ID: 907747519

View in Genome Browser
Species Human (GRCh38)
Location 1:57228064-57228086
Sequence TAGAGGAAAAGGTTAATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907747519_907747522 4 Left 907747519 1:57228064-57228086 CCATACATTAACCTTTTCCTCTA 0: 1
1: 0
2: 1
3: 23
4: 249
Right 907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG 0: 1
1: 0
2: 0
3: 5
4: 83
907747519_907747523 5 Left 907747519 1:57228064-57228086 CCATACATTAACCTTTTCCTCTA 0: 1
1: 0
2: 1
3: 23
4: 249
Right 907747523 1:57228092-57228114 AGACTGAAGTGCCTATAATAGGG No data
907747519_907747524 10 Left 907747519 1:57228064-57228086 CCATACATTAACCTTTTCCTCTA 0: 1
1: 0
2: 1
3: 23
4: 249
Right 907747524 1:57228097-57228119 GAAGTGCCTATAATAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907747519 Original CRISPR TAGAGGAAAAGGTTAATGTA TGG (reversed) Intronic
902254551 1:15179292-15179314 TAGAGGAAATGCATAATGTCAGG - Intronic
902420854 1:16278625-16278647 TAGTGGAAAAGCTTAATCTTAGG - Intronic
907747519 1:57228064-57228086 TAGAGGAAAAGGTTAATGTATGG - Intronic
909512673 1:76472609-76472631 TAGAGGAAAAGATTGAGGCAGGG - Intronic
911540703 1:99154846-99154868 TATAGGAAAAGTCTAATGTGTGG + Intergenic
911660713 1:100498597-100498619 TAAAGGAAAAGGGCCATGTAAGG - Intronic
911959733 1:104286013-104286035 TAGAGGAGAAGGGTAGAGTATGG - Intergenic
911978491 1:104534564-104534586 AAGAGGAAAAGGAAAATGGAAGG + Intergenic
912755618 1:112322316-112322338 TAGAGGAAAAGGGGATTGAAAGG + Intergenic
913041824 1:115034375-115034397 TAGAAGAAAAGGTGAATGAATGG + Intergenic
914511117 1:148332919-148332941 GAGAGGAAAATGTTAAGGGAAGG - Intergenic
918607719 1:186449034-186449056 TAGACCAAAAGGTTAATAAATGG - Intronic
919592010 1:199515951-199515973 TGTAGGAAAAGGGTAATTTAAGG + Intergenic
920409866 1:205750495-205750517 TAGAAAAAAAGATTTATGTAGGG + Intergenic
920802021 1:209198055-209198077 TAGAGCAAAATGGTTATGTATGG - Intergenic
922248670 1:223826194-223826216 AAGAGGAAAGGGTTAATTCAAGG + Intronic
922300335 1:224293593-224293615 TAGTGCAATAGGTTAAAGTATGG + Intronic
923811889 1:237327454-237327476 TAGATCAAAATGTTAAAGTAAGG - Intronic
924183729 1:241465323-241465345 AAGAGAAAAAGGTAATTGTATGG - Intergenic
1064490332 10:15849193-15849215 GAGAGGCAAAGGTGAATGAATGG + Intronic
1065154045 10:22851641-22851663 TGGAGGAGAAGGGTAAAGTATGG + Intergenic
1066153681 10:32651664-32651686 TGGAGGAAAAGTTTATTGCAGGG + Intronic
1066225423 10:33378264-33378286 TAGAGCTAAAGGTTTATGAAAGG + Intergenic
1067163742 10:43848550-43848572 TAGATGAATAGGTTAGTGAATGG - Intergenic
1068608562 10:59033490-59033512 TAGAGGAAGAGTTTAATGTGTGG + Intergenic
1069963852 10:72097190-72097212 TAGAGGCAATGGTGAATCTATGG + Exonic
1070107388 10:73447528-73447550 TTGAGGAGAAGGTTAAGGAAAGG + Intronic
1071448915 10:85776162-85776184 TGGAGGAAATGGTTGGTGTAAGG + Intronic
