ID: 907746853

View in Genome Browser
Species Human (GRCh38)
Location 1:57222326-57222348
Sequence CCACCACACTAAAGCACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907746853_907746857 18 Left 907746853 1:57222326-57222348 CCTGAGGTGCTTTAGTGTGGTGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 907746857 1:57222367-57222389 GTGTTGTTATAGAGGAAACATGG No data
907746853_907746858 19 Left 907746853 1:57222326-57222348 CCTGAGGTGCTTTAGTGTGGTGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 907746858 1:57222368-57222390 TGTTGTTATAGAGGAAACATGGG 0: 1
1: 0
2: 5
3: 11
4: 215
907746853_907746855 10 Left 907746853 1:57222326-57222348 CCTGAGGTGCTTTAGTGTGGTGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 907746855 1:57222359-57222381 AGTCCTAAGTGTTGTTATAGAGG 0: 1
1: 0
2: 0
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907746853 Original CRISPR CCACCACACTAAAGCACCTC AGG (reversed) Intronic
900741138 1:4331605-4331627 CCACATCCCAAAAGCACCTCGGG - Intergenic
903241656 1:21986702-21986724 CCACCACCCTAAAGCCCTCCGGG - Intronic
903245163 1:22009876-22009898 CCACCACCCTAAAGCCCTCCGGG - Intronic
905137539 1:35811169-35811191 CCACAACAAAAAAACACCTCAGG + Intronic
907470931 1:54673050-54673072 CCAAGCCACTAAGGCACCTCTGG - Intronic
907746853 1:57222326-57222348 CCACCACACTAAAGCACCTCAGG - Intronic
914943309 1:152041928-152041950 CCACCACACTAAAACTGCTCTGG - Intronic
915588447 1:156857766-156857788 CCTCCAAACTGAAGCAGCTCAGG - Intronic
917487557 1:175468743-175468765 CAGCCACACTGAAGCACCTGCGG - Intronic
919972040 1:202587277-202587299 CCACCTCTCTAAAGCACCCTCGG - Exonic
920873207 1:209811207-209811229 CCACCACCCCAGATCACCTCAGG + Intergenic
921589315 1:216985255-216985277 ACACCACAGGAAAGAACCTCTGG + Intronic
1067834814 10:49632072-49632094 CCTCCACACTCATGCACCCCAGG - Intronic
1070002399 10:72389704-72389726 GCTCCACTGTAAAGCACCTCAGG - Intronic
1070791003 10:79189299-79189321 CCACCACTCTACAGGCCCTCTGG - Intronic
1072191633 10:93080889-93080911 CCACCGCACAAAAGCACCTAGGG + Intergenic
1073630261 10:105141228-105141250 CCACCACAATAAATTGCCTCGGG - Intronic
1077696438 11:4397160-4397182 CCACCAAGCTCAAGCATCTCAGG - Intergenic
1082127833 11:48453657-48453679 CCACCAAGCTCAAGCATCTCAGG + Intergenic
1085647008 11:78230924-78230946 CCATCCCACAAAAGCAACTCAGG - Intronic
1086131752 11:83408726-83408748 CCTCCTCACTAAAGCACCTCTGG - Intergenic
1087605387 11:100371067-100371089 CCACCAAACTAACGCCCTTCAGG + Intergenic
1088436890 11:109823606-109823628 CCACCACAGTATACCATCTCTGG + Intergenic
1088688992 11:112309084-112309106 CCACTCAGCTAAAGCACCTCTGG - Intergenic
1091140533 11:133230708-133230730 CCACCCCATCACAGCACCTCAGG + Intronic
1095474769 12:42574960-42574982 CCAACACAATAAAACACATCTGG + Intronic
1101647857 12:106647769-106647791 CCCCCACAATAAAGGGCCTCAGG + Intronic
1108592717 13:51925013-51925035 CCAGCACACGTAAGCACCTCAGG + Intergenic
1113144853 13:107197137-107197159 CCACCACACTACAACACAGCTGG + Intronic
1114055698 14:18965646-18965668 CTCCCACACCAAAGCACCTGTGG + Intergenic
1114106849 14:19436118-19436140 CTCCCACACCAAAGCACCTGTGG - Intergenic
