ID: 907746278

View in Genome Browser
Species Human (GRCh38)
Location 1:57216857-57216879
Sequence CAGGACTGGGATTTCTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907746272_907746278 5 Left 907746272 1:57216829-57216851 CCATAGACCTACACTACTTGACG No data
Right 907746278 1:57216857-57216879 CAGGACTGGGATTTCTACTCAGG 0: 1
1: 0
2: 4
3: 34
4: 298
907746274_907746278 -2 Left 907746274 1:57216836-57216858 CCTACACTACTTGACGTAAGGCA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 907746278 1:57216857-57216879 CAGGACTGGGATTTCTACTCAGG 0: 1
1: 0
2: 4
3: 34
4: 298
907746271_907746278 6 Left 907746271 1:57216828-57216850 CCCATAGACCTACACTACTTGAC No data
Right 907746278 1:57216857-57216879 CAGGACTGGGATTTCTACTCAGG 0: 1
1: 0
2: 4
3: 34
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907746278 Original CRISPR CAGGACTGGGATTTCTACTC AGG Intronic
900117364 1:1034320-1034342 CACATTTGGGATTTCTACTCCGG + Intronic
900804775 1:4760480-4760502 CAGCACTGGACTTTCTGCTCCGG + Intronic
900985025 1:6068371-6068393 CAGGGCTGGGATTTGAACTCTGG - Intronic
900985035 1:6068431-6068453 TAGGGCTGGGATTTGAACTCTGG - Intronic
902389940 1:16097580-16097602 CTGCACTGGGCTTTCTTCTCTGG - Intergenic
902917790 1:19648931-19648953 CAGGAATGGGATTTGAACTCTGG + Intronic
902957695 1:19937145-19937167 CAGAACTGGGACTTGAACTCAGG - Intergenic
903235326 1:21946762-21946784 CAGAGCTGGGATTTCAACCCAGG - Intergenic
903287577 1:22286445-22286467 CAGGGCTGGGATTTGAACTGTGG + Intergenic
903409268 1:23127288-23127310 CAGGGCTGGGATTTGAATTCAGG + Intronic
903580620 1:24367936-24367958 CAGAGCTGGGATTCATACTCTGG + Intronic
904053138 1:27652779-27652801 CAGGAGTGGGATTATTATTCTGG - Intergenic
904089531 1:27935069-27935091 CAGGACAAGGAGTTCTGCTCAGG + Exonic
904442912 1:30543279-30543301 CAGAACTGAGATTTGAACTCTGG + Intergenic
905279072 1:36837373-36837395 CAGGGCATGGAATTCTACTCTGG - Intronic
905795789 1:40815862-40815884 CAGGACTGGGATCCAAACTCAGG + Intronic
905907262 1:41627365-41627387 CGGGGCTGGGATTTGAACTCAGG + Intronic
905932136 1:41796420-41796442 CAGGGCTGGGATTTGAACTCTGG - Intronic
906490643 1:46265818-46265840 CAGAGCTGGGATTTGAACTCAGG - Intronic
907746278 1:57216857-57216879 CAGGACTGGGATTTCTACTCAGG + Intronic
907870835 1:58441303-58441325 CAGAACTGGGATTTAAACCCAGG + Intronic
908473283 1:64465286-64465308 CAATTCTTGGATTTCTACTCTGG + Intergenic
908814403 1:68016850-68016872 CAGGACTGAGTTTTATACACAGG + Intergenic
909531694 1:76689156-76689178 CAGAGCTGGGATTTCAACTCAGG + Intergenic
910228596 1:84963085-84963107 CAGAACTGGGATTTGTGCTTGGG - Intronic
910345482 1:86231596-86231618 CAGGTCTGGGATCCCAACTCAGG + Intergenic
910497505 1:87848693-87848715 CAGAGCTGGGATTTCAACCCAGG + Intergenic
914604658 1:149240687-149240709 CAGGACTGGGCTCACTGCTCTGG + Intergenic
914800266 1:150956477-150956499 CAGGGCTGGAATTTGAACTCAGG - Intronic
915288236 1:154866470-154866492 CAGAGCTGGGATTCCAACTCTGG + Intronic
916062693 1:161111280-161111302 CAAAACTGGGATTTCAACCCAGG - Intronic
916497879 1:165361518-165361540 CAGTGCTGGGATTTGAACTCAGG - Intergenic
