ID: 907746857

View in Genome Browser
Species Human (GRCh38)
Location 1:57222367-57222389
Sequence GTGTTGTTATAGAGGAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907746851_907746857 23 Left 907746851 1:57222321-57222343 CCTATCCTGAGGTGCTTTAGTGT No data
Right 907746857 1:57222367-57222389 GTGTTGTTATAGAGGAAACATGG No data
907746853_907746857 18 Left 907746853 1:57222326-57222348 CCTGAGGTGCTTTAGTGTGGTGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 907746857 1:57222367-57222389 GTGTTGTTATAGAGGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907746857 Original CRISPR GTGTTGTTATAGAGGAAACA TGG Intronic
No off target data available for this crispr