348281-123348303 GCTCGTCTGTAAAATGAGGATGG + Intronic
961072404 3:123945872-123945894 CCTCATCAGTAAAATGGGAGTGG + Intronic
961301595 3:125925392-125925414 CCTCATCTATAAAATGGAGGTGG + Intergenic
961535496 3:127568137-127568159 CCTCATCTGTAAAATGGGATAGG + Intergenic
961622606 3:128236400-128236422 CCTCATCTGTAAATGGCGGGGGG + Intronic
961846474 3:129768753-129768775 CTTCATCTGTAAAATAAAGGTGG + Intronic
961886872 3:130102463-130102485 CCTCATCTATAAAATGGAGGTGG - Intronic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
962471088 3:135709971-135709993 CTTCATCTGTAGAATGGGTGTGG - Intergenic
962869666 3:139477014-139477036 TCTCATCTGTAAAATAAGGATGG - Intronic
964091052 3:152876012-152876034 TTCCATCTGTAAAATGAGGGTGG - Intergenic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
964970463 3:162553687-162553709 CCTCATGTGTTGAGGGAGGGAGG - Intergenic
965522878 3:169685930-169685952 CCTAATCAGTAAAATGAGAGAGG - Intergenic
965638721 3:170811081-170811103 CCTTATCTGTAAAATGGAGGTGG + Intronic
965669246 3:171129570-171129592 CCACATGTGTAGAAACAGGGAGG - Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
965772600 3:172196577-172196599 TCTCATCTGTAAAATGGAGGTGG + Intronic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
967230699 3:187335054-187335076 GCTCATCTGTAAAATAAGAGTGG - Intergenic
967260817 3:187640197-187640219 CCTCATCTGTAAAATGGTAGTGG - Intergenic
967278109 3:187796081-187796103 CCTCATCTGTTGAATGATGAGGG - Intergenic
967686752 3:192426219-192426241 CCTAATCTATAAAAGGAGGGGGG + Intronic
967946276 3:194806620-194806642 CCTCATCTGTAAAACAAAGGAGG + Intergenic
968277793 3:197454197-197454219 CATCTGCTGTAGAAGGAGGGAGG + Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969241909 4:5904528-5904550 CCTTATCTGTAAAATGGGTGTGG - Intronic
969524327 4:7696494-7696516 CCTCATCTGTAACATGAGGTTGG + Intronic
969757949 4:9162231-9162253 CCTCATCTATAAAATGGAGGTGG + Intergenic
969817931 4:9699773-9699795 CCTCATCTATAAAATGGAGGTGG + Intergenic
970026579 4:11630378-11630400 GCTCATGTGTAAAATGAAGGAGG + Intergenic
970113976 4:12672058-12672080 CCTCATATGTAGAGAGAGTGTGG - Intergenic
970200345 4:13598531-13598553 CCTCGTTTGTAAAATGAGGGTGG + Intronic
970206317 4:13659039-13659061 CATCAGCTGTAAAATGAGGAGGG - Intergenic
970265024 4:14273055-14273077 CCTCAACTGTGGAATGAGTGTGG - Intergenic
970322494 4:14888579-14888601 CCTCCTCTAGAGAATGAGGATGG - Intergenic
970511292 4:16784347-16784369 CCTCATCTGTAGACTGGGGCTGG + Intronic
970991307 4:22216338-22216360 CCTCAGCTATAAAATGAGGATGG + Intergenic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973027394 4:45289926-45289948 CCTCATAGGTAGAGTTAGGGAGG + Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
974772090 4:66429529-66429551 ATTCATCTGGAGAATGATGGAGG + Intergenic
975438664 4:74384185-74384207 CTTCATCTGTAAGATGAGGATGG + Intronic
975502692 4:75104355-75104377 TGTCACCAGTAGAATGAGGGGGG + Intergenic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
976793579 4:88907867-88907889 CCTCATCTGTAAAATCAGGGAGG - Intronic
977455450 4:97254468-97254490 CCTCATCTGTAAGTTGAAGGTGG - Intronic
978142634 4:105335029-105335051 TCTCATCTGTACAATGATGAAGG + Intergenic
978496662 4:109366715-109366737 CCTCATTTGGTGAATGAGGCTGG + Intergenic
979741381 4:124155136-124155158 CCTTATCTGAATAATAAGGGTGG - Intergenic
980254097 4:130353735-130353757 CCTCATCTGTAAAATGAAAGTGG + Intergenic
981316314 4:143343137-143343159 CCTTACCTGTAAAATGGGGGAGG + Intronic
982895886 4:160924847-160924869 ACTCATCTGTCTAATCAGGGCGG + Intergenic
983578917 4:169288268-169288290 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