1071795157 10:88996957-88996979 TAGAGGAAATGGGTAATGTAAGG - Intronic
1072205751 10:93204059-93204081 TAGAAGAAAATGTTAATGCATGG - Intergenic
1072568711 10:96640150-96640172 CAGAAGAAAAGTTCAATGTAGGG + Intronic
1073393612 10:103199970-103199992 TAGAGAAACAGTTTAACGTAGGG - Intergenic
1074968785 10:118518429-118518451 CAGAGGAAAAGGTCAAAGTGGGG - Intergenic
1076430718 10:130399972-130399994 TAAAGGCAGAGGTAAATGTAAGG + Intergenic
1077311932 11:1892689-1892711 TAGATGAATAGATTAATGGATGG + Intergenic
1077346486 11:2059417-2059439 TAGAGAAAAAGAATAGTGTATGG - Intergenic
1077353195 11:2102436-2102458 TAGAGGAAAGGATGAATGGATGG + Intergenic
1078651247 11:13195413-13195435 TAAAGGAAAAGATTAATAGATGG + Intergenic
1079437938 11:20476578-20476600 TAAAGGAAAAGCTTGAAGTATGG + Intronic
1080752461 11:35163559-35163581 AAGAGGAAAAGCTTGATGAATGG - Intronic
1082651695 11:55801912-55801934 TTGAAGAAAAGGATAATGTAAGG + Intergenic
1085615100 11:77991686-77991708 TAGAGCAAAATGTTAGTGTAAGG - Intronic
1086863214 11:91949481-91949503 TAGAGCAAAAGGTTTACATAAGG + Intergenic
1087952870 11:104245956-104245978 TAAAGGAAAAGCTTAATGTTAGG - Intergenic
1088616378 11:111633660-111633682 TAGAAGAAAAAGTAATTGTATGG - Intronic
1088640478 11:111868290-111868312 TGGAGGAAAAGTACAATGTACGG - Intronic
1088714354 11:112535854-112535876 TGGAGGAAAAGGGACATGTAGGG + Intergenic
1088759010 11:112911925-112911947 TAGAAGAAAAGCTGAATGAAGGG - Intergenic
1089967413 11:122664810-122664832 CGGAGGAAAAGGTAAATGTCAGG + Intronic
1092559285 12:9593422-9593444 AGGAGGAAAAGGTCAATGTTTGG + Intergenic
1092658865 12:10717510-10717532 TAGAGGAAATGGGTAAGATATGG - Intronic
1093161828 12:15755792-15755814 CAGAGTAAAGAGTTAATGTAGGG - Intronic
1094246721 12:28305537-28305559 TAGAGGAAAAGAAAAAAGTAAGG - Intronic
1096776013 12:53964729-53964751 TAGAGGAAAAGGAGACAGTAGGG + Intergenic
1098737058 12:74118469-74118491 GAGAGGAAAGAGTTAAGGTAAGG + Intergenic
1099082145 12:78198005-78198027 TAAAAGGAAAGGTTAAAGTAAGG + Intronic
1101168682 12:102065163-102065185 TAGAGGAAAAGATGAATGAAGGG - Intergenic
1102764011 12:115415309-115415331 TACAGGAAAAGGGAAATGCAGGG - Intergenic
1102850189 12:116235180-116235202 TAGTTGAAAAAGGTAATGTATGG - Intronic
1105384837 13:19920160-19920182 TACTTGAAAAGGTTAATTTAGGG - Intergenic
1105982067 13:25527552-25527574 TCCAGGAAAAGGTTATTGTGTGG - Intronic
1108613210 13:52104411-52104433 GGGAGAAAAAGGTTAATGTTTGG - Intronic
1109080279 13:57890969-57890991 AAAAGGAAAATTTTAATGTAGGG - Intergenic
1111372868 13:87339577-87339599 TAAAGGAACAGGATAACGTATGG + Intergenic
1111840372 13:93442118-93442140 CAAAGGGAAAGGTTAATGGAGGG + Intronic
1112718460 13:102214095-102214117 TAAAGGAAAAGGTTAGGCTAAGG - Intronic
1114535389 14:23419171-23419193 TGGAGGAGGAGGTTAAGGTAAGG - Exonic
1115014139 14:28589367-28589389 TATAAGAAAAGTTTAATGTGTGG - Intergenic
