ID: 907746855

View in Genome Browser
Species Human (GRCh38)
Location 1:57222359-57222381
Sequence AGTCCTAAGTGTTGTTATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907746851_907746855 15 Left 907746851 1:57222321-57222343 CCTATCCTGAGGTGCTTTAGTGT No data
Right 907746855 1:57222359-57222381 AGTCCTAAGTGTTGTTATAGAGG 0: 1
1: 0
2: 0
3: 6
4: 102
907746853_907746855 10 Left 907746853 1:57222326-57222348 CCTGAGGTGCTTTAGTGTGGTGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 907746855 1:57222359-57222381 AGTCCTAAGTGTTGTTATAGAGG 0: 1
1: 0
2: 0
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907746855 Original CRISPR AGTCCTAAGTGTTGTTATAG AGG Intronic
900753845 1:4419410-4419432 AGTCTAAAATGTAGTTATAGAGG + Intergenic
901333696 1:8430365-8430387 AGTGCAAAGTGTTTTTAAAGTGG - Intronic
905236072 1:36549477-36549499 TATCCTAAGTACTGTTATAGAGG + Intergenic
906004097 1:42454394-42454416 TGTCCTAAGTGTTAGGATAGGGG + Intronic
907675123 1:56510893-56510915 AGTGTTAAGTGCTGTTACAGAGG + Intronic
907746855 1:57222359-57222381 AGTCCTAAGTGTTGTTATAGAGG + Intronic
908097506 1:60754579-60754601 ATTCCACAGTGTTGCTATAGAGG + Intergenic
911227047 1:95317959-95317981 ATTCCTGAGTGTTGTTATATTGG + Intergenic
911312887 1:96317900-96317922 AATCCTATGTTTTGTTACAGAGG - Intergenic
913353516 1:117890607-117890629 AGTGCTAATTTTTGTTATAGTGG - Intronic
917876169 1:179289100-179289122 AGTCGTGAGTATTGTTAAAGGGG - Intergenic
918365287 1:183801612-183801634 AGTCCTTTGTGTTGCTATAAAGG + Intronic
918682788 1:187375927-187375949 AGTGATAAATGTTGTGATAGGGG + Intergenic
920002970 1:202811888-202811910 AGTTATAAGTGTTGTAATAGGGG - Intergenic
923312014 1:232744307-232744329 AGTGCTTAGTGTTGTGAAAGAGG - Intergenic
1065104154 10:22363656-22363678 AATCCTAAGTGTTACTATAATGG + Intronic
1066306700 10:34151622-34151644 AGTCATAACTGATGTTATAAAGG + Intronic
1067726234 10:48773399-48773421 AGTCCTAAGAGTTTTTGTAAAGG + Intronic
1071807549 10:89141216-89141238 AGACCTAAGAGTTGAAATAGTGG + Intergenic
1072923723 10:99597917-99597939 AGACGTAAGTGCTGTAATAGAGG - Intergenic
1074218091 10:111407821-111407843 TGTCCAAAGTGTTGTTTTACGGG + Intergenic
1077801799 11:5546614-5546636 AGTGCTGTGAGTTGTTATAGAGG - Intronic
1081953108 11:47063326-47063348 AGTGGTAAGTTTTGTTATATAGG - Intronic
1090235530 11:125144101-125144123 TGTCCCAGGTGTTGTTTTAGGGG - Intergenic
1095579995 12:43786881-43786903 AGGGCTAAGTGTTGATATGGTGG - Exonic
1095743676 12:45633941-45633963 AGTCCAAAGTTTTGAAATAGGGG + Intergenic
1100670779 12:96810216-96810238 TGTCCTAAGTGTTTTCAGAGGGG - Intronic
1101938677 12:109082578-109082600 AGACCACAGTGGTGTTATAGCGG - Intronic
1104174388 12:126315793-126315815 ATTCTTAAGTTTTGTTATTGGGG + Intergenic
1107982227 13:45744658-45744680 AGTCCTAAATATTGGAATAGAGG + Intergenic
