ID: 907747064

View in Genome Browser
Species Human (GRCh38)
Location 1:57223900-57223922
Sequence TGTGATATCATGGGGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 253}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907747056_907747064 11 Left 907747056 1:57223866-57223888 CCTTCCTGACACCTTGCTTCTGC 0: 1
1: 0
2: 2
3: 57
4: 609
Right 907747064 1:57223900-57223922 TGTGATATCATGGGGAAAACTGG 0: 1
1: 0
2: 0
3: 20
4: 253
907747058_907747064 7 Left 907747058 1:57223870-57223892 CCTGACACCTTGCTTCTGCAGGC No data
Right 907747064 1:57223900-57223922 TGTGATATCATGGGGAAAACTGG 0: 1
1: 0
2: 0
3: 20
4: 253
907747055_907747064 18 Left 907747055 1:57223859-57223881 CCTCTCTCCTTCCTGACACCTTG 0: 1
1: 1
2: 13
3: 53
4: 601
Right 907747064 1:57223900-57223922 TGTGATATCATGGGGAAAACTGG 0: 1
1: 0
2: 0
3: 20
4: 253
907747060_907747064 0 Left 907747060 1:57223877-57223899 CCTTGCTTCTGCAGGCTGGACAG 0: 1
1: 1
2: 25
3: 111
4: 386
Right 907747064 1:57223900-57223922 TGTGATATCATGGGGAAAACTGG 0: 1
1: 0
2: 0
3: 20
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907747064 Original CRISPR TGTGATATCATGGGGAAAAC TGG Intronic
903085882 1:20858413-20858435 TGTTAAATCATGTGGAAATCTGG - Intronic
903134222 1:21298751-21298773 TCTGATGTCATGGGAAAACCTGG - Intronic
903450515 1:23450912-23450934 TGGGACATCATGGGGAAAGAAGG - Intronic
904310560 1:29626755-29626777 TGTGTTATGATGGGTAAAACAGG - Intergenic
904700559 1:32355450-32355472 TGTCATGTAATGGGGAAGACAGG + Intronic
904944302 1:34188027-34188049 TGCGAGATTCTGGGGAAAACGGG + Intronic
907747064 1:57223900-57223922 TGTGATATCATGGGGAAAACTGG + Intronic
909101279 1:71352390-71352412 AGGGACAGCATGGGGAAAACTGG - Intergenic
911037493 1:93566205-93566227 TGAGAGACCTTGGGGAAAACTGG - Intronic
912647063 1:111403284-111403306 TGTGGTATTATGGTGAAAACAGG - Intergenic
916349152 1:163829399-163829421 TGGAAAATGATGGGGAAAACAGG - Intergenic
916430668 1:164725010-164725032 TGTGGTATCATAGGAAAAAGAGG + Intronic
922662667 1:227443800-227443822 TGTGACATCAGAGGGAAAACAGG - Intergenic
923403314 1:233636729-233636751 AGTGATGTCATAGGAAAAACAGG + Intronic
923633153 1:235668755-235668777 TGTCATATCAAGAGGAATACTGG - Intronic
1063075207 10:2709869-2709891 TGTGATGTTTTGTGGAAAACTGG + Intergenic
1065069596 10:22008948-22008970 TTTAAAATCATGGGGTAAACAGG - Intergenic
1065413173 10:25453021-25453043 TGTGACAACATGGATAAAACTGG - Intronic
1070211251 10:74324547-74324569 TGTGATAACATGGAGGAACCTGG - Intronic
1070635373 10:78122242-78122264 TGTGACATTATTTGGAAAACAGG + Intergenic
1071483917 10:86085407-86085429 TGTGAGAAAATGTGGAAAACAGG + Intronic
1071938622 10:90560734-90560756 TGTGATATGATGAGGTAAAATGG - Intergenic
1072448182 10:95517549-95517571 TGTGAGGTTGTGGGGAAAACAGG - Intronic
1073355922 10:102854104-102854126 ATTGATATCCTGAGGAAAACAGG - Intergenic
1073808430 10:107125633-107125655 GGTGAAATAAGGGGGAAAACAGG + Intronic