983891800 4:173037332-173037354 CTTCATCAGTAAAATGAGGTGGG - Intronic
984247039 4:177287133-177287155 AGTCACCTGTAGAATGAGGAAGG - Intergenic
984649755 4:182257736-182257758 TCTCTTCAGTAAAATGAGGGTGG - Intronic
986006688 5:3674113-3674135 CCAGCTCTGTAGAAAGAGGGTGG - Intergenic
986180704 5:5390597-5390619 CCACATCTGTGGAATCAGGGCGG + Intergenic
986234355 5:5893513-5893535 CCTCACCTGGAGAATGGGCGTGG - Intergenic
986428723 5:7660350-7660372 CCTTCTCTGAAGAATGAGAGAGG + Intronic
987707430 5:21473940-21473962 CCACATCTGTGGAATCAGGGCGG - Intergenic
987769660 5:22284398-22284420 TCTCATCTGAAGACTGAGGATGG + Intronic
988018847 5:25597333-25597355 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
989110451 5:37902109-37902131 CCTCCTCTCTAAAATGAGGAAGG + Intergenic
990382795 5:55232967-55232989 CTCCATCTGTAAAATGAGGCCGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990588246 5:57233954-57233976 CCACATCTTGAGAATGGGGGTGG - Intronic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992240861 5:74767728-74767750 CCTCAGCAGTAAAATGAAGGGGG - Intronic
992300142 5:75369569-75369591 CCTCATCTGTAAAACAGGGGTGG + Intronic
992401143 5:76412872-76412894 CCTCATCTGTAAAATGTAAGTGG + Intronic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
996546596 5:124685680-124685702 CCTCCTCTGGAGAATCAGGCTGG - Intronic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
997622764 5:135309636-135309658 CCTCATCTGTGAAATGTGAGAGG + Intronic
997708327 5:135979985-135980007 CCTTTTGTGTAGTATGAGGGGGG - Intergenic
997779839 5:136645579-136645601 CCTCATGTGTACAATGGAGGTGG - Intergenic
998157207 5:139793865-139793887 CCTCATCTGCCCAATGAGGATGG - Intergenic
998254488 5:140574255-140574277 CCTCATCTGGAAAATGTCGGGGG - Intronic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998458054 5:142289001-142289023 CCTCATCTCTAAAATGAGCTTGG + Intergenic
998831872 5:146168199-146168221 CTTCATCTGGAAAATCAGGGGGG + Exonic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999113726 5:149143037-149143059 GCTCATCTGTATGATGAGAGGGG + Intronic
999143628 5:149378837-149378859 TCCCATCTGGAGAGTGAGGGAGG - Intronic
999271671 5:150300270-150300292 TATCATCTGTAGAATGGGGGTGG - Intronic
999364091 5:151010134-151010156 CCTCATCTGTAAAATGGATGTGG + Intergenic
999399501 5:151253445-151253467 TCTGGTCTGTACAATGAGGGTGG + Intronic
999571305 5:152923037-152923059 CCTCATCTGTAATATGAGGGTGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000276221 5:159737429-159737451 CATCATCTGTGGACAGAGGGTGG + Intergenic
1000549229 5:162638509-162638531 ACTTATCTGAAGATTGAGGGAGG - Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001086665 5:168704981-168705003 CCTCAGCTGTAAAATGGAGGAGG - Intronic
1001131614 5:169069148-169069170 CCTCAACTGTAAATTGGGGGTGG - Intronic
1001219901 5:169891622-169891644 CCCCATCTCTATAATGAGGGGGG - Intronic
1001219977 5:169892243-169892265 CCCCATCTCTATAATGAGGGGGG - Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001724503 5:173885726-173885748 CCTTATGTGTAGACAGAGGGAGG + Intergenic
1001773200 5:174311161-174311183 CCTCATCTGTGGAATGGGCGTGG + Intergenic
1001841044 5:174877106-174877128 CCCCATCTGTAGGATGGGTGTGG - Intergenic
1001879992 5:175235017-175235039 CCTCGTCAGCAGAATGAGGTTGG - Intergenic
1001953630 5:175833294-175833316 TCTCATCTGCAAAATCAGGGTGG - Intronic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1002665343 5:180819593-180819615 CCTCATCTGTGGAATCACAGAGG - Intergenic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1003175283 6:3749551-3749573 CCTCACCTGGAGCAGGAGGGAGG - Intronic
1003333824 6:5152154-5152176 CCTCATCTATAGAATGAAGTTGG - Intronic