917679261 1:177349525-177349547 CAGGACTGGGTTCTTTGCTCAGG + Intergenic
918377709 1:183925746-183925768 CAGAACTGGGATTTGAACTCGGG - Intronic
918527220 1:185478407-185478429 CAGGGCCTGGATTTCGACTCAGG - Intergenic
920581043 1:207107935-207107957 AATGACTTGGATTTCTAGTCTGG + Intronic
1062795370 10:341210-341232 GTGGACTGGGATTTGTCCTCTGG - Exonic
1065732214 10:28719958-28719980 CAGAAGTGGGATTTAAACTCAGG - Intergenic
1065868424 10:29934367-29934389 CAGGACTGGAAGAACTACTCTGG + Intergenic
1066523897 10:36254450-36254472 CAGGACTGGGAGTACTACTCAGG + Intergenic
1067015547 10:42754658-42754680 CGGGACTCGGATTTCGCCTCTGG - Intergenic
1067770820 10:49123113-49123135 CAGGTATGGGATTTCTTCTTAGG - Intergenic
1068128045 10:52865562-52865584 CAGAACTGTGATTTCAACTATGG + Intergenic
1068669900 10:59711843-59711865 CAGCACTTCCATTTCTACTCAGG + Intronic
1070288744 10:75101182-75101204 CAGACCTGAGATTTCTACCCAGG - Intronic
1070684664 10:78471795-78471817 CAGGGCTGGGATTTGTGCTCAGG - Intergenic
1070761882 10:79028997-79029019 CAGGACTGGGATTTGAACTCAGG + Intergenic
1071153239 10:82660650-82660672 CCGTACTGAGATTTCTGCTCAGG + Intronic
1072821317 10:98560501-98560523 CAGGACTGGGCTTTGGTCTCAGG - Intronic
1073144002 10:101267347-101267369 CAGGATTTAGATTTCTTCTCAGG - Intergenic
1073433516 10:103502151-103502173 CAGGGCTGGGATCTCTACTCAGG + Intronic
1073802605 10:107058577-107058599 CAGGGCTGGGATTCAAACTCAGG - Intronic
1075646816 10:124102312-124102334 CAGGACTGGACCTTCTTCTCTGG + Intergenic
1076251229 10:128985179-128985201 CAGGGCTGGGCTTTCTAGCCAGG + Intergenic
1078329432 11:10407727-10407749 CAGGGCTGCCATTTCTACTGTGG + Intronic
1078397935 11:10998555-10998577 CAGAAGTGGGATTTGAACTCAGG + Intergenic
1078431627 11:11292660-11292682 CAGGGCTGGGATATAAACTCAGG - Intronic
1081641523 11:44758800-44758822 CAGAACTGAGATTTAAACTCAGG + Intronic
1081775555 11:45673924-45673946 CAGAACTGGGATTTGAACCCAGG - Intergenic
1083844961 11:65326314-65326336 CAGGAATGGGATTTAAACCCAGG + Intergenic
1084028847 11:66468913-66468935 CAGGGCTGGGATTTGGACCCAGG + Intronic
1084199243 11:67544247-67544269 CAGAACTGGAATTTGTACCCAGG + Intergenic
1084307505 11:68296722-68296744 CAGGACTGGGACAGCTTCTCAGG - Intergenic
1084775136 11:71369898-71369920 CAGGGCTGGGAATCCTGCTCAGG + Intergenic
1085308737 11:75503485-75503507 CAGAACTGGGATTTGAACCCAGG + Intronic
1085342383 11:75741530-75741552 CAGGACTGGGACTTGAACTCAGG - Intergenic
1086232124 11:84582051-84582073 CAGGACTATGATTTAAACTCAGG + Intronic
1088835009 11:113570280-113570302 CAGAACTGGGATTAGCACTCAGG - Intergenic
1089837497 11:121383944-121383966 CAGGACTGGGAACTCTACCAAGG - Intergenic
1092033936 12:5314079-5314101 CAGGACTGGAATTACAGCTCTGG - Intergenic
1092481119 12:8859967-8859989 CAGGACTGGAATTTGAACCCAGG - Intronic
1092990259 12:13890495-13890517 CAGCACTAGAATTTCTATTCAGG + Intronic
1093935560 12:24996703-24996725 CAGAACTGGGGTTTGAACTCAGG + Intronic
1094672795 12:32587268-32587290 CGGGGCTGGGATTTGAACTCAGG - Intronic
1095218615 12:39580272-39580294 CAGAACTGGGATTTATATTCAGG + Intronic
