ID: 907746276

View in Genome Browser
Species Human (GRCh38)
Location 1:57216843-57216865
Sequence TACTTGACGTAAGGCAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907746271_907746276 -8 Left 907746271 1:57216828-57216850 CCCATAGACCTACACTACTTGAC No data
Right 907746276 1:57216843-57216865 TACTTGACGTAAGGCAGGACTGG No data
907746272_907746276 -9 Left 907746272 1:57216829-57216851 CCATAGACCTACACTACTTGACG No data
Right 907746276 1:57216843-57216865 TACTTGACGTAAGGCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907746276 Original CRISPR TACTTGACGTAAGGCAGGAC TGG Intronic
No off target data available for this crispr