1114204534 14:20556299-20556321 ACACCTCACAAAAGCACCTTAGG - Exonic
1117031662 14:51677976-51677998 CCACCACATCAAACCACCTGTGG + Intronic
1118848955 14:69570463-69570485 CCACCACAGTAAAGCAGCCAAGG + Exonic
1122718197 14:103707743-103707765 CCACGACACCGAAGCCCCTCAGG + Intronic
1124198509 15:27656358-27656380 CCACCAGACTCAAGCACAGCTGG + Intergenic
1125391397 15:39196454-39196476 CCAGCACACTAAGGTACATCTGG + Intergenic
1129282223 15:74494720-74494742 ACACCACAGAAAAGCAACTCTGG - Intergenic
1131183120 15:90254020-90254042 CCACCACACCCAACCTCCTCTGG - Intronic
1131865351 15:96702818-96702840 CCACCACACAAGAGCAACTCAGG - Intergenic
1131899463 15:97072055-97072077 CTACCTCACAAAAGCAGCTCCGG - Intergenic
1132397670 15:101486683-101486705 CCACCAGTCTAAATTACCTCTGG + Intronic
1136499972 16:30665207-30665229 CCTCCACCCTAAAGCCCCCCAGG - Intronic
1138372659 16:56539748-56539770 CCACCACTTTAATGCATCTCTGG - Intergenic
1138518158 16:57550666-57550688 CCACCACAGTAAAGCAAATATGG + Intronic
1139189613 16:64847043-64847065 CTACCACACCAATGCACTTCTGG + Intergenic
1139704665 16:68732932-68732954 CCCCGCCACTAAAGCTCCTCAGG - Intergenic
1141201125 16:81898776-81898798 TCACCACACCATATCACCTCAGG - Intronic
1148262421 17:46194389-46194411 CCACCACTTTAAACCAACTCTGG - Intronic
1148864321 17:50620661-50620683 CCACCACCCAAAAGGGCCTCTGG - Intronic
1148893381 17:50824108-50824130 CCACCACACCCAGCCACCTCAGG - Intergenic
1159637441 18:70822381-70822403 CCAGAACATGAAAGCACCTCAGG - Intergenic
1164857238 19:31534525-31534547 CCTCCACAGTCAAGCAGCTCTGG + Intergenic
1164931951 19:32182771-32182793 CCACCAGACTAAGGCATCTGTGG + Intergenic
926114937 2:10206976-10206998 CCTCCACACCAATGCACTTCAGG + Intronic
926479727 2:13377400-13377422 CCAGCACACAAAAGCTCCTGGGG - Intergenic
927182793 2:20458895-20458917 CCACCAAACTCAAGCATCCCAGG - Intergenic
927699863 2:25261149-25261171 CCACCACACTTGGCCACCTCTGG - Intronic
931232433 2:60386148-60386170 CCACCACCCTTACACACCTCCGG + Intergenic
934781442 2:96972050-96972072 CCACCACACCCACCCACCTCTGG + Exonic
937339064 2:121079439-121079461 CCCACGCACTAAAGCACCTGTGG - Intergenic
938473868 2:131590246-131590268 CTCCCACACCAAAGCACCTGTGG + Intergenic
940008437 2:149030950-149030972 CCAGCACACAAAAGCACATTCGG + Intergenic
943074647 2:183179390-183179412 CCACCAAGCTCAAGCATCTCAGG + Intergenic
1178088506 21:29136889-29136911 CCTCTACACTAAATCATCTCAGG - Intronic
1178763067 21:35422578-35422600 CCAGCACTCTACAGCATCTCTGG - Intronic
1180474176 22:15688197-15688219 CTCCCACACCAAAGCACCTGTGG + Intergenic
1183411868 22:37659485-37659507 CCCCCACACCAAAGCACCCTGGG - Intronic
1184622917 22:45696382-45696404 CCACCACAGCACAGCAGCTCTGG - Intronic
952362722 3:32646918-32646940 CCAGCTCTCTAAAGCAGCTCAGG + Intergenic
952724913 3:36573674-36573696 CCACCACACCATTGCACCACTGG - Intergenic
952926903 3:38326802-38326824 ACATCACACTCAGGCACCTCAGG + Intergenic
953760459 3:45682962-45682984 GCAGCACCCTATAGCACCTCTGG - Exonic
957249662 3:77757034-77757056 CCACCAAGCTCAAGCATCTCAGG - Intergenic
958586244 3:96091480-96091502 CCACCAAACTGAAGCATCCCAGG - Intergenic