1096633626 12:52945200-52945222 CAGCCCTGGGATTTCTCCTGTGG + Intronic
1098184394 12:67880658-67880680 CAGAAATGGGATTTGAACTCAGG - Intergenic
1098504772 12:71236909-71236931 CAGAGCTGGGATTCCAACTCAGG + Intronic
1099594254 12:84638176-84638198 CATGGCTGGGTTTTCTGCTCAGG - Intergenic
1099944772 12:89232166-89232188 CAAGACTGGGTTCTCTTCTCAGG + Intergenic
1101270952 12:103143820-103143842 CAGAGCTGGGATTAATACTCAGG - Intergenic
1101331257 12:103759591-103759613 CAGAACTGGGATTCATACTGGGG - Intronic
1101341697 12:103847745-103847767 CAGAACTGGGATTCCAACTCAGG + Intergenic
1101841911 12:108333674-108333696 CAGAGCTGGGATCTCAACTCTGG + Intronic
1101864895 12:108513619-108513641 CAGAACTGGGATTTGAACCCAGG + Intergenic
1102129095 12:110511058-110511080 CAGGACTGATATTTCTAAACAGG - Intronic
1102626364 12:114238625-114238647 CAGGACTGGGACTTGAACCCAGG + Intergenic
1102924805 12:116818731-116818753 CAGAACTGGGACTTGTACCCAGG - Intronic
1103185107 12:118949880-118949902 CAGAAATGGGATTTAAACTCAGG + Intergenic
1103718038 12:122957470-122957492 CAGGACAGGGATTTGTGCCCAGG + Intronic
1105060264 12:133143778-133143800 CATGGCTGGGTTTTCTGCTCAGG + Intronic
1106451704 13:29888334-29888356 CAGGGCTGGCATCTCTGCTCTGG - Intergenic
1106705057 13:32271228-32271250 CAGAACTGGGATTTGAACACAGG - Intronic
1106891860 13:34254542-34254564 CAGAACTGTCATTTCTACTCTGG - Intergenic
1114069886 14:19098138-19098160 CAGGACTCGGATTTCGCCCCTGG + Intergenic
1114092375 14:19301864-19301886 CAGGACTCGGATTTCGCCCCTGG - Intergenic
1115003107 14:28444721-28444743 CAGAACTGGGATTCCTTCACAGG - Intergenic
1115426734 14:33269398-33269420 CAGAGCTGGGATTTGAACTCAGG + Intronic
1115737049 14:36343785-36343807 CAGAACTTGGATTTGGACTCAGG - Intergenic
1115837224 14:37420744-37420766 CAGGACTTGGTTTTCTTCTGAGG + Intronic
1116864858 14:50023723-50023745 CAGGACTGGGACTTCTCATCTGG - Intergenic
1117941412 14:60970399-60970421 CAGAGCTGGGATTTGAACTCAGG + Intergenic
1118760430 14:68877689-68877711 CAGAACTGGGATTTGAACTCAGG + Intronic
1119367778 14:74109962-74109984 CTGTACTGGGATTTCTAGCCAGG - Intronic
1120547102 14:85825569-85825591 TAGGACTGTGGTTTCTACTATGG + Intergenic
1120557347 14:85945096-85945118 CAGGACTGTGATTTGGCCTCTGG - Intergenic
1122356593 14:101126450-101126472 GAGCCCTGGGATTTCTGCTCTGG + Intergenic
1127302092 15:57664783-57664805 CAGAGCTGAGATTTGTACTCAGG - Intronic
1127600301 15:60528880-60528902 CAGAGCTGGGATTTCAACTCGGG + Intronic
1128335629 15:66784102-66784124 CAGAACTGGGATTTGAACTCGGG - Intergenic
1128775616 15:70317835-70317857 CAGAACTGGAATTTGAACTCTGG - Intergenic
1129085854 15:73091040-73091062 CAGAACTGGGATTTGAACTCAGG + Intronic
1129239119 15:74241248-74241270 CAGGACTGGCACTTCTGATCTGG + Intronic
1130287298 15:82566603-82566625 CAAGACTGGGAGTTATACTGGGG - Intronic
1130326072 15:82881172-82881194 CAGGACTGGGTCTTTTACTAGGG - Intronic
1130411014 15:83648823-83648845 CAGGTCTGCGATTTCAAGTCAGG - Intergenic
1132321516 15:100929114-100929136 CGGGACTGGTTTTTCCACTCTGG - Intronic
1134412250 16:14012739-14012761 TAGAACTGGGATTTGAACTCAGG + Intergenic