1111128840 13:83948163-83948185 TGTCCAAAGTGCTGTTAGAGTGG + Intergenic
1111528430 13:89504944-89504966 ACTCTTAAGTGTTTTTATGGAGG + Intergenic
1111908621 13:94284838-94284860 AGTCATTAGTGTTTTTATTGTGG + Intronic
1113445649 13:110364392-110364414 AATCCTCAATGGTGTTATAGTGG + Intronic
1118409467 14:65462993-65463015 TGTACTAAGTGTTTTCATAGTGG + Intronic
1120370045 14:83621868-83621890 AGTGCTCAGTGTTTTTATTGGGG + Intergenic
1127285180 15:57526509-57526531 CGTTCTAAGTGCTGTAATAGTGG + Intronic
1128283478 15:66416701-66416723 TGTTCTCACTGTTGTTATAGTGG - Intronic
1130528264 15:84725413-84725435 TGTGATAAGTGTTGTGATAGGGG - Intergenic
1131118759 15:89810065-89810087 TTTCCTAAGTGCTGTGATAGAGG - Intronic
1135738135 16:24950100-24950122 CGTTCAAAGTGGTGTTATAGAGG - Intronic
1156332998 18:36142987-36143009 AGACCTAAGTATCGTTATATTGG - Intronic
1159827206 18:73228545-73228567 AGTTCTAAGAATTTTTATAGTGG - Intronic
1164777747 19:30866448-30866470 AGTCATAGGTGTGGTTATAAGGG + Intergenic
931396677 2:61893856-61893878 AGACATGAGTGTTGTTTTAGGGG + Intronic
935616208 2:105084781-105084803 AGTCGAAATTGCTGTTATAGAGG + Intronic
936241810 2:110794308-110794330 ATGCCTAAGTGTTTTAATAGAGG + Intronic
936442352 2:112565734-112565756 AGTCCTTTGGGTTGTTATGGAGG + Intronic
941053836 2:160765392-160765414 AGTATTAAATTTTGTTATAGTGG + Intergenic
943013893 2:182487598-182487620 AGTTCTCAGTGTTTTTGTAGTGG - Intronic
944574497 2:201078463-201078485 AGTTCAAAGAGTTGTTTTAGAGG + Intronic
944865274 2:203853916-203853938 AGTCCTAATTGAAGTTATAAAGG + Intergenic
947098127 2:226590189-226590211 AGTTCCATGTGTTTTTATAGTGG + Intergenic
1169082746 20:2807130-2807152 GGTCCTAAGGGTTGCAATAGAGG - Intergenic
1176017902 20:62946121-62946143 AGTGCTAAGTGTTGGTTTAGTGG + Exonic
1178895904 21:36556621-36556643 TGTTCTAAGTGTTTTTATATCGG - Intronic
1181963011 22:26636714-26636736 AGTTGTAAGTGTTGCTGTAGGGG + Intergenic
1183965581 22:41440006-41440028 AGTCCTGAGTGTTCTTGTGGAGG - Intronic
951068600 3:18297466-18297488 ACTCTTAAGTGTTTTTATAATGG - Intronic
952816248 3:37450693-37450715 TGTTCTAAGTGTTGAGATAGAGG + Intergenic
959130914 3:102354986-102355008 ATTCCTAAGTGTTGTAATCCAGG - Intronic
959500374 3:107099841-107099863 AGACTTAAGTGTTGTCACAGTGG - Intergenic
959732600 3:109620961-109620983 AGACATAAGTCTTGTTACAGAGG - Intergenic
961407030 3:126686850-126686872 AGTCCTTTGTGTTGCTATAAAGG + Intergenic
964813286 3:160689702-160689724 AGTCCTAAATGTTCTTCTATAGG + Intergenic
969119338 4:4896227-4896249 AATCATAAGTGTTTTTATAAAGG + Intergenic
969182350 4:5451924-5451946 AGTCCTAGGTGATGTGAAAGGGG - Intronic
974611111 4:64217553-64217575 AGAACTAAGTATTGTTATAACGG - Intergenic
975319126 4:72990012-72990034 AGTGCTAAGTGCTATGATAGAGG - Intergenic
