ID: 907746271

View in Genome Browser
Species Human (GRCh38)
Location 1:57216828-57216850
Sequence GTCAAGTAGTGTAGGTCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907746271_907746278 6 Left 907746271 1:57216828-57216850 CCCATAGACCTACACTACTTGAC No data
Right 907746278 1:57216857-57216879 CAGGACTGGGATTTCTACTCAGG 0: 1
1: 0
2: 4
3: 34
4: 298
907746271_907746277 -7 Left 907746271 1:57216828-57216850 CCCATAGACCTACACTACTTGAC No data
Right 907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG 0: 1
1: 0
2: 1
3: 1
4: 62
907746271_907746276 -8 Left 907746271 1:57216828-57216850 CCCATAGACCTACACTACTTGAC No data
Right 907746276 1:57216843-57216865 TACTTGACGTAAGGCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907746271 Original CRISPR GTCAAGTAGTGTAGGTCTAT GGG (reversed) Intronic
No off target data available for this crispr