1134678459 16:16107071-16107093 CAGAACTGGGATTTGAACCCTGG + Intronic
1134768388 16:16782572-16782594 CAGAGCTGGGATTTGAACTCAGG + Intergenic
1135971184 16:27073300-27073322 CAGGGCTGGGATTTGAACCCAGG + Intergenic
1136363140 16:29794483-29794505 CAGAGCTGGGATTTCAACCCAGG + Intronic
1137719540 16:50619973-50619995 CAGAACTGGGATTTGAACCCAGG - Intronic
1137872102 16:51960078-51960100 CAGGTCTGGCATTTCCATTCTGG - Intergenic
1138372006 16:56534581-56534603 CAGGACTGTGATTTCTCTGCAGG - Intergenic
1139241371 16:65395674-65395696 AAGATCTGGGATTTCAACTCAGG - Intergenic
1141150785 16:81563315-81563337 CAGAGCTGGGATTTGAACTCAGG - Intronic
1141207990 16:81948614-81948636 CAGGACTGGGAGCTGCACTCTGG + Intronic
1141471762 16:84243480-84243502 CAGGACTGGGATTTTTCCGGAGG + Intergenic
1141607046 16:85159739-85159761 CAGAGCTGGGATTTCAACCCCGG - Intergenic
1141795427 16:86270239-86270261 CAGAACTGGGATTCACACTCGGG + Intergenic
1141876477 16:86828419-86828441 CAGAGCTGGGATTTGAACTCAGG + Intergenic
1144246733 17:13373588-13373610 CAGGACAGGGATTTGAACACTGG - Intergenic
1146533429 17:33629765-33629787 CAGAACTGGGTTTGCTACCCTGG - Intronic
1147604050 17:41763919-41763941 CAGAACTGGGATTTGAACCCAGG - Intronic
1147769363 17:42856919-42856941 CAGGACTGGCAACCCTACTCTGG - Exonic
1148148812 17:45383990-45384012 CAACACTGGGATTTCTAAACTGG + Intergenic
1148533971 17:48422285-48422307 CATGACTGGGAGTTTTACTGTGG + Intronic
1150594352 17:66590992-66591014 CAGGCCTGGGATTTGAACCCAGG - Intronic
1151088947 17:71413168-71413190 CAGGATTGTGCTTGCTACTCAGG + Intergenic
1152991039 18:363847-363869 CAGGGCTGGGATTTGTATTTGGG - Intronic
1155507136 18:26545516-26545538 CAGAACTGGAATTTCCACTTTGG + Intronic
1156228537 18:35132068-35132090 AAGGAAAGGGATTTCTACTTTGG + Exonic
1156445816 18:37236048-37236070 CAGAACTGGGATTTGAACCCAGG - Intergenic
1156617711 18:38807123-38807145 CAGGTCAGGGATTTCTTTTCTGG - Intergenic
1157024227 18:43823639-43823661 CAGGTCTTGGATTTAAACTCAGG - Intergenic
1158844761 18:61430046-61430068 CAGGAGTGGATATTCTACTCTGG - Intronic
1158856543 18:61548330-61548352 CAGAGCTGGGATTTGAACTCTGG - Intronic
1159874933 18:73800446-73800468 CAGAGCTGGGATTTGAACTCAGG + Intergenic
1160965022 19:1743573-1743595 CAGAACTGGGATGTGGACTCAGG - Intergenic
1161798688 19:6403089-6403111 CAGGACTGGGAGTTCTCCGAGGG + Intergenic
1162328899 19:10014915-10014937 CAGAGCTGGGATTTGAACTCAGG + Intronic
1162343839 19:10108258-10108280 CAGGAGTGGGATTTGACCTCAGG - Intronic
1162462105 19:10819343-10819365 CAGGGCTGGGATTTCAACCTTGG - Intronic
1165315292 19:35051615-35051637 CAGGGCTGGGATTTGAACCCAGG + Intronic
1165411891 19:35667019-35667041 CAGAGCTGGGATTTCAACCCAGG - Intronic
1165428833 19:35760143-35760165 CAGAGCTGGGATTTGAACTCAGG - Intronic
1165844897 19:38812121-38812143 CAGAGCTGGGATTTTAACTCGGG + Intronic
1166553607 19:43683630-43683652 CAGAACTGGAATTTGAACTCGGG + Intergenic
1167103139 19:47416448-47416470 CAGAGCTGGGATTTGAACTCGGG + Intronic
1167103972 19:47419728-47419750 CAGGGCTGGGGTTCCTGCTCCGG + Intergenic
1167561358 19:50227779-50227801 CAGAACTGGGATTTGAACCCAGG - Intronic
