ID: 907746858

View in Genome Browser
Species Human (GRCh38)
Location 1:57222368-57222390
Sequence TGTTGTTATAGAGGAAACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 5, 3: 11, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907746851_907746858 24 Left 907746851 1:57222321-57222343 CCTATCCTGAGGTGCTTTAGTGT No data
Right 907746858 1:57222368-57222390 TGTTGTTATAGAGGAAACATGGG 0: 1
1: 0
2: 5
3: 11
4: 215
907746853_907746858 19 Left 907746853 1:57222326-57222348 CCTGAGGTGCTTTAGTGTGGTGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 907746858 1:57222368-57222390 TGTTGTTATAGAGGAAACATGGG 0: 1
1: 0
2: 5
3: 11
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907746858 Original CRISPR TGTTGTTATAGAGGAAACAT GGG Intronic
902918397 1:19652369-19652391 TGTGGTTGTACTGGAAACATGGG + Intronic
903430708 1:23297184-23297206 TGTTTTTATTGATGTAACATGGG - Intergenic
905500892 1:38435474-38435496 TGATGTGATAGAGGAAAATTTGG + Intergenic
906919562 1:50048719-50048741 GGGTGTAATAGAGGAAAGATAGG - Intronic
907038715 1:51238696-51238718 TTTTGTTGTATAGTAAACATAGG - Intronic
907746858 1:57222368-57222390 TGTTGTTATAGAGGAAACATGGG + Intronic
910647548 1:89530046-89530068 GGTTGTTATAAAGGAGACATGGG + Intronic
911429353 1:97764091-97764113 AGTTGATAAAGAGGAAACAAGGG + Intronic
912914915 1:113805016-113805038 TGTTGTTAAAAAGGAAAGAAAGG - Intronic
913109518 1:115644953-115644975 TGTTGTAATAAAAGAATCATTGG + Intronic
915630842 1:157153360-157153382 TATTGTTGTTGAGGAAACAAAGG + Intergenic
918457224 1:184733987-184734009 TGTTGTTAAAAAGGGAATATAGG - Intronic
919291422 1:195638148-195638170 TTTTATTACAGAGGAAACCTGGG + Intergenic
920434144 1:205937351-205937373 TGGTGTTTTGGAGGAGACATGGG + Intronic
920988416 1:210912584-210912606 TGCTGTAAGAGAGGAAACACAGG + Intronic
923591739 1:235326933-235326955 TGGTGTTTTAGAGGATACCTTGG - Exonic
923607207 1:235454785-235454807 TGTTGTTTTAGATAAAAGATTGG + Intronic
923745457 1:236695654-236695676 TGTTTTTGTATAGAAAACATGGG + Intronic
924687734 1:246312671-246312693 TGTTGGTATATAGAAAATATGGG + Intronic
1063752118 10:8961685-8961707 AGTTGTTATATGGGAAACTTAGG + Intergenic
1065521211 10:26575153-26575175 TGTAGTTATAGAAGAAATAGTGG + Intergenic
1065526634 10:26628811-26628833 TGTAGTTATAGAAGAAATAGTGG + Intergenic
1065559794 10:26950933-26950955 TGTAGTTATAGAAGAAATAGTGG - Intergenic
1066134341 10:32428087-32428109 TTTTGTTATATAGGCAATATAGG + Intergenic
1066134386 10:32428893-32428915 TTTTGTTATATAGGCAATATAGG - Intergenic
1068158435 10:53232038-53232060 TCTTGTTATAGAAGAAAGAGAGG - Intergenic
1068236676 10:54243888-54243910 TATTGTTATGGAAGAAACACAGG + Intronic
1069044963 10:63733625-63733647 TCTTGTTCTGGAGGAAACTTGGG + Intergenic
1069375308 10:67787204-67787226 AGTTGTTATAGAGCAAGCAATGG - Intergenic
1071157878 10:82712175-82712197 TATTGGAATAGAGGAAAAATAGG + Intronic