959564241 3:107818140-107818162 CCACCAACCTAAAGCAGCACTGG - Intergenic
961558572 3:127713356-127713378 CCACCACACTCAGGAACCGCAGG + Intronic
964842480 3:161009010-161009032 TCCCCACCCTAAAGCACCCCAGG - Intronic
967655104 3:192038508-192038530 TCACCCCACAAAAGGACCTCAGG - Intergenic
970154295 4:13125994-13126016 CCAATACACTAAAGCACATAAGG - Intergenic
971164404 4:24168190-24168212 CCACCACAGTAAAGCAAATATGG - Intergenic
971352340 4:25864678-25864700 CCACCACATTAAAGCATTTTGGG + Intronic
976655926 4:87488940-87488962 CCACCAAACTCAAGCATCCCAGG + Intronic
977563552 4:98558516-98558538 CCACCACATTAAAGTCCCTGGGG - Intronic
983702555 4:170615558-170615580 CCCCCACCCTAAATCACCCCAGG + Intergenic
996147302 5:119991881-119991903 CCACCACACTCCAGCATCCCAGG + Intergenic
997799370 5:136844185-136844207 CCACCACAATAAAGTACATGGGG + Intergenic
998976931 5:147658879-147658901 CCACCAAACTCAATCATCTCAGG + Intronic
1001714466 5:173803573-173803595 CCACCTAAATAGAGCACCTCTGG - Intergenic
1003395943 6:5752003-5752025 GCTCCTCACTAAACCACCTCCGG - Intronic
1006454434 6:34123818-34123840 CCACCACATTACTGCCCCTCGGG + Intronic
1009777108 6:68218805-68218827 CCACCAAGCTCAAGCACCCCAGG + Intergenic
1011674654 6:89720825-89720847 ATACCACACTAAAGAAGCTCTGG + Intronic
1015915149 6:138208861-138208883 TCTCCACACTAAACCTCCTCAGG - Intronic
1016063577 6:139655634-139655656 TCACCACAATAAAGCCCTTCTGG + Intergenic
1016388136 6:143548871-143548893 CCACAACTCTAAAACACCTATGG - Intronic
1019342053 7:512958-512980 CCCCCTCACTAAAGCACTCCTGG + Intronic
1019508774 7:1406704-1406726 CCACCACACCACTGCACCCCTGG + Intergenic
1020611735 7:10405651-10405673 TCACCACACTAAAGAGTCTCAGG - Intergenic
1024053448 7:45644706-45644728 CCACTGCAATAAAGCACCACAGG - Intronic
1024340605 7:48254618-48254640 AAACAAAACTAAAGCACCTCTGG - Intronic
1027613038 7:80386798-80386820 GCACCACACTTGAGAACCTCTGG - Intronic
1037928631 8:22864811-22864833 GCACCACAGTAAAACACCACGGG + Intronic
1038428314 8:27479677-27479699 CCACCACCCTAGAGGACCACCGG + Intronic
1042459762 8:69050037-69050059 CCACCACAATAAAGCAAATATGG - Intergenic
1042593212 8:70418289-70418311 CCACCATCCTGAAGCATCTCTGG - Intergenic
1048186221 8:132243488-132243510 CCATCAGACTGAAGCCCCTCTGG - Intronic
1048645443 8:136414453-136414475 CCAAAATACTGAAGCACCTCAGG - Intergenic
1050458352 9:5855554-5855576 CCTCCACAAGAAAGCAACTCAGG - Intergenic
1053267117 9:36723536-36723558 CCACCACACCAGTGCACCCCTGG - Intergenic
1056538392 9:87551059-87551081 CCACCAGACTGAAGCAGCACTGG - Intronic
1185876383 X:3705464-3705486 CCACCACAGTAGAGGACCACGGG + Intronic
1191119740 X:56890912-56890934 CCACCAAGCTCAAGCATCTCAGG - Intergenic
1191962486 X:66718898-66718920 CCACCAAGCTCAAGCATCTCAGG - Intergenic
1193140865 X:78025202-78025224 GCACCACAGTAAAGCACCCAAGG + Intronic
1195810631 X:108825066-108825088 CCACCAAACTCAAGCATCCCAGG + Intergenic
1200788996 Y:7283247-7283269 CCACCACAGTAAACGACCACAGG - Intergenic
1202330620 Y:23748866-23748888 CCACCAATCTCAAGCACTTCAGG - Intergenic
1202540149 Y:25921195-25921217 CCACCAATCTCAAGCACTTCAGG + Intergenic