1073852326 10:107635217-107635239 AGTGATATGAGAGGGAAAACAGG - Intergenic
1076194946 10:128511080-128511102 TGTGTTCTAATGGGTAAAACAGG + Intergenic
1077720551 11:4624329-4624351 TGTGGTTTCACGAGGAAAACAGG + Intergenic
1078436675 11:11331144-11331166 TGTGTTTCCATGGGGACAACAGG + Intronic
1078786100 11:14495007-14495029 TAAGATATCATCTGGAAAACTGG + Intronic
1079498587 11:21075379-21075401 TGTGATATTATAGTAAAAACAGG - Intronic
1079852740 11:25557846-25557868 TGTGGACTCAAGGGGAAAACTGG - Intergenic
1080032264 11:27674249-27674271 TGTGCACTCATGGAGAAAACTGG + Exonic
1081659857 11:44881399-44881421 TGTAATATCATGACGAGAACAGG + Intronic
1082229994 11:49752039-49752061 TGTGATAGCATGGATGAAACTGG - Intergenic
1082666167 11:55978857-55978879 TGTGATTTCACCTGGAAAACAGG + Intergenic
1083502325 11:63121571-63121593 TGTGATATCATTGGGTATGCAGG - Intronic
1086585801 11:88449686-88449708 TTTAATATCATGGATAAAACAGG + Intergenic
1086993893 11:93334691-93334713 TCTGATATCATGGTTATAACCGG + Intronic
1087280812 11:96207964-96207986 TGTGTTAGTATGGAGAAAACAGG - Intronic
1088408568 11:109508118-109508140 TTTGATATCAAGGGGAAAAGTGG - Intergenic
1088536152 11:110863893-110863915 TGTGATATTATTTGGAAAAAGGG - Intergenic
1089185679 11:116613225-116613247 TGAGAGATGAGGGGGAAAACTGG - Intergenic
1090784005 11:130032445-130032467 TGTGAAAGCATGGAGAAGACTGG - Intergenic
1091665005 12:2412389-2412411 TTTGAGATCATGGGGATAAGGGG + Intronic
1097063187 12:56300805-56300827 GGTGACATCATGTGGACAACAGG + Intronic
1099323657 12:81183148-81183170 TGTGCTAACACGGGGAAAAGTGG - Intronic
1101428167 12:104604783-104604805 TGATATATAATGGTGAAAACAGG + Intronic
1101969189 12:109300953-109300975 TGTGACACCATGGGGATACCTGG - Intronic
1102047785 12:109840601-109840623 TGTGATTTCATGGGGAACCTGGG - Intergenic
1102724703 12:115050946-115050968 GGTGAGATCATGGAGAAAAATGG - Intergenic
1103676598 12:122660854-122660876 TGTGATTTCACTGGGAAAAAAGG - Intergenic
1106507531 13:30384303-30384325 GATGACATCATGGGGAAAGCTGG + Intergenic
1109730675 13:66409401-66409423 TGTGTTTTCATAGGGAAAAAAGG - Intronic
1109817683 13:67607427-67607449 TGTGAGAACATGGATAAAACTGG + Intergenic
1109887572 13:68561814-68561836 TCTGGCATCATGAGGAAAACAGG - Intergenic
1112624653 13:101090479-101090501 TGTGTCATCATGGTGAACACAGG + Intronic
1113405736 13:110037942-110037964 TGTGACAACATGGGTAAACCTGG - Intergenic
1114338925 14:21722841-21722863 TGTATTATGATGGGGAAAAGGGG - Intergenic
1114475614 14:22992522-22992544 GGTGCTATTATGGGCAAAACTGG - Intronic
1116865467 14:50028278-50028300 TTTAATATTAAGGGGAAAACAGG - Intergenic
1119005401 14:70922418-70922440 TTTTATAGCATGGAGAAAACCGG + Intronic
1119005454 14:70923275-70923297 TTTTATAGCATGGAGAAAACTGG - Intronic
1119257064 14:73208035-73208057 TGTGTTAACCTGGGGAACACAGG + Intronic
1120344484 14:83268177-83268199 TGTGACAACATGGATAAAACTGG + Intergenic
1121878574 14:97478294-97478316 TGTGAGATCATTGTGAAGACTGG - Intergenic