1076118071 10:127914493-127914515 GGTTGTTACTGAGGTAACATGGG + Intronic
1078343381 11:10519375-10519397 TTTTGTGATAAAGAAAACATAGG + Intronic
1079652981 11:22953586-22953608 TGTTGTTATGGAGTCATCATGGG - Intergenic
1080150069 11:29041782-29041804 TGTTGTTTTAGAGGAATTTTAGG + Intergenic
1086186013 11:84016760-84016782 TTTTGTTGAAGAGGAAACAAAGG + Intronic
1086513009 11:87580493-87580515 TGTATTTATAGAGCAAACAGTGG - Intergenic
1087670582 11:101101630-101101652 TGTTGTTTTGGTGGAAGCATGGG - Intronic
1088517184 11:110650327-110650349 TGTAGTTATAGAAGAAACTAAGG - Intronic
1088757132 11:112894780-112894802 TGCTGTTAAATAGGAAACAGGGG - Intergenic
1089157172 11:116411200-116411222 TCATGTTATAGAGGGAACAAAGG - Intergenic
1092794912 12:12100710-12100732 AGTTGTTTTAGTGGAAACAGGGG - Intronic
1094319101 12:29165900-29165922 TGTTGTTGTATAGGAAAAACAGG + Intronic
1094724185 12:33095596-33095618 TGTTATTATGGAGGAAACATTGG - Intergenic
1095445220 12:42275898-42275920 TGTTGTTATAAAGGAACCTGAGG - Intronic
1097341781 12:58446853-58446875 TGCTGTAACAGAGGAAACAAAGG - Intergenic
1097363337 12:58682264-58682286 TGATGTTATTGAGAAAACAAGGG + Intronic
1097424820 12:59430376-59430398 TGTTTGAATAGAAGAAACATTGG + Intergenic
1099418814 12:82426874-82426896 TGTTGTGGTAGAGGGAAGATGGG - Intronic
1099643463 12:85320280-85320302 TGTTGTGATAGAGTAAACATAGG - Intergenic
1103357103 12:120329848-120329870 GGTTGTTGTAGAGGTGACATAGG - Intergenic
1104476580 12:129075342-129075364 TGTTGTTATAAAAGGAAGATGGG + Intronic
1104581099 12:130011349-130011371 TGTAATTATTGAAGAAACATTGG + Intergenic
1107098413 13:36561267-36561289 TTTTGTTATGGATGACACATGGG - Intergenic
1107724710 13:43287011-43287033 TGGGGTTATAGAGGGAACACAGG + Intronic
1108245641 13:48510408-48510430 TGGAGGTATAGATGAAACATGGG + Intronic
1108862080 13:54873254-54873276 TGTTGTTTTAGAGAGAACGTGGG - Intergenic
1108944716 13:56007287-56007309 TGTTTTTAGAGAGGAAACATTGG - Intergenic
1111207384 13:85028484-85028506 TGATGTCATAGAGAAAATATTGG - Intergenic
1111340224 13:86875522-86875544 TTTTGTTCCAGAGGCAACATAGG + Intergenic
1111635244 13:90894425-90894447 AGTGGTTATAGAGGAAAAAAAGG - Intergenic
1111835085 13:93378336-93378358 TGTTGTCATAGAAGAAACGCAGG - Intronic
1111877333 13:93913611-93913633 TTTTGTTAAAGAGGAAATACTGG - Intronic
1113886423 13:113661978-113662000 TTTTGTTATAAAGGTAACACTGG - Intergenic
1114902521 14:27082316-27082338 TGTTGTTATATAGGTAAATTGGG + Intergenic
1115108708 14:29793948-29793970 GCTTGTGTTAGAGGAAACATTGG - Intronic
1115906006 14:38203790-38203812 TTTTGTAGTAGAGAAAACATAGG + Intergenic
1117761448 14:59033026-59033048 TGTTGTCCTAGAAGAAACACAGG - Intergenic
1118410747 14:65475258-65475280 TGTTATTATAGAGGAAATCAGGG - Intronic
1120179071 14:81324834-81324856 TGTTGGTTTGGAGGAAGCATGGG + Intronic
1120466585 14:84865342-84865364 TTTTGTGATAGAAAAAACATAGG + Intergenic