1003533124 6:6954247-6954269 CCTCATCTCTAAAACCAGGGTGG + Intergenic
1003975673 6:11341438-11341460 CCTCAGCCGTGGACTGAGGGAGG - Intronic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004240778 6:13919218-13919240 CCCCATCTATAAAATGAAGGTGG - Intergenic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1004900287 6:20187303-20187325 TCTCATCTGTAAAGTGAGGGAGG + Intronic
1005699476 6:28385925-28385947 TCTCAACTGTATAATGAGGTTGG - Intronic
1005945640 6:30593410-30593432 TCTCATCTGTAAAATGAAGGTGG + Intronic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008325944 6:50181794-50181816 CCTCACGTGTCGAAGGAGGGAGG + Intergenic
1009020794 6:57946572-57946594 CCACATCTGTGGAATCAGGGCGG + Intergenic
1010740009 6:79490357-79490379 TCTCATGTATAAAATGAGGGTGG - Intronic
1011986964 6:93459229-93459251 CCTAATCTATAAAATGAGGTTGG + Intergenic
1012860943 6:104558802-104558824 TCCCATCTGTAAAATGAGGCTGG + Intergenic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1013521487 6:110937777-110937799 CTCCATCTGTAAACTGAGGGTGG + Intergenic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015178208 6:130334440-130334462 CCTCATCTGTAAAATGAAAGAGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1016723527 6:147331496-147331518 CCTCATTTATAAAATGAAGGTGG + Intronic
1018090108 6:160339011-160339033 ACCCATCTGTAGCTTGAGGGTGG - Intergenic
1019501413 7:1366701-1366723 CTTCCTCTGTAGAATGGGGTGGG - Intergenic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020320309 7:6934877-6934899 CCTCATCTATAAAATGGAGGTGG - Intergenic
1021675646 7:23077863-23077885 CCTCATCTGTAAAACAGGGGTGG + Intergenic
1021840157 7:24715887-24715909 CTTCATTTGCAGAATGAGAGAGG + Intronic
1021903602 7:25311854-25311876 CCTCATATGTGGAGGGAGGGAGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022040764 7:26579351-26579373 CCTCATCTGTAAAATGGAGCTGG + Intergenic
1022214565 7:28245770-28245792 CCTCATCTGAGAAATGAAGGGGG + Intergenic
1022776995 7:33537084-33537106 CCTCAGCTGTTAAGTGAGGGAGG - Intronic
1023154153 7:37231253-37231275 CCTAATCGGTTGAATGAGGGGGG - Intronic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023623998 7:42098416-42098438 CCTCACCTATAGGATCAGGGAGG + Intronic
1023627285 7:42128845-42128867 CCTCATCTCTAAAATGGGAGTGG - Intronic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1024542856 7:50493112-50493134 CCTCATCTGTAAAGAGAGCGTGG + Intronic
1026010463 7:66631825-66631847 CCTAATCTGTAGAGTGAGCCTGG - Intronic
1026020105 7:66699388-66699410 TCTCATCTGTAAAATGGGAGTGG + Intronic
1026052918 7:66961851-66961873 CCTCATCTGTAAAACAAGGATGG + Intergenic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1026928959 7:74212573-74212595 TCTCATCTATAAAATGAGGTCGG - Intronic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1028655130 7:93196397-93196419 TATCATCTATAGAATGATGGCGG + Intronic
1028828357 7:95300289-95300311 TCTCATCTGTAGAATGAAATGGG + Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029464925 7:100719569-100719591 CCTCATCTGTCAAATGGGTGTGG - Intergenic
1029527266 7:101102622-101102644 CCTCATCTTTAAAACGAGGATGG - Intergenic
1029658667 7:101944535-101944557 CCTCATCTGTGAAGTGAGAGGGG - Intronic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1031439258 7:121772982-121773004 CCACATCCATACAATGAGGGAGG - Intergenic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032658938 7:133961954-133961976 CCTCCTCTGAGAAATGAGGGCGG - Intronic
1032675374 7:134125375-134125397 TCTCATCTGTCTAATGAGGATGG + Intergenic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1034384778 7:150731890-150731912 CCTTATCTGTAATATGGGGGAGG + Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1034556535 7:151853968-151853990 CCTTGTCTGTAGAATAAAGGGGG - Intronic