1115864546 14:37729857-37729879 TATAGGAAAGTGTGAATGTAGGG + Intronic
1116233778 14:42252228-42252250 TAGAAGAAAAGGGCAATGGAAGG + Intergenic
1116259967 14:42612603-42612625 TATAGGAAAAGGGTATTATAAGG + Intergenic
1116753230 14:48912966-48912988 CAGAGGTAAAGATTAATGTGAGG - Intergenic
1118119434 14:62822196-62822218 TAAATGTAAAGGTTAATTTAGGG - Intronic
1118488924 14:66240470-66240492 TAGAGAAAAAGTTTAATGGATGG - Intergenic
1118924742 14:70181845-70181867 AAGAGGAAAAGGTTGAAGTTGGG + Intronic
1119356678 14:74013011-74013033 TAGAGCAGAGGGTTATTGTATGG - Intronic
1119585387 14:75829678-75829700 CAGAGGAAGAGTTTAAGGTAGGG + Intronic
1120413583 14:84191450-84191472 TAGAGGCAAAGATTAAAGTAAGG - Intergenic
1121206224 14:92170526-92170548 AAAAGGAAAGGGTTATTGTAAGG - Exonic
1123150037 14:106171801-106171823 TAGAGGAAAGAGTAAATGTAAGG + Intergenic
1126593210 15:50360149-50360171 TACAGGAAACGTTTAATATATGG - Intergenic
1127777268 15:62274681-62274703 TAGAGGAAAAGGCAAAGGAAAGG + Intergenic
1131423121 15:92324074-92324096 TAGAGGAAGGGATTCATGTATGG - Intergenic
1131708505 15:95025252-95025274 TTGAAGAAAAGCTTAATGAAAGG + Intergenic
1131821585 15:96279432-96279454 TTGAGGATAAGGATCATGTAGGG + Intergenic
1135012814 16:18898002-18898024 TAGAGGAATAGCTTAGTGTCTGG - Intronic
1135319734 16:21485596-21485618 TAGAGGAATAGGTTAGTTTCTGG - Intergenic
1135372570 16:21917083-21917105 TAGAGGAATAGGTTAGTTTCTGG - Intergenic
1135439215 16:22453619-22453641 TAGAGGAATAGGTTAGTTTCTGG + Intergenic
1136329962 16:29567297-29567319 TAGAGGAATAGGTTAGTTTCTGG - Intergenic
1136444592 16:30307001-30307023 TAGAGGAATAGGTTAGTTTCTGG - Intergenic
1136680016 16:31954989-31955011 CAGAGGAAAGAGTAAATGTAAGG - Intergenic
1136780360 16:32896533-32896555 CAGAGGAAAGAGTAAATGTAAGG - Intergenic
1136890048 16:33963111-33963133 CAGAGGAAAGAGTAAATGTAAGG + Intergenic
1138876978 16:60964036-60964058 TAGAGGAGAAGAGTAATGAATGG + Intergenic
1203082985 16_KI270728v1_random:1160503-1160525 CAGAGGAAAGAGTAAATGTAAGG - Intergenic
1147860788 17:43521674-43521696 TGGAGGAAAAGGGTTATGTGAGG - Intronic
1149791766 17:59483994-59484016 AAGAGGAAATGGTTGATCTAGGG + Intergenic
1150291371 17:63984317-63984339 TAGAGGAAAAGGGTCAGGTTTGG - Intergenic
1152034086 17:77861347-77861369 TGGATGAACAGGTTAATGAATGG + Intergenic
1153189406 18:2521167-2521189 TAAAGTTGAAGGTTAATGTAGGG - Intergenic
1153318314 18:3746443-3746465 TAAAGAGAAAGGTTAATGAATGG + Intronic
1153345720 18:4023895-4023917 TAGTAGAAAAGGTTTATATATGG + Intronic
1155805180 18:30161325-30161347 TAAATGAAGAGATTAATGTAGGG - Intergenic
1156182304 18:34619656-34619678 TGTGGGAAAAGGTTCATGTATGG + Intronic
1156612596 18:38742949-38742971 GAGATGAAAAGTTTATTGTATGG + Intergenic
1156675151 18:39519119-39519141 TAGAGAAAAAGGTTGATATCGGG + Intergenic
1157312756 18:46564590-46564612 TAGAGGAAAAATCTAAAGTAAGG + Intronic