1124420887 15:29520569-29520591 TTTTTTTTTATAGGAAACATGGG - Intronic
1126821859 15:52512212-52512234 TATTGTTATAGTAGAAAAATGGG + Intronic
1127214857 15:56813562-56813584 AGTTTTTATAAAGGAAACTTGGG - Intronic
1127251897 15:57247364-57247386 TTTTATTATGGAGGAAACTTTGG - Intronic
1128283477 15:66416692-66416714 TGTTGTTATAGTGGAAACCAAGG - Intronic
1128491380 15:68149032-68149054 TGCTGAGATAGAGGAAACACTGG + Intronic
1128858122 15:71038415-71038437 TGTTGTTATAGAGGAAAAGTAGG + Intronic
1130114078 15:80990873-80990895 TGTTGTAATAGCAGAAAAATTGG - Intergenic
1131330225 15:91491149-91491171 TTTTGTTATATAGGAGAGATGGG - Intergenic
1137757536 16:50914605-50914627 TATTGTTATAGAGACAGCATAGG - Intergenic
1138236187 16:55385062-55385084 TGTTTTTATAGAGGACTCTTGGG + Intergenic
1139108188 16:63854764-63854786 TATTGTTAAAGAGAAGACATGGG + Intergenic
1141342305 16:83214277-83214299 TGTTATTAAAAAGGAAACCTAGG + Intronic
1141817641 16:86423704-86423726 TGTTGTGAGCGAGGAAACGTTGG + Intergenic
1144935753 17:18897257-18897279 TCTTGTTAAAGAGCAAACTTTGG - Intronic
1146762846 17:35493218-35493240 TGTGGTCCTAGAGGAAGCATTGG + Intronic
1148506634 17:48132504-48132526 TGTTGTAGTGGAGGACACATGGG + Intergenic
1150354526 17:64471625-64471647 TGCTGTGATAGAGGAAATGTTGG - Intergenic
1150917867 17:69454742-69454764 TTTTGTTATTAAGGCAACATAGG + Intronic
1153053566 18:923888-923910 TGTACTTATAGAGGCATCATTGG + Intergenic
1153439719 18:5102851-5102873 AGTTGTTAAAAAGAAAACATAGG + Intergenic
1153525435 18:5990643-5990665 ATGTTTTATAGAGGAAACATGGG - Intronic
1153743633 18:8154329-8154351 TGCTGCGGTAGAGGAAACATAGG - Intronic
1153808169 18:8728906-8728928 TTTTGTTTTAGAAGAAACAAGGG + Intronic
1157467854 18:47963092-47963114 TTATGTTATAGAGTAAGCATTGG - Intergenic
1158654007 18:59312072-59312094 TCTTATCATAGAGGAAACACAGG - Intronic
1159152857 18:64542557-64542579 AGTAGCTATTGAGGAAACATAGG - Intergenic
1164560650 19:29289762-29289784 TGTTCTGATGGAGGAAACACTGG + Intergenic
1165588004 19:36938139-36938161 TGTTCTTAGACAGAAAACATTGG - Intronic
1167033847 19:46981446-46981468 TGTTGCTAGAAAGGAAACTTTGG + Intronic
1167645113 19:50701514-50701536 ACTTGTTATGTAGGAAACATTGG + Intronic
925460168 2:4055280-4055302 TGATGTTGTAGTGGAAACATTGG + Intergenic
926391590 2:12399576-12399598 TGTTATTATAGAAGACACTTAGG + Intergenic
926737894 2:16088079-16088101 TGTTGTTAAAAATGAAACTTAGG - Intergenic
927057350 2:19377994-19378016 TGTCATTATGTAGGAAACATAGG - Intergenic
927136449 2:20100147-20100169 TCTTGTTTTAGAGGAAAGAGTGG - Intergenic
930617556 2:53609196-53609218 TGTAGTTATAGAGGACAGAAGGG + Intronic
931052893 2:58433691-58433713 TGTTGTTACAGTGGAAACTATGG - Intergenic
931793143 2:65683377-65683399 TCTTCTTATAAAGGAAAAATTGG + Intergenic
932193938 2:69766538-69766560 CTTTGTTATAGAGGAAGGATGGG + Intronic