1122592306 14:102863183-102863205 TGTGATATTTTGTTGAAAACTGG + Intronic
1122737576 14:103852061-103852083 TGTTAAAAAATGGGGAAAACTGG - Intergenic
1127146322 15:56027949-56027971 AGGGATATAATGGAGAAAACAGG - Intergenic
1127833146 15:62768511-62768533 TGTGATCTCATGTGGAAAAAGGG - Intronic
1128281514 15:66398422-66398444 GGTGATATCAAGGGAAAAAAAGG + Intronic
1128884398 15:71273236-71273258 TGTGACAACATGGGTAAACCTGG + Intronic
1128967513 15:72074502-72074524 TCTGAGATCATGGTGAACACAGG + Intronic
1129326706 15:74803654-74803676 TGTGACATCGTGGGTGAAACTGG - Intergenic
1133407482 16:5536771-5536793 TGTAATATGTGGGGGAAAACAGG + Intergenic
1133670802 16:8017693-8017715 GGTGTTAACTTGGGGAAAACTGG + Intergenic
1134634109 16:15779236-15779258 GGTGAGGTCATGGGGAAAAGGGG - Intronic
1134801550 16:17089551-17089573 TGTGGTATCTTGGGAAGAACAGG - Intergenic
1136871395 16:33811072-33811094 TCTCACATCATGGGGGAAACGGG + Intergenic
1138199986 16:55081498-55081520 TGTCACATCATGGGGAGAGCAGG + Intergenic
1140121791 16:72090014-72090036 TGTGTTAGCTTGGGGAAAAAAGG - Intronic
1140984353 16:80143529-80143551 AGTGATATCAGGGAGAAAAAGGG - Intergenic
1203100777 16_KI270728v1_random:1304986-1305008 TCTCACATCATGGGGGAAACGGG - Intergenic
1143409466 17:6699974-6699996 TGTGATTTTGTGGGGAAAATAGG - Intronic
1146130645 17:30271421-30271443 AGTACGATCATGGGGAAAACTGG + Intronic
1149665360 17:58361293-58361315 TTTGCTATAATGGGGAAGACGGG - Intronic
1149703994 17:58678669-58678691 TGTCATAGGATGGGGGAAACGGG + Intronic
1149721215 17:58846416-58846438 TGTCATAGGATGGGGGAAACGGG - Intronic
1150305390 17:64080456-64080478 TGTCATATCATGGAGAAAAAAGG - Intronic
1150527726 17:65940582-65940604 TGTGATAACATGGATAAACCTGG + Intronic
1150540972 17:66098887-66098909 AGTGGTAGCATGGGGAAAAAAGG + Intronic
1150868920 17:68883007-68883029 TATGTTTTCATGGGGAAAATGGG + Intronic
1152824320 17:82454609-82454631 TATGAGACAATGGGGAAAACTGG + Intergenic
1152848345 17:82616297-82616319 TGTGATTTCCTGGGGGAAACTGG + Intronic
1153513981 18:5888095-5888117 TGTTACTTCAAGGGGAAAACAGG - Exonic
1153700080 18:7683923-7683945 GCTGATATCAGGGAGAAAACAGG - Intronic
1157638523 18:49187251-49187273 TGCAATCTCATGGGGAAAATGGG + Intronic
1157889285 18:51399608-51399630 TGTGTTATAATTGGGAAAGCAGG + Intergenic
1158810815 18:61031897-61031919 AGTAATTTCATGGAGAAAACAGG + Intergenic
1159291299 18:66425036-66425058 TGTGACATCATGGGTAAATCTGG + Intergenic
1160144769 18:76354755-76354777 TGTGATATAATGGGGTAATTAGG - Intergenic
1161227713 19:3154824-3154846 TGGGAAATCATGGGGAAGTCTGG + Intronic
1163723540 19:18909913-18909935 TATGATATCATTTGGAAAAAGGG - Intronic
1166236617 19:41461598-41461620 TCTAATATCAAGGGGAAAAGAGG - Intergenic
1166686249 19:44798140-44798162 AGTGTTTTCATGGGGAAAATGGG + Intronic
1168012835 19:53547330-53547352 TGTGACAACATGGGTAAATCTGG - Intronic
1168027617 19:53654406-53654428 TGTGGTTCCATGAGGAAAACAGG - Intergenic
925274332 2:2638127-2638149 TTTTATATGATGGGGAAAAAAGG + Intergenic