1157986900 18:52448414-52448436 TAGAGTAGAATGTTAATGAAAGG + Intronic
1158089598 18:53694942-53694964 TTGATGAAAATGTTACTGTATGG + Intergenic
1159039674 18:63312045-63312067 TAGAGGAAAAGGATAGTGTCTGG + Intronic
1159214895 18:65379205-65379227 TAGAGGAAATGGATAATTTCTGG - Intergenic
1159306382 18:66648379-66648401 TAGAGGAAAATATGAATGTCAGG - Intergenic
1160606236 18:80051859-80051881 TAGAGGAAATGGATAATGCCTGG + Intronic
1161498892 19:4602449-4602471 TGGATGAACAGGTGAATGTATGG + Intergenic
925887727 2:8407598-8407620 TAGAGTAAAAGGTGAAGGAAGGG + Intergenic
926383825 2:12316772-12316794 TAAAGGAAGAGTTTAATGGATGG + Intergenic
926727427 2:16009402-16009424 TGGAGGAACAGGTGAATGCATGG - Intergenic
929277749 2:40043937-40043959 ATGAGGAAACGGTTACTGTAAGG - Intergenic
930293588 2:49526804-49526826 TAAAGAAAAAGATTAATGGAAGG + Intergenic
933380172 2:81532878-81532900 TAGAGAAAACAGTCAATGTAAGG + Intergenic
933473681 2:82761702-82761724 TAGAACAAAAGGTTAAGGAAGGG + Intergenic
936434811 2:112495293-112495315 GCCAGGAAAAGGTTAATGTCAGG - Intronic
936581803 2:113706475-113706497 TGGAGGAAAAGTTCAATGGAAGG + Intronic
937038955 2:118806385-118806407 TAAAGTGAAAGGTTCATGTAAGG - Intergenic
937481763 2:122268952-122268974 TAGAGGAAAAGATTAAGGAAGGG + Intergenic
937588464 2:123585464-123585486 TAGAGTAAATGGTTAATGCTAGG + Intergenic
939773332 2:146352414-146352436 TTGGGGAAAGGGTGAATGTATGG - Intergenic
940392149 2:153144716-153144738 AAGAGGAAAATGTTCATGTCTGG + Intergenic
940692894 2:156941477-156941499 TAGTTGAAAAGTTTTATGTAAGG - Intergenic
941245088 2:163086136-163086158 TAGAGAAATAGTTTAATATACGG - Intergenic
943394480 2:187316320-187316342 TAGAGGAAGAGGTGAAAGTGAGG - Intergenic
943415064 2:187591394-187591416 TAGTGCAAAAGGCAAATGTAGGG - Intergenic
944709774 2:202325228-202325250 TTGAGGAAAAGGTCAAAGTTGGG + Intergenic
944957630 2:204830510-204830532 TAGTGAAGAAGATTAATGTATGG + Intronic
945145097 2:206729731-206729753 TAGAGGAAATGGCTAGTGCAAGG + Intergenic
947938488 2:234027474-234027496 GAGAGGAAGAGGTTAAGGGAAGG - Intergenic
1170133398 20:13046877-13046899 TTGAGTAAAAGGTAAATGAAAGG - Intronic
1170391639 20:15881250-15881272 TAGAGAAAGAGTTTAATGCAGGG + Intronic
1171438619 20:25143108-25143130 AAGAGGAAAAGGTTGATCAAGGG - Intergenic
1172430637 20:34888467-34888489 TAGAGTAAAAGGTTTATGCAGGG + Intronic
1173427391 20:42954946-42954968 GAGAGGAGAAGGTTAAGGAAGGG + Intronic
1174986542 20:55460555-55460577 TAGAGGAAAAGGGAAAAATAAGG - Intergenic
1176924172 21:14726600-14726622 TAAAGGAAAATGTTAAGATAGGG + Intergenic
1176997259 21:15570116-15570138 TAGAGGACATGTTTAATGTCAGG + Intergenic
1177953972 21:27573898-27573920 TAGAGGAAGAGGTAGAGGTAGGG + Intergenic
1181903559 22:26174739-26174761 TTGAGGAAAGGGTAAAAGTATGG + Intronic
1185193392 22:49452884-49452906 TAGAGGAACAGGTGCCTGTATGG + Intronic
