ID: 907746851

View in Genome Browser
Species Human (GRCh38)
Location 1:57222321-57222343
Sequence ACACTAAAGCACCTCAGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907746851_907746857 23 Left 907746851 1:57222321-57222343 CCTATCCTGAGGTGCTTTAGTGT No data
Right 907746857 1:57222367-57222389 GTGTTGTTATAGAGGAAACATGG No data
907746851_907746858 24 Left 907746851 1:57222321-57222343 CCTATCCTGAGGTGCTTTAGTGT No data
Right 907746858 1:57222368-57222390 TGTTGTTATAGAGGAAACATGGG 0: 1
1: 0
2: 5
3: 11
4: 215
907746851_907746855 15 Left 907746851 1:57222321-57222343 CCTATCCTGAGGTGCTTTAGTGT No data
Right 907746855 1:57222359-57222381 AGTCCTAAGTGTTGTTATAGAGG 0: 1
1: 0
2: 0
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907746851 Original CRISPR ACACTAAAGCACCTCAGGAT AGG (reversed) Intronic
No off target data available for this crispr