976590825 4:86848408-86848430 AGTCCTAGGAGTTGCTAAAGAGG + Intronic
977363998 4:96043276-96043298 AGTCCTAAGGCTTGTTGAAGAGG - Intergenic
979341803 4:119534171-119534193 AGTCCAAAGTATTGTTTCAGAGG + Intronic
986114543 5:4759230-4759252 AGTCCTAAGTGATTGTACAGAGG - Intergenic
987685561 5:21195684-21195706 TCTCCTAAGTGTTGATATAAGGG - Intergenic
988638698 5:33016977-33016999 AATCACAAGCGTTGTTATAGAGG + Intergenic
992335340 5:75761836-75761858 AGTTCTAACTGTAGTTACAGAGG - Intergenic
996188965 5:120515015-120515037 AGTCCCAGGTATTGTTACAGGGG - Intronic
996488934 5:124069271-124069293 AGTACTAAGAGTGGTTATAGAGG - Intergenic
1003471956 6:6444808-6444830 AATCACAAGTGTTGTTATAAAGG + Intergenic
1003477966 6:6502380-6502402 AGGCCTGAGTGTTGTTGGAGGGG - Intergenic
1010354224 6:74911561-74911583 AATCCCAAGTGTTTTTATTGTGG + Intergenic
1011053468 6:83179765-83179787 ACTACTAAGTCTTGTTTTAGAGG + Intronic
1014859460 6:126447042-126447064 AGGCCTACCTGCTGTTATAGGGG + Intergenic
1015108221 6:129562494-129562516 TGTCCTAAGTCTTGTTTTACAGG + Intergenic
1020522669 7:9213086-9213108 GATCCTAAGTGTTTTTATAATGG + Intergenic
1020780559 7:12512089-12512111 AGTTCTAAGAGTTTTTTTAGTGG + Intergenic
1022168020 7:27791808-27791830 AGTACATAGGGTTGTTATAGAGG + Intronic
1024683131 7:51715164-51715186 AGTCATAAGTGTTATGAAAGAGG + Intergenic
1028546001 7:92000677-92000699 AGTTCTAAGTGTCATTATTGTGG + Intronic
1029308827 7:99642399-99642421 AGTCCTCACTGTGGTCATAGTGG + Intergenic
1030238418 7:107292455-107292477 AGTTCTAAAAGTTGTTATGGAGG - Intronic
1033909049 7:146243762-146243784 AGTCCTAAGTGAGATTACAGAGG + Intronic
1037406819 8:18551549-18551571 ATTTATAAGTTTTGTTATAGTGG + Intronic
1039019897 8:33193728-33193750 TGTCATAAGTTTTGTTAAAGGGG + Intergenic
1040306453 8:46214414-46214436 AGTCCTCAGTGGTGTCCTAGTGG + Intergenic
1042233527 8:66584491-66584513 AGTTCTAAGAGTTTTTTTAGAGG - Intronic
1046147776 8:110183943-110183965 AGTTCTAAGAGTTTTTATGGGGG + Intergenic
1048201624 8:132379423-132379445 AGTCCTAAGGGCTGTGATTGTGG - Intronic
1048384610 8:133900146-133900168 AATGCTAAGTTTTGTTATTGCGG - Intergenic
1050340923 9:4637725-4637747 TGTCCCAAGTGTTGTTCTACAGG - Intronic
1052847899 9:33353523-33353545 AGTGCCAAGTGTTGCTCTAGGGG + Intronic
1053378756 9:37631007-37631029 TGTGCTAAGTGCTGTCATAGAGG + Intronic
1055921460 9:81465618-81465640 AGTCCTGGGTGTTCTAATAGAGG - Intergenic
1057208943 9:93189177-93189199 AGGCGTCAGTGTTGTTAAAGGGG - Intronic
1057527483 9:95815857-95815879 AGTGCTAAGTCTTGTGATCGCGG + Intergenic
1203445801 Un_GL000219v1:54943-54965 AGTCCTAAGTTTTGTTAATATGG + Intergenic
1196541536 X:116916322-116916344 AGTCCTGAGCCTTGTGATAGGGG - Intergenic
1198703775 X:139425208-139425230 ATTACTAAGTGTTCTCATAGAGG - Intergenic
1198993224 X:142540989-142541011 ATTCCTAAGTGTTCTTTTAGGGG + Intergenic