933083270 2:78021604-78021626 TGTTGTTAGATAAGAAATATAGG - Intergenic
933434397 2:82227900-82227922 TGTTGGTAAAAAGGAAAAATTGG - Intergenic
937054802 2:118925335-118925357 TGTTATTATGGAGAAAACAGAGG - Intergenic
941791027 2:169552139-169552161 TGTTGTTATATAAAAATCATAGG - Intronic
943374921 2:187064807-187064829 TGTTCTTTTAGAGGACACATTGG + Intergenic
943510512 2:188820523-188820545 TGTTGTTATAAAAGGCACATGGG + Intergenic
943518597 2:188918751-188918773 GTTTGTTATAGAGGAAAAACTGG - Intergenic
943912809 2:193590693-193590715 TATTGTTAAAGAGGTGACATAGG + Intergenic
1170442302 20:16391310-16391332 TGCTGTGATAGAGGACTCATGGG - Intronic
1172989398 20:39021828-39021850 TTTTGTTTTACAGGAAACTTCGG + Exonic
1177344377 21:19850916-19850938 GCTTGTTGTAGAAGAAACATTGG + Intergenic
1177378159 21:20300918-20300940 TATTATCATAGAGGAAACAGAGG + Intergenic
1178267032 21:31152993-31153015 TGTTGGTAAAGAGGAAAAATGGG - Intronic
1178939788 21:36895574-36895596 TGTTGTATTAGAGGAGGCATTGG - Intronic
949136206 3:569446-569468 TGGTGTTCTATAGGCAACATAGG - Intergenic
951652889 3:24971586-24971608 TGCTGTTTTAGAAGAGACATTGG + Intergenic
952007129 3:28854823-28854845 TGTTCTTATAGGGGAAAACTTGG + Intergenic
953261786 3:41346388-41346410 TATTGTTGAAGAGGAAACCTAGG - Intronic
955805111 3:62725637-62725659 TGCTGGTATACAGGAAACACCGG + Intronic
956433762 3:69213254-69213276 GGTTGTCATGGAGGAAAAATGGG + Intronic
960114729 3:113882581-113882603 TGTTATAATAGAAGAAACACGGG - Intronic
960610023 3:119547141-119547163 TGTTGGTATAGAAAGAACATGGG + Intronic
971467511 4:26979217-26979239 TATTGTTAAAGATGAAACATAGG + Intronic
972172216 4:36360196-36360218 TGTTGTTCTAGGTGAAATATGGG - Intergenic
972370247 4:38416543-38416565 TGTTTTTATCAAGGAAACAATGG + Intergenic
972470886 4:39403502-39403524 TGTCATAATAGAGAAAACATGGG + Intergenic
972711719 4:41603279-41603301 TATAGTTAGAGAGTAAACATGGG + Intronic
973932262 4:55804916-55804938 TGTTGTGTAAGATGAAACATTGG - Intergenic
974580234 4:63789617-63789639 TGTTTTTATAAAGGAAAATTAGG - Intergenic
976147701 4:82058355-82058377 TGTGGTTATAGAGGAAAACCTGG + Intergenic
977245447 4:94625172-94625194 TGTTTTAACAGAGGATACATAGG - Intronic
978156392 4:105493904-105493926 TGTTGGTATATAGGAATCTTAGG + Intergenic
980339037 4:131518012-131518034 TGTTGTTATAAAAGAAAATTTGG + Intergenic
981654925 4:147102267-147102289 TGTTGTTAGAAAGGCAAAATTGG + Intergenic
982589117 4:157282036-157282058 TGTTGTGTTAGTGAAAACATTGG - Intronic
982788795 4:159566513-159566535 ATTTTTTATAGAGGAAAAATTGG + Intergenic
983899808 4:173121970-173121992 TGTTGTTATTAAGGCCACATTGG - Intergenic
984290778 4:177791179-177791201 TGTAGTTCTAGAGGCAAGATAGG - Intronic
984994479 4:185415714-185415736 TGTTGCTCCAGAAGAAACATGGG - Exonic
985021464 4:185695779-185695801 TGTTGACATATAGGAAAGATAGG - Intronic
987143384 5:14967485-14967507 GGTTGTAATAGTGGAAACAGAGG - Intergenic