949505354 3:4722623-4722645 TTGAGGATAAGGTTATTTTATGG - Intronic
953516965 3:43602821-43602843 GAAAGGGAAAGGTTAATGGAGGG - Intronic
956804551 3:72796169-72796191 TAGAGCAAAGAGTTCATGTAAGG + Intronic
957361222 3:79161469-79161491 TAGAGGATAAGTTTACTGCATGG + Intronic
957390165 3:79555005-79555027 TAGAGAAAAATGTTGAGGTAAGG + Intronic
957532494 3:81458502-81458524 TAGACTAATAGGTTAATGGAAGG + Intergenic
957589673 3:82179827-82179849 TAGAGGAACAGATTAATAAATGG + Intergenic
958978575 3:100694714-100694736 TAGAACAAAAGTTTAATGTTGGG - Intronic
959342037 3:105144034-105144056 TAGAGCCAAAGGAAAATGTAAGG + Intergenic
961223472 3:125218512-125218534 TAGAAGAAAAGGTGAATTTAAGG + Intergenic
961939630 3:130623732-130623754 TAGAGGAAAGGGTTTAGGTCTGG + Intronic
964285481 3:155113218-155113240 AAGAGGAAAAGGGGAAGGTAGGG + Intronic
965475518 3:169150255-169150277 TAGAGGAAAAGGATTTTGCAAGG + Intronic
965700846 3:171458557-171458579 TGGAGGAAAAGGTTTAATTAAGG + Intronic
965804244 3:172525960-172525982 TAAAGGTTATGGTTAATGTATGG - Intergenic
966118880 3:176499780-176499802 TGAAGGAAAAGGTTAATGTGAGG - Intergenic
966591369 3:181687023-181687045 TACATGTAAAGGTTAATATAAGG - Intergenic
970035294 4:11727969-11727991 TATAGGCAAAGCTTAATTTATGG + Intergenic
970257725 4:14185943-14185965 TACAGGAAAAGGTTATTTAAAGG + Intergenic
970669792 4:18383132-18383154 AAGTGGGAAAGGTTAATGAATGG + Intergenic
970887638 4:21004939-21004961 GAGAGGAAGAAGTGAATGTAGGG + Intronic
970903046 4:21182388-21182410 AAGAGGAAAAGTTGAAAGTAAGG - Intronic
971651051 4:29274558-29274580 TTTAGGCAAAGGTTAATGTCCGG - Intergenic
971820360 4:31545670-31545692 TAGGGGAAAAGGCTAACATAGGG - Intergenic
973090861 4:46134635-46134657 TAGCAGATAAGGTTACTGTATGG + Intergenic
974771321 4:66417926-66417948 TAGAGCAAAAGGCTTATGAAAGG - Intergenic
974904486 4:68038212-68038234 TAGTTGAAAAGTTTATTGTAAGG - Intergenic
975350218 4:73337936-73337958 GAGAGGAAAAGGAGATTGTAGGG - Intergenic
975398997 4:73912465-73912487 TAGAGTAAAAGTCTAAAGTATGG - Intergenic
975482215 4:74893405-74893427 CAGAGGAAAAGGGAAATGTGGGG + Intergenic
976362610 4:84197404-84197426 CAGAGAAAAATGTAAATGTAAGG + Intergenic
976379074 4:84379026-84379048 TAGGGGAAAGGGTAAATGGAGGG - Intergenic
977167594 4:93720340-93720362 TAGGGGAAGAGATTAATATAAGG - Intronic
978123369 4:105108338-105108360 TAGATAAACAGGTTAATGAATGG + Intergenic
978378496 4:108101158-108101180 TCAAGGAAAGTGTTAATGTAAGG + Intronic
979652287 4:123149370-123149392 GTGAGGAAAAAGTTAATGTCTGG + Intronic
980237972 4:130132689-130132711 TAAAGGCAAAGTTCAATGTAAGG + Intergenic
981588749 4:146333043-146333065 GAGGGGAAAAGGTGAATATATGG + Intronic
982008687 4:151086448-151086470 TAGATGAAAAGGTTAATCTTTGG + Intergenic
982555891 4:156864181-156864203 TGGATAAAAAGGGTAATGTAAGG + Intronic
