ID: 907739535

View in Genome Browser
Species Human (GRCh38)
Location 1:57151327-57151349
Sequence TAAGGTCCTCCAGATGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907739533_907739535 19 Left 907739533 1:57151285-57151307 CCTTTATTTGATATTTATTGAGT No data
Right 907739535 1:57151327-57151349 TAAGGTCCTCCAGATGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907739535 Original CRISPR TAAGGTCCTCCAGATGCTGC AGG Intronic
No off target data available for this crispr