988624493 5:32858516-32858538 TGTTGTAATAGCAGAAATATTGG + Intergenic
990222889 5:53614815-53614837 TGTTATTATGTAGGAAACTTTGG + Intronic
991915676 5:71602749-71602771 TGTAATTATAAAGGAAACACAGG + Intronic
993400949 5:87450495-87450517 TTTTGTTTTAGAGGAAACATTGG + Intergenic
995374009 5:111453203-111453225 TGTGGTAACATAGGAAACATTGG + Intronic
995861128 5:116641819-116641841 TGTTGGTGTAGAGGACACAGGGG + Intergenic
996473020 5:123881974-123881996 TGTATTTATAGAGAAAACAGAGG - Intergenic
996628105 5:125594797-125594819 TGTTCATAAAAAGGAAACATTGG + Intergenic
999848601 5:155512912-155512934 TGTTGTTATGGAGGATAATTTGG + Intergenic
1001682045 5:173565231-173565253 GGTTGTTGTAGAGGTAACATTGG - Intergenic
1003637034 6:7841818-7841840 TGTTTTGGTAGAGGAAAAATTGG + Intronic
1003714705 6:8633394-8633416 TGTTGTTTTGGACTAAACATTGG + Intergenic
1004061604 6:12203532-12203554 TATTATTATAGAGGTGACATGGG + Intergenic
1004125652 6:12870138-12870160 TGTTGATACAGGGGAAGCATTGG - Intronic
1005211223 6:23466381-23466403 TTTTATTATAGATGAAAGATAGG - Intergenic
1006274852 6:32995505-32995527 AGTTGTTATATATAAAACATTGG + Intergenic
1007426090 6:41747116-41747138 TGATGTTAGACAGGACACATGGG - Intronic
1007504712 6:42326682-42326704 TGTGGTAATAGATGATACATTGG - Intronic
1008353682 6:50525234-50525256 TATTGTTATAGTAGACACATAGG + Intergenic
1008581329 6:52910293-52910315 TGATGTGATAGAGGAAGCACAGG - Intergenic
1008694572 6:54019718-54019740 TGTGGTTATAGAGTTAACATTGG + Intronic
1010448305 6:75973805-75973827 TGCTGCTAAAGAGGACACATAGG + Intronic
1012283503 6:97359776-97359798 TGTTGTGATTCAGGAAAAATAGG + Intergenic
1012322800 6:97872151-97872173 TTTTCTTAAAGAGGAAACTTTGG - Intergenic
1020149789 7:5673121-5673143 TGGTGTTGTAGAGGACACATTGG - Intronic
1020484169 7:8700800-8700822 TTCTGTAATAGAGAAAACATGGG - Intronic
1021218284 7:17943470-17943492 AGTTGTTACAGAGGAAACCTGGG + Intergenic
1021922427 7:25499483-25499505 TGATGGTATAGGGGAAAAATAGG - Intergenic
1022267626 7:28772582-28772604 TGTTGTAACAAAGGAAACACAGG + Intronic
1022843416 7:34187000-34187022 ACTTGTTTTAGAAGAAACATTGG - Intergenic
1023103156 7:36739301-36739323 TGTTGTTGAATAGGACACATAGG + Intergenic
1023486143 7:40689253-40689275 TGTTGTTCTAGAGAAGACTTAGG + Intronic
1023950823 7:44843198-44843220 TTTTGTAATTGATGAAACATAGG + Intronic
1024025403 7:45405987-45406009 TGTTGATAAAGAGGTATCATTGG - Intergenic
1024102751 7:46049429-46049451 AATTGTTATAGAGGCAACCTGGG + Intergenic
1024860082 7:53828708-53828730 GTTTGTTACATAGGAAACATGGG - Intergenic
1026554772 7:71397973-71397995 TGTTGTTTTAGAAGAACCAAAGG + Intronic
1027135009 7:75617779-75617801 TGTCGTCATGGAGGAAACCTTGG + Intronic
1027979055 7:85193830-85193852 TGTTGTTATTGTTGAAAGATGGG - Intergenic
1029433454 7:100547598-100547620 TGTTCTAATACAGGAAACTTGGG - Intronic
1029946468 7:104538566-104538588 TGTTGTGATAAAGAAAACAATGG - Intronic