1168265738 19:55223149-55223171 CAGCCCTGGGTTTTCTACTCTGG - Intergenic
925006167 2:444705-444727 CAGCACTGGGATTTGAACCCGGG + Intergenic
928729788 2:34218197-34218219 CAGAACTGGGATTTGAACCCAGG - Intergenic
930006422 2:46900954-46900976 CAGGCCTAGGATTTCAACTCAGG + Intergenic
930080601 2:47444669-47444691 CAGAGCTGGGATTGCTACCCAGG + Intronic
931139941 2:59446297-59446319 TAGTACTGGGATTTGAACTCTGG - Intergenic
931145710 2:59514840-59514862 CAGAACTGGGATTAGAACTCAGG + Intergenic
931940132 2:67242927-67242949 TAGGAACGAGATTTCTACTCTGG - Intergenic
932328711 2:70883731-70883753 CAGGAATGGGATTTCTTTTGGGG + Intergenic
933498646 2:83084167-83084189 CAGGAATGCAATTTCTGCTCTGG - Intergenic
936462936 2:112725216-112725238 CAGCACTGTGCTGTCTACTCTGG + Exonic
938914330 2:135920032-135920054 CAGAGCTGGGATTTGAACTCAGG + Intronic
941775332 2:169387206-169387228 AAGAACTGGGATTTAAACTCGGG - Intergenic
942181963 2:173388655-173388677 CATGTATGGGATTTCTACTATGG - Intergenic
945687014 2:212983898-212983920 CAGAACTGAGGTTTCAACTCAGG + Intergenic
945756330 2:213851637-213851659 CGAGACTGGAATATCTACTCTGG - Intronic
946417820 2:219549414-219549436 CAGGACTGGGCTTTCCCCACGGG + Intronic
947467895 2:230370306-230370328 CAGCACTGGGAACTCTTCTCTGG + Intronic
1168874808 20:1164211-1164233 AATGGCTGGGATGTCTACTCTGG - Intronic
1170778578 20:19403029-19403051 CAGGCCTGGGATGTCTAATATGG - Intronic
1173433829 20:43015221-43015243 CAGGGCTGAGATTTGAACTCTGG - Intronic
1173683330 20:44903350-44903372 CAGAAGAGGGATTTCTACCCAGG + Intronic
1173992919 20:47316970-47316992 CAGTACTGGGATTTCAACCCAGG + Intronic
1174203547 20:48823728-48823750 CAGAACTGGGATTTGAACCCAGG - Intronic
1174296165 20:49546633-49546655 CAGGACTGGGATTTGAACCCAGG - Intronic
1174359274 20:50017683-50017705 CAGAACTGGGATTTGAACCCAGG + Intergenic
1174739374 20:52997364-52997386 CAGTCCTGAGATTTCTAATCTGG + Intronic
1174789668 20:53465618-53465640 CAGAGCTGGGATTTGAACTCAGG - Intronic
1174870999 20:54182091-54182113 CAGGACTGGGATCTCTAGCTAGG - Intergenic
1176100609 20:63362791-63362813 CAGTACTGGGATTCCAACCCAGG + Intronic
1177809352 21:25908871-25908893 CAGGGCTGGAATTTAAACTCGGG + Intronic
1177809998 21:25915427-25915449 CAGGACTTGGATTTCAGCACTGG - Intronic
1178049807 21:28735251-28735273 TAGGACTGGGTTCTCTACCCTGG + Intergenic
1178407216 21:32334735-32334757 CAGGGCTGGGATTCAGACTCAGG + Intronic
1178511660 21:33210382-33210404 CATGGCTGGGTTCTCTACTCAGG + Intergenic
1178741121 21:35202404-35202426 CAGAACTGGGGTTTGAACTCAGG + Intronic
1178788372 21:35675362-35675384 CAGGCCTGGGTTTTCTCATCTGG + Intronic
1179289285 21:40004857-40004879 CAGGACTGAGGTTGCAACTCTGG + Intergenic
1180488353 22:15820702-15820724 CAGGACTCGGATTTCGCCCCTGG + Intergenic
1180654247 22:17405902-17405924 CAAGACCAGGATGTCTACTCTGG - Intronic
1181885763 22:26021129-26021151 CAGAGCTGGGATTTGAACTCAGG + Intronic
1182458745 22:30469693-30469715 TAGGGCTGGGATTTATGCTCAGG - Intronic
1182778197 22:32846645-32846667 CAGGGCTGGGATTTGAACCCTGG + Intronic
1183697590 22:39431994-39432016 CAGGGCTGGGATTTGAACCCAGG + Intronic
