ID: 907746277

View in Genome Browser
Species Human (GRCh38)
Location 1:57216844-57216866
Sequence ACTTGACGTAAGGCAGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907746271_907746277 -7 Left 907746271 1:57216828-57216850 CCCATAGACCTACACTACTTGAC No data
Right 907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG 0: 1
1: 0
2: 1
3: 1
4: 62
907746272_907746277 -8 Left 907746272 1:57216829-57216851 CCATAGACCTACACTACTTGACG No data
Right 907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG 0: 1
1: 0
2: 1
3: 1
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907746277 Original CRISPR ACTTGACGTAAGGCAGGACT GGG Intronic
900343135 1:2198006-2198028 ACTTGAGGACAGGCAGGACAAGG - Intronic
902329259 1:15723066-15723088 ACCTGGAGGAAGGCAGGACTTGG + Intronic
904362243 1:29983788-29983810 CCTTGCCATAAGGCAGGACATGG - Intergenic
905323108 1:37131649-37131671 CCTTCACCTAGGGCAGGACTGGG - Intergenic
905581186 1:39083443-39083465 ACTTGAAGTAAGACAGACCTGGG - Intronic
907695253 1:56719595-56719617 AACTGATGTAACGCAGGACTAGG + Exonic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
912569758 1:110612884-110612906 ACTTGAAGTCAGACAGGCCTGGG + Intronic
914725453 1:150323424-150323446 ACTTGAGGTAAGGCATTACCTGG + Intronic
916201511 1:162275907-162275929 AAATGAGGTAAGGCAGGAGTTGG + Intronic
1063376805 10:5558827-5558849 ACTGGACGAAGGGCAGGACCTGG - Intergenic
1065491684 10:26288677-26288699 ACTTGAAGTAAGAGAGAACTTGG - Intronic
1067037705 10:42932250-42932272 CCTTGAAGTAAGGCAGGACAAGG + Intergenic
1067434022 10:46264793-46264815 CCTTGAAGTGAGGCAGGCCTGGG - Intergenic
1072484301 10:95840227-95840249 ACTTGAAGTCGGGCAGAACTTGG - Intronic
1079314461 11:19395975-19395997 AGTTGGCCTCAGGCAGGACTTGG + Intronic
1079416892 11:20246008-20246030 CCTTGAAGAAGGGCAGGACTTGG - Intergenic
1088399551 11:109408142-109408164 ACTTGAAATAAGCCAGGAGTAGG + Intergenic
1089278138 11:117353483-117353505 GCTTGACGAAAGGCAGGAGACGG + Intronic
1092778675 12:11965626-11965648 ACCTGGCATAAGGGAGGACTGGG - Intergenic
1103733873 12:123046180-123046202 CCTTCAGGAAAGGCAGGACTGGG - Intronic
1105679212 13:22708125-22708147 ACTTAGCATAAGGCAGGGCTGGG - Intergenic
1118830483 14:69426682-69426704 ACCTGCCCCAAGGCAGGACTTGG - Intronic
1118894795 14:69936667-69936689 ACTTGGCTAAAGGCAGGTCTGGG + Intronic
1125967584 15:43886774-43886796 ACTAGGCCAAAGGCAGGACTAGG + Intronic
1132339549 15:101069261-101069283 ACTTGAGGTAGGGCAGGAGGGGG + Exonic
1135814172 16:25616897-25616919 ACTTGACCTAAGGCAGAGCAAGG - Intergenic
1137815155 16:51391866-51391888 ACCTGCCGGATGGCAGGACTGGG - Intergenic
1137845808 16:51686959-51686981 TCTTGACTCAAGGCTGGACTGGG + Intergenic
1152387117 17:79981267-79981289 ATTTGACGCAAACCAGGACTGGG + Intronic
1153456675 18:5290722-5290744 ACTGGACTTAAGGCAGTGCTTGG - Exonic
1157053205 18:44194801-44194823 AATTGATGTAAGACAGGAATTGG - Intergenic
1159080104 18:63726940-63726962 ACTAGGTGGAAGGCAGGACTTGG - Intergenic
1163008177 19:14409231-14409253 ACTTGAGGAAAAGCAGGGCTGGG + Intronic
929756680 2:44771746-44771768 ACTTGACAGAAGGCAGAGCTGGG - Intronic
936669501 2:114640528-114640550 ACTTGACCTGAGGCATGACGAGG - Intronic
939793651 2:146614172-146614194 ATTTCTTGTAAGGCAGGACTAGG + Intergenic
1174124657 20:48294994-48295016 ACTTGACTTCAGACAGGACCCGG + Intergenic
951909206 3:27731477-27731499 ATCTGACCTAAGGCAGCACTGGG - Intergenic
957449794 3:80364991-80365013 ATTTGAAGTATGGCAGTACTTGG - Intergenic
960555092 3:119019539-119019561 TCTTGAAGTAAAGCAGGACAAGG - Intronic
968938702 4:3626771-3626793 GCTACACGTAAGGCAGAACTGGG - Intergenic
969315465 4:6379008-6379030 CCTTGGCGTCAGGCAGGCCTCGG - Intronic
971145115 4:23968013-23968035 ACTGGAAGTAAGGAAGTACTTGG + Intergenic
975637775 4:76467444-76467466 ACTTAAAGTCAGACAGGACTGGG - Intronic
976221584 4:82760656-82760678 GCTTGACTGAGGGCAGGACTTGG - Intronic
981561976 4:146057998-146058020 AATTGAATTAAGCCAGGACTGGG - Intergenic
986846516 5:11762758-11762780 ACTAGACAGAAGGCAGTACTGGG - Intronic
990497664 5:56364887-56364909 AGTTGCCTTAAGGCAGGAATGGG - Intergenic
1016858320 6:148694390-148694412 CCTAGGCGTAAGGCAGCACTTGG + Intergenic
1020269991 7:6589356-6589378 ACTGGCCGGAAGGCAGGCCTGGG - Exonic
1026980401 7:74523427-74523449 ACTCGACCTCAGGCCGGACTTGG + Intronic
1030236180 7:107265193-107265215 ACTTGACCAAAGGAAGGATTTGG + Intronic
1039339090 8:36627154-36627176 ACTTGAAGTCAGGAAGGAGTTGG - Intergenic
1044547073 8:93471929-93471951 ACTTGATGGTGGGCAGGACTGGG - Intergenic
1048677056 8:136794540-136794562 ACTTAACGAAAGCGAGGACTTGG - Intergenic
1049787806 8:144459440-144459462 ACCTGACGTGAGGCAGGACTCGG + Intronic
1051487983 9:17629149-17629171 ACTTCATGGAAGGCAGAACTGGG - Intronic
1054452039 9:65408564-65408586 GCTACACGTAAGGCAGAACTGGG + Intergenic
1057870502 9:98713419-98713441 ATTTGGGGTCAGGCAGGACTGGG - Intergenic
1059806510 9:117806850-117806872 ACTAGACTAAAGGCAGGATTTGG - Intergenic
1060201317 9:121653080-121653102 ACTTCAGGAAAGGCAGGAGTGGG - Intronic
1192477486 X:71455570-71455592 AATTGACATAAAGCAGGCCTGGG + Intronic
1199474126 X:148227463-148227485 ATTTGAAGCAAGGCAGGAGTTGG - Intergenic
1200031659 X:153302054-153302076 ATTTGATGTAAGGAAAGACTTGG + Intergenic