925471973 2:4172754-4172776 TGGGGTTTCATGAGGAAAACGGG + Intergenic
931424682 2:62159886-62159908 GATGTTACCATGGGGAAAACTGG + Intergenic
931827874 2:66020042-66020064 TGTGATCTCATTTGGAAAAAGGG - Intergenic
931991115 2:67791435-67791457 TGTGATACAATGGGGAAGAGTGG - Intergenic
932584888 2:73021562-73021584 TGTGATGTCATTGTGTAAACTGG - Intronic
932893527 2:75616439-75616461 TGTGTCCTCATTGGGAAAACAGG - Intergenic
933986600 2:87596972-87596994 TGTGAAATGATGGGGCAAAGAGG - Intergenic
934057485 2:88263840-88263862 TGTGATCTTATGTGGAAAAAGGG - Intergenic
934917606 2:98312568-98312590 TGTGAGTGCAGGGGGAAAACAGG - Exonic
936307237 2:111353829-111353851 TGTGAAATGATGGGGCAAAGAGG + Intergenic
937373047 2:121315745-121315767 CTTGATATCAGGTGGAAAACGGG - Intergenic
939121458 2:138122785-138122807 TGTGATATAATACAGAAAACAGG + Intergenic
940199857 2:151138541-151138563 TGTAATACCATGGGGCACACAGG + Intergenic
940358619 2:152772603-152772625 TGTAATATGAAGGGGAAAACAGG + Intergenic
942234573 2:173891472-173891494 TGTTATGTCTTTGGGAAAACTGG - Intergenic
942361019 2:175171472-175171494 TGTGGCATTATGGGGAAAAAGGG + Intergenic
942832751 2:180256022-180256044 TGTGATTTCATGGGCAATACAGG + Intergenic
943021579 2:182580868-182580890 TGTGGAATAATGGGGAAAAAGGG - Intergenic
943342464 2:186696872-186696894 TGTTCTATCAAGGGAAAAACAGG - Intronic
943618031 2:190116125-190116147 TGTGATATCACAGGAAAAAAGGG + Intronic
945026539 2:205624909-205624931 TGTGACATCATAGGTAAACCTGG + Intergenic
945180978 2:207090859-207090881 TGTTATCTCAAGGGGAAATCTGG + Intronic
946060564 2:216937399-216937421 TGTGAGATCATAGGGAACAGTGG + Intergenic
946999408 2:225436578-225436600 TGTGACCTCATGGGGAAATAAGG - Intronic
1169099604 20:2935288-2935310 TGTGATAACATGGATAAACCTGG - Intronic
1170208935 20:13828716-13828738 TGTGAGTTCCTGAGGAAAACAGG + Intergenic
1171277617 20:23871449-23871471 TGTGAGCTCCTGGGGAAAAGAGG - Intergenic
1175187151 20:57186507-57186529 TGTGCTGTCATGAGTAAAACAGG - Intronic
1177702923 21:24661999-24662021 TGTGAAATCTTCGTGAAAACGGG + Intergenic
1177815377 21:25970775-25970797 AGTGATATCATCGGTAGAACAGG + Intronic
1178346474 21:31832866-31832888 TGTGCTATCCTGAGGAAAATGGG - Intergenic
1178935421 21:36857720-36857742 TGGGCTTTTATGGGGAAAACAGG - Intronic
1179578766 21:42324755-42324777 TTTGATATCAATGGGGAAACAGG + Intergenic
1183148230 22:36015571-36015593 TGTGATTTCAAAGTGAAAACTGG - Intronic
1184135006 22:42542959-42542981 TGGCATATAATGGGGAAAAATGG - Intergenic
950051477 3:9993864-9993886 TGTGATTGCATGAGGAAACCGGG + Intronic
951473950 3:23084669-23084691 TGAGATAAAGTGGGGAAAACAGG + Intergenic
952152736 3:30610068-30610090 TCTGATATCATTGCAAAAACTGG + Intronic
955028492 3:55193153-55193175 TTTAATATCAAGAGGAAAACTGG - Intergenic
955540759 3:59973548-59973570 TAGGATATCTTAGGGAAAACTGG - Intronic
955950147 3:64235652-64235674 TGTGATATCAATAGGAAAACTGG - Intronic