949310156 3:2688525-2688547 AAGGACAGGGATATTTACTCTGG + Intronic
951525096 3:23645822-23645844 CAAGACTGGCTTTTCTCCTCTGG + Intergenic
951752214 3:26049242-26049264 TGGGACTGGGATTTGAACTCAGG + Intergenic
952796928 3:37247659-37247681 CATGACTGGGTTCTCTGCTCAGG + Intronic
953245861 3:41191350-41191372 CAGAGCTGGGATTTGAACTCTGG - Intergenic
953891257 3:46753262-46753284 GAGGCCTGGGACTTCCACTCTGG - Intronic
953896722 3:46808858-46808880 GAGGCCTGGGACTTCCACTCTGG - Intronic
954224660 3:49174057-49174079 GAGATCTGGGATTCCTACTCTGG - Intronic
954691628 3:52398692-52398714 CAGAGCTGGGATTTGTACCCAGG + Intronic
955209455 3:56927085-56927107 CAGCACTGGGATTTGAACCCAGG - Intronic
955474097 3:59317636-59317658 CAGGACTGGGATCAGGACTCTGG + Intergenic
955770626 3:62381357-62381379 CAGAACTGGGAATTTTGCTCTGG + Intergenic
955886986 3:63610532-63610554 CTGGACTGTGATTTCTGCTTTGG + Intronic
955951172 3:64243548-64243570 CAGAGCTGAGATTTCTACCCAGG - Intronic
956168315 3:66413104-66413126 CTGCACTGGGATTTCTCCTCTGG - Intronic
956170281 3:66428162-66428184 CAGGCATGGAATTGCTACTCAGG + Intronic
956828948 3:73026888-73026910 CAGGGCTGGGATTTCAACCCAGG - Intronic
957039457 3:75326287-75326309 CAGAGCTGGGATTTGAACTCAGG - Intergenic
958889206 3:99764548-99764570 CAGGACTGGAATTTGAGCTCAGG - Intronic
959557458 3:107738601-107738623 CAGAACTGGGATTCCAACGCCGG + Intronic
959566446 3:107837336-107837358 CAGAACTGGGATTTGAACCCAGG - Intergenic
961044182 3:123697565-123697587 CAGAGCTGGGATTTGAACTCAGG - Intronic
961684255 3:128618403-128618425 CAGGCCTGGGATTTCCATCCAGG + Intergenic
962028677 3:131575484-131575506 CAGGACTGGGACTTAGACACAGG - Intronic
962597059 3:136956950-136956972 CAGGACTGGGTGTTAAACTCTGG - Intronic
963059940 3:141217377-141217399 CATGACATGAATTTCTACTCAGG - Intergenic
964735409 3:159912113-159912135 CAGGGCTGGAATTCCTACTCAGG - Intergenic
966983810 3:185161730-185161752 CAGGACTGTGGTTTCATCTCAGG - Intergenic
967299471 3:187998468-187998490 CAGGAATGGGATTTGAACCCTGG - Intergenic
968680595 4:1916176-1916198 CAGGGCTGGGATTTGAACCCAGG + Intronic
969133950 4:5014987-5015009 CAGGGCTGGTATTCCTACCCAGG - Exonic
969567688 4:7988810-7988832 CAGAGCTGGGATTTGAACTCAGG + Intronic
970492008 4:16584428-16584450 CAGAACTGGGACTTGAACTCAGG - Intronic
970855586 4:20647078-20647100 CAGGGCTGGGATTTGAACCCTGG - Intergenic
970958643 4:21846407-21846429 CAGAGCTGGGATTTGAACTCAGG - Intronic
971426279 4:26518989-26519011 TATGACTGGGATTTTTACCCAGG - Intergenic
972650105 4:41008799-41008821 CAGAGCTGGGATTTGAACTCAGG + Intronic
972671694 4:41218479-41218501 CAGAACTGGGATTTGAACCCAGG + Intergenic
973604067 4:52569672-52569694 CAGGGCTGGGATTTCATCCCAGG - Intergenic
975606773 4:76162863-76162885 CAGAACTGGGATTTGAACTCAGG + Intronic
976398042 4:84578772-84578794 CAGAGCTGGGATTTGAACTCAGG + Intergenic
977920256 4:102635164-102635186 CAGGACTGGGATTAAAACTCAGG - Intronic
981175221 4:141674921-141674943 CTGGACTGGGTGTTCTACTTGGG + Intronic
981997465 4:150990147-150990169 CTGAAATGGGATTTCTCCTCTGG - Intronic