982731053 4:158956055-158956077 GAGAGGAAGAGTTTAATGCAAGG - Intronic
983008316 4:162513492-162513514 TGGAGGAACAGGTTTATGTGTGG - Intergenic
983324141 4:166231571-166231593 TAGAGGAAAATGATAATTTGTGG - Intergenic
985840637 5:2302568-2302590 TAGAAGAAAATGTAAATGTGGGG - Intergenic
986010465 5:3710038-3710060 TTGAGGAAAATTTTAATGAAAGG + Intergenic
986238575 5:5935807-5935829 TAGTGGAAAATGTTATTTTAAGG + Intergenic
986453045 5:7885242-7885264 TAAAGGAAAAGAGTAAAGTAAGG + Intronic
989326353 5:40200448-40200470 TACAGGAAAAAGTTATTTTAAGG + Intergenic
989683226 5:44054272-44054294 TAGTGGAAAAGGTAGATGGAGGG + Intergenic
990907691 5:60821396-60821418 TAGTGGAAAAGGTTGCTGTTAGG - Intronic
991235934 5:64397466-64397488 TAGAAGTAAAGGTTAAAATAAGG - Intergenic
991451422 5:66754915-66754937 TAGAGGAAATGATAAATGTAAGG + Intronic
992693617 5:79262822-79262844 TAGATAAAAATGTTAATGTTTGG + Intronic
992716617 5:79516780-79516802 TATAACAAAAGGTTAATGAAAGG + Intergenic
993371476 5:87098090-87098112 TAGAGGAAGATGTGAGTGTATGG - Intergenic
993635753 5:90341531-90341553 TAGATCAAAAAGTTCATGTAAGG + Intergenic
993726648 5:91375630-91375652 AAGAGAAAAAGGTCAGTGTATGG + Intronic
993832958 5:92782182-92782204 CAGAAGAAAAGGTTAATGCCTGG - Intergenic
993920947 5:93801232-93801254 TGGAAGAAAAAGTTACTGTATGG + Intronic
994047006 5:95321486-95321508 TAGAGGCACAGGTAAAAGTAGGG + Intergenic
994296627 5:98097264-98097286 TAGAGGTAAGGGTGAATGTAGGG - Intergenic
994807329 5:104466340-104466362 TAGTGGAAAAGGATGATGAAAGG + Intergenic
995681565 5:114726378-114726400 TAGAGGAGAAGTTTATTGCAGGG - Intergenic
997157080 5:131572699-131572721 TAGTGGAGAAGGTAAATTTAAGG - Intronic
998468469 5:142364576-142364598 GAGAGGCAAAGGTTAAGGTAAGG - Intergenic
1001877835 5:175216613-175216635 TAAAGGAAAAAGTTAAAGGAAGG - Intergenic
1005109181 6:22260381-22260403 TAGAGGAAAGGGTGAAAGAATGG + Intergenic
1006081263 6:31568396-31568418 TAGAGGAGAAGTTTTATTTAGGG + Intergenic
1009043289 6:58208135-58208157 TACAGGAAATGGATAATGTCTGG - Intergenic
1009219125 6:60962393-60962415 TACAGGAAATGGATAATGTCTGG - Intergenic
1009268912 6:61593029-61593051 AAGAAAAAAAGGTTAATGTCTGG + Intergenic
1009679144 6:66869681-66869703 GAGAAGAAAATGATAATGTAGGG + Intergenic
1009931024 6:70177877-70177899 TAGAAGATAAGCTTAATTTAGGG - Intronic
1010739287 6:79480943-79480965 TAGAAAAAAAGGTTTATTTAAGG - Intergenic
1011025371 6:82862995-82863017 AAGAGGCAAAGATTAATGCAAGG + Intergenic
1011630584 6:89320147-89320169 GTGAGGAAAAGGTTACTGTGGGG - Intergenic
1015242520 6:131041288-131041310 TATGGGAAAAAGTTAATGTAAGG + Intronic
1015423895 6:133042069-133042091 TAGAGGCAGATGTAAATGTAGGG - Intergenic
1016099176 6:140076200-140076222 TGGAGCAAAATGTAAATGTAAGG + Intergenic
1016492887 6:144627053-144627075 TAGGGCAAAAGGTTACTGAATGG - Intronic
1016923983 6:149322379-149322401 TAAAGGAAAAATTTTATGTATGG - Intronic