957648036 3:82960035-82960057 TGTGACAACATGGGCAAACCTGG + Intergenic
959321279 3:104878446-104878468 TGTATTATCATGGCTAAAACTGG + Intergenic
959377522 3:105604194-105604216 TCAGATATCTTGGGGACAACTGG - Intergenic
960576713 3:119237293-119237315 TCTGAGATCATGGGTATAACAGG + Intronic
961654674 3:128434686-128434708 AGTTATGTCATGGGGAAACCTGG + Intergenic
962037869 3:131672120-131672142 TGTGACAACATGGATAAAACTGG - Intronic
962682546 3:137815245-137815267 TGTGACATTATGAGGAAAATTGG - Intergenic
962779104 3:138694430-138694452 GGTGAAGTCATGAGGAAAACAGG - Intronic
963259235 3:143176600-143176622 TGTGAAATCAAGGAGAAAACCGG + Intergenic
964107226 3:153052293-153052315 TGTGCTACCTTTGGGAAAACTGG - Intergenic
964225693 3:154398613-154398635 TATAATATCATGGGGAAATGAGG + Intronic
964894562 3:161579742-161579764 TGAGATTTTATGGGGAAAGCTGG + Intergenic
965317113 3:167206279-167206301 TGTGATAACATGGATGAAACTGG - Intergenic
965633073 3:170752963-170752985 TCTGATTTCATCAGGAAAACAGG + Intronic
966364015 3:179162814-179162836 TGTAATTTAATGAGGAAAACTGG - Intronic
966737476 3:183199549-183199571 TGTGAAAGCATGGAAAAAACTGG + Intronic
966854534 3:184185170-184185192 AGTGACTTCATGGGGACAACAGG - Intronic
968251133 3:197215275-197215297 TTATATATCATGGGGAAAATGGG + Intronic
970506365 4:16734635-16734657 TGAGAAATCATGGGCAAGACAGG - Intronic
972880711 4:43418501-43418523 TGTTAGATCTTGAGGAAAACCGG + Intergenic
973856885 4:55020343-55020365 TGTGAAACCAAGGGGAGAACTGG - Intergenic
975332107 4:73128261-73128283 TGTGATATAGTGGGGAGAGCAGG - Intronic
976201565 4:82584672-82584694 TTTGGTATCATGGGTAATACTGG + Intergenic
977117286 4:93046214-93046236 TGTAATATCATGAGGGAAAGAGG - Intronic
977139140 4:93344919-93344941 TTTGATAACATGGATAAAACTGG - Intronic
978057322 4:104287543-104287565 TGTGACAGCATGGATAAAACTGG - Intergenic
978111534 4:104969561-104969583 TGTGAAATCATGGGGGAACAGGG + Intergenic
978510956 4:109517317-109517339 TGTGATACCATGGATAAACCTGG + Intronic
979048104 4:115895463-115895485 TGTGCTATTATGGTGAAAAATGG + Intergenic
979149348 4:117289345-117289367 TATGATATAATGTAGAAAACTGG + Intergenic
980792961 4:137643356-137643378 TGTGCTTCTATGGGGAAAACTGG - Intergenic
981012130 4:139936161-139936183 TGTGACAACATGGGGGAAGCAGG - Intronic
981773498 4:148337110-148337132 TGTAATATTATGGAGAAAAAAGG + Intronic
982144274 4:152365689-152365711 TGAGATATCTTGGAGATAACTGG + Intronic
982583943 4:157213324-157213346 TTTGACAGCATTGGGAAAACTGG - Intronic
984391768 4:179143107-179143129 AGTGATATGATGGAGAAAATTGG + Intergenic
984869123 4:184311255-184311277 TGTGTCATAATGAGGAAAACTGG - Intergenic
985468336 5:19561-19583 TGCTAAATCATGGAGAAAACGGG - Intergenic
986423984 5:7612513-7612535 TCTGATCTCATGGGGAGCACTGG + Intronic
989408766 5:41093004-41093026 TGGGACAACATGGGGAAAGCTGG - Intergenic
990363291 5:55043369-55043391 TGTGATCTCAGAGGGGAAACTGG - Intergenic
990682048 5:58255866-58255888 AGGGATATCATGGGGAGAATAGG - Intergenic