983188968 4:164734406-164734428 CATGACTGGGTTCTCTACTCAGG + Intergenic
984894802 4:184528797-184528819 CTGGACTTGGATTTCAATTCTGG + Intergenic
985261733 4:188120640-188120662 CATGACTGGGATCTCTGCTCAGG - Intergenic
988298739 5:29395259-29395281 CTGGACTGGTACTTGTACTCTGG + Intergenic
990206638 5:53436695-53436717 CAGAGCTGAGATTTCTACCCAGG - Intergenic
990712338 5:58599104-58599126 CAGGGCTGGGATTCCTTCTTTGG + Intronic
992465159 5:76997002-76997024 CAGAGCTGGGCTTTCAACTCAGG + Intergenic
992568123 5:78022955-78022977 CAGCACTGGGATTTGAACCCAGG + Intronic
992937713 5:81727114-81727136 CAGAACTGGGATTTGAACTTAGG - Intronic
993880213 5:93352336-93352358 CAAGACTGAGATGTGTACTCAGG - Intergenic
995356101 5:111239114-111239136 CAGGACTTGGATCTGTATTCTGG + Intronic
996887518 5:128375476-128375498 CATGACTGGGATGTCATCTCAGG - Intronic
997894193 5:137701392-137701414 CAGGACTGAGATTTGAACTTTGG + Intronic
998390616 5:141784973-141784995 CAGGGCTGGGATTTGAACCCAGG + Intergenic
999534117 5:152498836-152498858 CAGGACTTGGATTTAAACACAGG + Intergenic
1001454868 5:171852824-171852846 CAGGACTGTCATTACTACTGAGG - Intergenic
1001948796 5:175801534-175801556 CAGGGCTGGGATTTGAACCCAGG - Intronic
1002692742 5:181061767-181061789 GGGGACTGAGATTTCTACTAGGG + Intergenic
1004290341 6:14361200-14361222 TAGGACTGGGATTTAAACTCAGG - Intergenic
1004372620 6:15065577-15065599 CCCTAATGGGATTTCTACTCAGG - Intergenic
1006023425 6:31131671-31131693 CAGAACTGGGATTTCAATTTAGG - Intronic
1007241421 6:40428612-40428634 CAGGGCTGTGATTTGAACTCCGG - Intronic
1007369486 6:41417004-41417026 CAGAACTGGGATTTGAACCCCGG + Intergenic
1010988966 6:82458264-82458286 CTGCACTGGGATCTCTACACAGG + Intergenic
1011655871 6:89551479-89551501 CAGGACTGGAATGTCCACCCAGG + Intronic
1012517072 6:100074120-100074142 CAGAACTGGGATTTAAACTTAGG - Intergenic
1012777411 6:103515320-103515342 CAGGACTCTGATTTCTCTTCAGG + Intergenic
1013126565 6:107190181-107190203 AAAGACTGGGATTTTTACTGTGG - Intronic
1016881456 6:148916298-148916320 TAGAACTGGGATTTGCACTCTGG + Intronic
1017777706 6:157692388-157692410 CAGGACTGGGTTTGCTTTTCAGG - Intergenic
1017795337 6:157839447-157839469 CTGGACTGGGATTTGAACCCAGG - Intronic
1019818050 7:3215860-3215882 CAGAGCTGGGATTTCAACCCAGG + Intergenic
1021390137 7:20082880-20082902 CAGCAGTGGGATTTCTAATACGG - Intergenic
1022037254 7:26546203-26546225 CAGGAATGAGATTTAAACTCAGG - Intergenic
1022663949 7:32392307-32392329 TAGGCCTGGGCTTTCTATTCTGG - Intergenic
1023295838 7:38714388-38714410 CAGGACTGAGGTTGCTACTGAGG + Intergenic
1024199444 7:47090893-47090915 CAGAGCTGGGATTTCAGCTCCGG - Intergenic
1024645358 7:51366504-51366526 CAGGGCTGAGATTTCAAATCAGG - Intergenic
1026205177 7:68250935-68250957 CAGAGCTGGGATTTGTACCCAGG - Intergenic
1029743171 7:102502840-102502862 CAGGACTGGGCCCTCGACTCTGG + Intronic
1029761160 7:102602001-102602023 CAGGACTGGGCCCTCGACTCTGG + Intronic
1031967571 7:128038334-128038356 CAGAACTGGGGTTTAAACTCAGG - Intronic
1033069206 7:138186596-138186618 CAGCACTGGAATTGCAACTCAGG - Intergenic
1033246972 7:139725842-139725864 CAGGGCTGGGATTTGAACTGAGG + Intronic