1035582054 8:746595-746617 CCTCATCTGCTGAATGAATGTGG + Intergenic
1035756214 8:2034858-2034880 CCTCATCTGTAAGGTGAGCGTGG - Intergenic
1035839301 8:2793569-2793591 TCTTGACTGTAGAATGAGGGAGG - Intergenic
1035905851 8:3509497-3509519 CCTCATCTTTAAAATGAAGAAGG + Intronic
1036381202 8:8237553-8237575 CCTCATCTATAAAATGGAGGTGG + Intergenic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1036848361 8:12185075-12185097 CCTCATCTATAAAATGGAGGTGG - Intronic
1036869721 8:12427356-12427378 CCTCATCTATAAAATGGAGGTGG - Intronic
1036959801 8:13231668-13231690 CCTCATCTGTTAAATGGAGGTGG - Intronic
1037061047 8:14509946-14509968 CCTCACCTGTTGAGGGAGGGAGG - Intronic
1037272612 8:17146209-17146231 TCTCATCTGTAGCATGAGAAAGG + Intergenic
1037829818 8:22180797-22180819 CCTCATCTGTAAAATAAAGGTGG - Intronic
1038352214 8:26787032-26787054 CCTCATCTGTAAGATGAGGTTGG - Intronic
1038693053 8:29780682-29780704 CCCCATCTGTAAAATGAAGGTGG + Intergenic
1039344052 8:36684432-36684454 CCTCATTTCTAAAATCAGGGAGG + Intergenic
1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG + Intronic
1041045771 8:53884553-53884575 CCTCATCTGTAAAACGAAGGAGG - Intronic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042086591 8:65115726-65115748 CCCCATATGTGGAAGGAGGGAGG - Intergenic
1042491270 8:69401249-69401271 TATCATCTGGGGAATGAGGGAGG + Intergenic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG + Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1044999981 8:97870175-97870197 CCTCATCTGTCTAATGAGGATGG + Intronic
1045547969 8:103144947-103144969 CCTCACTTGTAAAAGGAGGGTGG - Intronic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1045684931 8:104702221-104702243 CCTCACCTGTCGAGGGAGGGAGG + Intronic
1045863880 8:106843336-106843358 TTTCATCTTTAGACTGAGGGAGG + Intergenic
1046793141 8:118343079-118343101 CCTCATCTGTAAGATGAGAAGGG + Intronic
1046999756 8:120562267-120562289 CCTCATCTGAACAAAGGGGGCGG - Intronic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047411596 8:124628794-124628816 CCCCATCTTTAAAATGAGGATGG - Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1047742081 8:127814587-127814609 CAACATCTGTAAAATGAGGATGG - Intergenic
1048234320 8:132675248-132675270 CCTAATCTGTAAAATGGGCGGGG - Intronic
1048559785 8:135521624-135521646 CCTCATTTGTAATATGAGGTTGG + Intronic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049310324 8:141930761-141930783 CCTCATCTGTAGATGCAGGGTGG - Intergenic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1050351218 9:4741967-4741989 CCTCTCCTGTAAAATGAGGTAGG - Intronic
1050459662 9:5866880-5866902 CCTCATCTGTAAAATGGGACTGG + Intergenic
1051296493 9:15601423-15601445 CCTCTTCTGTAGAATCTGGAAGG + Intronic
1051584016 9:18707569-18707591 TCTCATCTGTAAGATGGGGGTGG - Intronic
1051694420 9:19752785-19752807 CCTCATCTGTAGTATGGGCATGG - Intronic
1051922392 9:22283205-22283227 CCTCTTCTGTAAAATGAAGTTGG - Intergenic
1053198658 9:36138005-36138027 CCCTGTCTGTACAATGAGGGTGG + Intronic
1053418945 9:37964794-37964816 CTTCATCTGTACAGTGGGGGCGG - Intronic
1053419129 9:37965831-37965853 CCTCATCTGTACAGTGGGGGCGG + Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1053792030 9:41693472-41693494 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054153126 9:61621293-61621315 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054180435 9:61905492-61905514 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054472920 9:65552497-65552519 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054657156 9:67675650-67675672 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1056071103 9:82987793-82987815 TCTAATCTGTAAAATGAGGGAGG - Intronic