991451752 5:66758718-66758740 TTTGTTTTCATGGGGAAAAGAGG - Intronic
991592890 5:68273010-68273032 TGTGGTATTATGGGGAGAGCTGG + Intronic
991706132 5:69360612-69360634 AATGAAATCATGGGGGAAACAGG + Intronic
994611151 5:102041758-102041780 TGTGACACCATGGGTAAACCTGG + Intergenic
995755556 5:115499955-115499977 TGTGACAACATGGGTAAACCTGG - Intergenic
996989921 5:129616546-129616568 TGTGATATCCTGCGGAAAGCTGG - Intronic
997774456 5:136588295-136588317 TGTGGCAACATGGAGAAAACTGG + Intergenic
998558659 5:143150306-143150328 TGTGAACTCTTGGGGAAGACAGG - Intronic
1000567308 5:162865716-162865738 TCTCAAATCATGGGGAAACCAGG + Intergenic
1003699730 6:8448512-8448534 TGTGATATCATATGGCAAAAGGG - Intergenic
1003907001 6:10710737-10710759 GATGTTATCATTGGGAAAACCGG - Intergenic
1006187297 6:32188722-32188744 TGTGAAATCAAGGAGAAAACTGG - Exonic
1007590746 6:43019345-43019367 CCTGATATCATGAGGCAAACAGG - Exonic
1009047866 6:58250139-58250161 TGTAATATCTTGGGGAAGAGAGG + Intergenic
1009223665 6:61004434-61004456 TGTAATATCTTGGGGAAGAGAGG + Intergenic
1009365416 6:62854034-62854056 TCTAATATCAAGGGGAAAAGAGG + Intergenic
1012213362 6:96551883-96551905 TGTGATATTATGGTGAAAAGGGG + Exonic
1012314932 6:97774254-97774276 TGTGATATCAATGTGAAAAGTGG - Intergenic
1013922819 6:115429351-115429373 TGTGACAACATGGGTGAAACTGG + Intergenic
1014997551 6:128168923-128168945 TGTGACATCGTGGGTAAACCTGG + Intronic
1016658860 6:146552271-146552293 TTTGATATAATGGGGATAGCTGG + Intronic
1016754141 6:147665312-147665334 TTTAATAATATGGGGAAAACAGG + Intronic
1016930740 6:149405593-149405615 TGTGATAACATGGGTGAACCTGG + Intronic
1017829155 6:158109395-158109417 TGTGATAACATGGGGAGAAGGGG - Intergenic
1019029884 6:169000869-169000891 TGAGACCCCATGGGGAAAACAGG + Intergenic
1021544907 7:21802731-21802753 TGTGATATCATGTGATACACAGG + Intronic
1021940398 7:25673327-25673349 TACAATATCATGTGGAAAACTGG - Intergenic
1022056236 7:26737727-26737749 TGTTTTATTCTGGGGAAAACAGG - Intronic
1022063651 7:26827658-26827680 TGTGATGTCTTGGGAAAAACTGG - Intronic
1022164744 7:27747120-27747142 TCTGTAATAATGGGGAAAACTGG - Intronic
1024614158 7:51094073-51094095 TGTGACATCATGGGTGGAACTGG + Intronic
1028975845 7:96913269-96913291 TGGGGTATCATGTGGTAAACGGG - Intergenic
1031502481 7:122536682-122536704 TGGGATGTCAAGGGGAAAAGAGG + Intronic
1031559763 7:123224522-123224544 TGTGATAACATGGACACAACTGG - Intergenic
1032961946 7:137045793-137045815 GATGATATCATTTGGAAAACGGG + Intergenic
1033233877 7:139623087-139623109 TTTGATATCACGGGTAAAATGGG - Intronic
1033936375 7:146590748-146590770 CGTGATTGCATGGGGAAACCTGG - Intronic
1034819993 7:154208043-154208065 TGTGATATGATAAAGAAAACAGG + Intronic
1035613820 8:987816-987838 TGTCATATGTTGGGGGAAACTGG - Intergenic
1036051351 8:5202074-5202096 TGTGATCTCATTTGGAAAAAGGG + Intergenic
1036579105 8:10055895-10055917 GGTGAAATGATGGGGAAACCAGG - Intronic
1036604950 8:10296557-10296579 CGTGATGACATGGGGAAAATTGG - Intronic
