ID: 907746272

View in Genome Browser
Species Human (GRCh38)
Location 1:57216829-57216851
Sequence CGTCAAGTAGTGTAGGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907746272_907746276 -9 Left 907746272 1:57216829-57216851 CCATAGACCTACACTACTTGACG No data
Right 907746276 1:57216843-57216865 TACTTGACGTAAGGCAGGACTGG No data
907746272_907746277 -8 Left 907746272 1:57216829-57216851 CCATAGACCTACACTACTTGACG No data
Right 907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG 0: 1
1: 0
2: 1
3: 1
4: 62
907746272_907746278 5 Left 907746272 1:57216829-57216851 CCATAGACCTACACTACTTGACG No data
Right 907746278 1:57216857-57216879 CAGGACTGGGATTTCTACTCAGG 0: 1
1: 0
2: 4
3: 34
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907746272 Original CRISPR CGTCAAGTAGTGTAGGTCTA TGG (reversed) Intronic
No off target data available for this crispr