1030968501 7:116024139-116024161 AGTAGTTGTAGAGGTAACATGGG - Intronic
1031709865 7:125032053-125032075 TGTTGTCATAGAGTAATTATTGG + Intergenic
1032817070 7:135487133-135487155 GGTTGTAATTGAGAAAACATAGG - Intronic
1035330485 7:158093632-158093654 TCTTCTTACAGAGGAGACATCGG + Intronic
1036174779 8:6526972-6526994 TGTGTTTGAAGAGGAAACATTGG + Intronic
1036995653 8:13653114-13653136 TTTTGCTATAGTGGAAAAATAGG + Intergenic
1037806091 8:22058600-22058622 TGTTGTTATTGAGAGAACAAGGG + Intronic
1038745525 8:30251394-30251416 TGTTGTTTTGGGGGTAACATTGG - Intergenic
1038918912 8:32060333-32060355 TGTGGGAATAGAGGAAACAGAGG + Intronic
1040343085 8:46454217-46454239 TGATGTTATGGAGCAAACAGAGG - Intergenic
1040810201 8:51444106-51444128 TGCTGTTATTGATGAAACAGGGG - Intronic
1045753844 8:105517987-105518009 TATGGTAATAGAGTAAACATTGG - Intronic
1046779712 8:118202121-118202143 TGTTGTTAAAAAGGACTCATAGG + Intronic
1047879160 8:129173588-129173610 TGTTTTTATAGATGAGACAGTGG + Intergenic
1048230288 8:132633377-132633399 TGTTGTTAAGGGTGAAACATGGG - Intronic
1048514127 8:135090303-135090325 TTTTGTTAAAGGGGAAAAATGGG + Intergenic
1050368505 9:4896550-4896572 TGTTTTTATAGTAGAATCATTGG + Intergenic
1050810555 9:9741266-9741288 TTTAGTGATAGAAGAAACATGGG + Intronic
1051670807 9:19508409-19508431 TGTCCATATAGAGTAAACATGGG - Exonic
1052665745 9:31493212-31493234 AGTTGATATGGAGGGAACATTGG - Intergenic
1053305739 9:36983584-36983606 TTGTTTTAAAGAGGAAACATTGG + Intronic
1055409067 9:76008334-76008356 TGTTGTTTTATAGGATGCATGGG + Intronic
1055850468 9:80622190-80622212 TGTTGTTATAGAAGAAGCAATGG + Intergenic
1055904602 9:81278171-81278193 TGTTGTTATAGATGAAATTAAGG - Intergenic
1056113277 9:83417506-83417528 TGTTTCCATATAGGAAACATAGG - Intronic
1057329400 9:94098736-94098758 TGATGTTATAGAAAAAACACAGG + Intronic
1057966111 9:99505026-99505048 TGTTGTTATAGAAAGGACATTGG - Intergenic
1058587058 9:106520191-106520213 TGATGTAAAAGAGGCAACATGGG + Intergenic
1187345930 X:18463669-18463691 AGTTGTTACAGAGGAAATCTGGG + Intronic
1188216171 X:27480098-27480120 TGTTGTTATAGTCAAAACAATGG - Intergenic
1189483064 X:41407935-41407957 TGATGTCATAGTGGAAACAGAGG - Intergenic
1191644019 X:63459437-63459459 TGTTGTTATAAAGGAAAAGAAGG - Intergenic
1193115154 X:77768590-77768612 TCTTCTTCTAAAGGAAACATGGG - Intronic
1197598074 X:128491192-128491214 GGTTGTTACTGAGGAAATATAGG + Intergenic
1198014894 X:132600478-132600500 TGTTGTTTTAGAGAAGACACTGG + Intergenic
1199290361 X:146098617-146098639 AGTGGTTTTGGAGGAAACATTGG - Intergenic
1199535817 X:148902050-148902072 TCTTTTTATAGAGCCAACATAGG - Intronic
1200325540 X:155234420-155234442 TCTTGATATAGAAGAAACAGGGG - Intronic
1201864790 Y:18638319-18638341 TGGTGTTATAGGGGAAAGAATGG - Intergenic
1201868532 Y:18682059-18682081 TGGTGTTATAGGGGAAAGAATGG + Intergenic