1036915870 8:12803205-12803227 TAGGATTTCAGGGGGAAAACTGG - Intergenic
1036933978 8:12982932-12982954 TGTGCTCGCATGGGGAAATCTGG - Intronic
1040089695 8:43385123-43385145 TGGGATTTCATGAGGAAAACAGG + Intergenic
1042031602 8:64482127-64482149 TGTAATATCATTGGCAAAATTGG - Intergenic
1042522422 8:69727652-69727674 TGTGCTATGATGGTGAAAACCGG - Intronic
1042817213 8:72890674-72890696 AGTGATTTCATCTGGAAAACGGG - Intronic
1043730033 8:83665866-83665888 TGTGTTATCTTGGTGAAAATGGG + Intergenic
1043921874 8:85992276-85992298 CCAGATATCATGGGAAAAACAGG - Intronic
1044643483 8:94412169-94412191 TGTGACAACATGGGTAAACCCGG - Intronic
1044831065 8:96249743-96249765 TGTGATATTATGGGGAACTGAGG + Intronic
1044875027 8:96656929-96656951 TCTGACCTCATGGGGAATACTGG - Intronic
1045656903 8:104396580-104396602 TGTAATATCAATGGAAAAACTGG + Intronic
1046907994 8:119594907-119594929 TGTTATTTCATTGGGAAATCAGG + Intronic
1047236848 8:123049124-123049146 TGTGATATAATGAGAAAAAAAGG + Intronic
1047581565 8:126222099-126222121 TGGGATTCCATGAGGAAAACAGG + Intergenic
1048715594 8:137265227-137265249 AGTGATAGCATAGGGAAAATGGG + Intergenic
1048746867 8:137624322-137624344 TGTGATCTCATTTGGAAAAGGGG - Intergenic
1056425709 9:86474353-86474375 TGTGATAACATGGGTGAATCTGG + Intergenic
1058656417 9:107225765-107225787 TGTGAAAGTATGGGGAAAATAGG - Intergenic
1059550938 9:115228170-115228192 TGTCCTATTAAGGGGAAAACTGG - Intronic
1060701075 9:125748602-125748624 TGTGAGATCAAAGAGAAAACAGG + Exonic
1061830611 9:133291394-133291416 TGGGGTTTCATGAGGAAAACAGG + Intergenic
1061925176 9:133802730-133802752 GGTGATACCATGAGGAAAATGGG - Intronic
1186823465 X:13314639-13314661 GGTGAAATCATGGGAACAACAGG - Intergenic
1186824742 X:13328400-13328422 AGTGAAATCATGGGAACAACAGG - Intergenic
1187204473 X:17169263-17169285 TGATATATCCAGGGGAAAACTGG + Intergenic
1188997436 X:36903464-36903486 TGTGATAGCATGGATGAAACTGG - Intergenic
1189744067 X:44151750-44151772 TGTTATATCATAAGGAAAGCAGG + Intronic
1189984678 X:46543752-46543774 TGTGATACCATCAGGACAACAGG + Intronic
1190005686 X:46735595-46735617 AGTGATATAATTTGGAAAACTGG - Intronic
1190722904 X:53165278-53165300 TGGGGTTTCATGAGGAAAACAGG - Intergenic
1192777154 X:74256962-74256984 TGGGGTTTCATGAGGAAAACAGG - Intergenic
1195677378 X:107517382-107517404 TGAGATTTCTTGGGGAAAATGGG + Intergenic
1195857025 X:109342708-109342730 TGTGCTGTCATTGGGAACACTGG - Intergenic
1196569275 X:117246868-117246890 TGTGATATGATGGGAATAAAAGG - Intergenic
1196642730 X:118081875-118081897 TGTAGTATCATGGATAAAACTGG - Intronic
1196771371 X:119297759-119297781 TGTGACAACATGGGTAAAACTGG - Intergenic
1197838034 X:130715976-130715998 TCTGATATCTTATGGAAAACAGG + Intronic
1200273448 X:154709788-154709810 TGTGACAACATGGGTAAACCAGG + Intronic
1200389386 X:155928683-155928705 TGTGATATTATCTGGAAAAGGGG - Intronic
1201570900 Y:15413216-15413238 TGTGAGAACATGTGGAAAAAGGG + Intergenic