1056820555 9:89838796-89838818 CCTCGTCTGTAGATTGGGGATGG + Intergenic
1057908004 9:98997213-98997235 TCTTGTCTGTAAAATGAGGGTGG - Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058606103 9:106725173-106725195 CCATATATGTAGAATGAGAGAGG + Intergenic
1059563468 9:115358426-115358448 CCTCATGTGTTGAGGGAGGGAGG + Intronic
1059591113 9:115663213-115663235 CCTTGTCTGTAAAATGAAGGAGG + Intergenic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1059993291 9:119885419-119885441 TCTCATTTGTAGAATGAGGGGGG - Intergenic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060157447 9:121329483-121329505 CCTCATCTGTAAACTGGGAGTGG + Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060513635 9:124251969-124251991 TCCCATCTGTAAAGTGAGGGTGG + Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1060682023 9:125574852-125574874 TCTCATGTATAAAATGAGGGTGG - Intronic
1060732793 9:126048793-126048815 CCACATCTGTAAAATGCGGCTGG + Intergenic
1060962910 9:127693790-127693812 CCTCATCTGTAGAATGGGAGAGG - Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061462249 9:130749652-130749674 CTCCATCTGTTGAATGAGGCTGG + Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062037020 9:134386890-134386912 CCTCATCTTTAAAATGGGAGTGG - Intronic
1062215905 9:135389771-135389793 GCTCATATGAAGAAGGAGGGGGG + Intergenic
1062465419 9:136678634-136678656 ACTCATCTGTAGAAAGTGTGGGG - Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1186773437 X:12839958-12839980 CCTCATCTGTAAAATAAGATGGG - Intergenic
1186890648 X:13956096-13956118 CCTCCTCTCTAGAATGGGAGAGG + Intergenic
1187031630 X:15493713-15493735 CCTCCTCTATAAAATGAGGATGG + Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1188878834 X:35467032-35467054 CCTCATCTGTTAAATGAAGTTGG + Intergenic
1188928328 X:36073630-36073652 CCTCATCTGTGATATGAGGAAGG + Intronic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190287763 X:48971992-48972014 CGTCATCTGGAAAATGGGGGTGG + Intergenic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190516611 X:51230204-51230226 CCTCATCTGTTGAGTGGGGCAGG - Intergenic
1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG + Intronic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1191014475 X:55793765-55793787 CATCATCTGTATAATGCAGGGGG - Intergenic
1191246667 X:58233561-58233583 CTTCATCTTTAGAATGCGTGAGG - Intergenic
1191673137 X:63767759-63767781 CCTCACCTCTAGAATGAAGGAGG + Intronic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192195211 X:69023337-69023359 CCTCATTTGGAGGATGATGGTGG + Intergenic
1192564202 X:72149850-72149872 CCTCATGTGTGAAATGAGAGAGG - Intergenic
1193385427 X:80865450-80865472 CTTCATCTGTAAAATGTGAGGGG - Intergenic
1193431293 X:81409424-81409446 CCTCAACTGTAAAAGGAGAGTGG + Intergenic
1193448878 X:81642089-81642111 CCTCATATAATGAATGAGGGAGG + Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1194697222 X:97068243-97068265 CCTCATTTGTAAAATGACAGTGG + Intronic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1196936915 X:120739485-120739507 CCACATCTGTAGTATGATGAAGG + Intergenic
1197918517 X:131562476-131562498 CTTCATCTTTAAAATGAGGGAGG - Intergenic
1198103068 X:133438590-133438612 CTTCATCTGTAAACTGAAGGTGG - Intergenic
1198388919 X:136154049-136154071 CCTCATCTGTAAAATAATGGGGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198575843 X:138009484-138009506 CCTCATCTGAAAAATGTGGTGGG + Intergenic
1199438541 X:147841991-147842013 CTTCATCTGGGGAATGGGGGAGG - Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1201305041 Y:12542642-12542664 CCTCATCTGCAGGTTGCGGGTGG + Intergenic