1033414006 7:141146433-141146455 CAGAACTTGGATTCCTACCCAGG - Intronic
1033668416 7:143465696-143465718 CAGAACTAGGATTTCAATTCAGG - Intergenic
1043403733 8:79909569-79909591 AAGGAGTGGGAATTCCACTCAGG - Intergenic
1043908113 8:85831329-85831351 CAGGGCTGGGATCTCTGCTCAGG + Intergenic
1044929258 8:97236041-97236063 GAGGACTGGGAGTTCTTCTGGGG + Intergenic
1045255470 8:100516969-100516991 CAGAGCTGGGATTTGAACTCAGG - Intronic
1045504458 8:102768768-102768790 CAGGACTAAGATTATTACTCAGG + Intergenic
1045622469 8:103996693-103996715 CAGGACTGGGTTTCAAACTCAGG - Intronic
1047591442 8:126331364-126331386 CAGGACTGGGATTTATAGACAGG - Intergenic
1047781123 8:128111905-128111927 CAGGGCTGGGATTTGTGCTCAGG + Intergenic
1048395541 8:134010840-134010862 CAGTACTGGGTTTGGTACTCAGG - Intergenic
1048637509 8:136313321-136313343 CAGAACTGATATCTCTACTCAGG - Intergenic
1050224458 9:3435966-3435988 CAGGACTGGGACTGACACTCTGG + Intronic
1050536822 9:6637766-6637788 CAAGACTGAGATTTCTAGTTTGG + Intronic
1051410771 9:16787428-16787450 CAGAGCTGGGATTTAAACTCAGG - Intronic
1051598481 9:18848864-18848886 CAGGACTGGATTTTGCACTCGGG + Intronic
1052400142 9:27989833-27989855 TAGAACTGGGATTTAAACTCAGG + Intronic
1054728199 9:68674015-68674037 CAGAGCTGTGATTTCAACTCAGG - Intergenic
1056810604 9:89760897-89760919 CCAAACTGGGATTTCCACTCTGG - Intergenic
1058140473 9:101352591-101352613 CAGGACTGGGATTAGAATTCGGG - Intergenic
1058474091 9:105313463-105313485 CAGGGCTGGGATTTCATCTGAGG + Intronic
1059740816 9:117147792-117147814 TAGAACTGGGATTTGGACTCAGG + Intronic
1059999631 9:119946562-119946584 CAGGGCTGGGATTTGAACTCAGG + Intergenic
1061544166 9:131294208-131294230 CAGGGCTGGGATTTGCACTCAGG - Intronic
1062150658 9:135017168-135017190 CAGGTTTGGGAATTCAACTCTGG - Intergenic
1062174158 9:135151686-135151708 CAGCACTGGGATCTTTGCTCCGG + Intergenic
1186396907 X:9218555-9218577 CAGAACTGGGATTTGAACTCAGG - Intergenic
1186749295 X:12605345-12605367 CAGGAGTGGGACTTCTACTCTGG - Intronic
1187313505 X:18169267-18169289 CAGGACTGTGATTACTTCTGGGG + Intronic
1189023211 X:37364120-37364142 CAGGACTGTGATTTCTCCAAAGG - Intronic
1189064391 X:37791145-37791167 CAGAGCTGGGATTTAAACTCAGG - Intronic
1189850048 X:45168925-45168947 CAGAACTGGGATTTGAACCCAGG - Intronic
1190234719 X:48606521-48606543 CAGGGCTGGAATTTGTACCCTGG - Exonic
1192218029 X:69177542-69177564 CAGAGCTGGGATTTGGACTCAGG + Intergenic
1194188113 X:90799553-90799575 CAGGACTAGGATTTGAACTCAGG - Intergenic
1195615540 X:106909301-106909323 CAAGATTGGGATTTGAACTCGGG + Intronic
1196429534 X:115607919-115607941 CAGGACTGGAATTCACACTCAGG - Intronic
1197700394 X:129595271-129595293 CAGAGCTGGGATTTGAACTCAGG - Intergenic
1197805465 X:130394426-130394448 TAGAACTGGGATTTGAACTCAGG + Intergenic
1197825494 X:130585703-130585725 CATGACTGGGATCTCTGCTAAGG - Intergenic
1198618895 X:138485445-138485467 CAGGACTGGGACTTGACCTCTGG + Intergenic
1199742368 X:150747671-150747693 CAAGACTGCCATTTATACTCAGG - Intronic
1199910475 X:152281389-152281411 CAGGATTGGCATTACTACTGAGG + Intronic