ID: 907741439

View in Genome Browser
Species Human (GRCh38)
Location 1:57170070-57170092
Sequence CCTGGGATGCAGAGGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907741439_907741449 25 Left 907741439 1:57170070-57170092 CCCTGCAACCTCTGCATCCCAGG No data
Right 907741449 1:57170118-57170140 TCCTGAGTAGCTGGGCTTACAGG 0: 174
1: 55063
2: 143364
3: 230409
4: 201912
907741439_907741446 16 Left 907741439 1:57170070-57170092 CCCTGCAACCTCTGCATCCCAGG No data
Right 907741446 1:57170109-57170131 GCTTCAGCCTCCTGAGTAGCTGG 0: 3644
1: 94132
2: 199845
3: 231233
4: 154825
907741439_907741447 17 Left 907741439 1:57170070-57170092 CCCTGCAACCTCTGCATCCCAGG No data
Right 907741447 1:57170110-57170132 CTTCAGCCTCCTGAGTAGCTGGG 0: 4986
1: 107758
2: 212296
3: 240129
4: 147600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907741439 Original CRISPR CCTGGGATGCAGAGGTTGCA GGG (reversed) Intronic
No off target data available for this crispr