1018163254 6:161068684-161068706 TAGAGGAGAAGGTGGATTTAAGG + Intronic
1022057337 7:26751967-26751989 TATAGAAAAATGTTAATGTTAGG + Intronic
1023433619 7:40119611-40119633 TATAGCAAAAGGTTTGTGTATGG + Intergenic
1026946231 7:74317899-74317921 AAGAGGAAAAGGTTCAGGTACGG + Intronic
1027894256 7:84020833-84020855 TAGAGGAAATAGATAATGCAGGG - Intronic
1027932199 7:84552238-84552260 AAAAGGAAAAGGTTCAAGTAAGG - Intergenic
1028424883 7:90675171-90675193 TATAGGAAAGGTTAAATGTATGG - Intronic
1028781756 7:94745332-94745354 AAGAGGAAAAGCTGAATATAGGG - Intergenic
1030984023 7:116219749-116219771 TAGAGGGACAGTTGAATGTAGGG + Intronic
1033166751 7:139045642-139045664 GAGAGGAACAGGTTCATGTGAGG + Exonic
1038764517 8:30414899-30414921 AAGGGGAAAAGGAGAATGTAGGG - Intronic
1041094570 8:54336281-54336303 TAGATGGAAAGGTTCATATAAGG + Intergenic
1043226560 8:77739560-77739582 TAAAGTAAAAGATTAATGAATGG + Intergenic
1043242877 8:77957924-77957946 TAGAGGAAAAGTTTGAAGGAAGG + Intergenic
1044012318 8:87009655-87009677 TACAAGAAAGGGTAAATGTATGG - Intronic
1044119671 8:88379380-88379402 TAGAACAAAAGGTTAAATTAAGG - Intergenic
1044270411 8:90236135-90236157 TACCAGAAAAGGTTAATGGATGG + Intergenic
1044459073 8:92423858-92423880 TAGAGGAATAGGATAATGAAGGG + Intergenic
1048172141 8:132117441-132117463 CAGAGGAAGAGGAAAATGTAAGG - Intergenic
1050613014 9:7372706-7372728 TGGTGGAAAGGGTTACTGTAAGG - Intergenic
1051526447 9:18050077-18050099 CAGTGGAAAATGTTAATGTTTGG + Intergenic
1052015186 9:23455348-23455370 TACAGCAAAAGTTTTATGTAAGG + Intergenic
1055211189 9:73795179-73795201 TAGAGAAAAATGATAATTTAGGG - Intergenic
1056090022 9:83196203-83196225 GAGAGGAAACGGTTAATGTCAGG + Intergenic
1056508348 9:87279090-87279112 TAGAGTAAAAGGTCACTTTAGGG + Intergenic
1056726116 9:89119589-89119611 TAGAAGAAAACTTTAATGAAAGG + Intronic
1058299379 9:103351745-103351767 AAGAGGAAAGGATTAATGTGGGG - Intergenic
1059217630 9:112580837-112580859 TACAGGAAAAGGTTAAGAAATGG - Intronic
1059799144 9:117731931-117731953 TAGGGAAAAAGTATAATGTAAGG - Intergenic
1060707787 9:125821437-125821459 TAAAGGAAAGGATTAATATAGGG + Intronic
1185811834 X:3117644-3117666 TAGGGAAAAAGGTTAATTAAGGG - Intergenic
1187608290 X:20910955-20910977 TATAGGAAAAGGTTAATTATAGG - Intergenic
1188535605 X:31193578-31193600 TAGGGTAAAAGGTTAAGGAATGG + Intronic
1189693712 X:43642318-43642340 CAGAGGATAAGGGTAATTTAGGG - Intergenic
1190009507 X:46771976-46771998 TAGAAGAAAAGGATATTGGAGGG - Intergenic
1190187836 X:48251348-48251370 TAGAGGAAAAGGATAAACTGAGG + Intronic
1190656718 X:52619115-52619137 TAGAGGAAAAGGATAAACTGAGG + Intergenic
1191932057 X:66384574-66384596 TTGAGGGAAAGGCCAATGTATGG + Intergenic
1193722173 X:85000039-85000061 TATAGGAAAAGATGAGTGTAAGG + Intergenic
1195938268 X:110145470-110145492 TAGAGGGAAGGGATAATCTAAGG - Intronic
1195955948 X:110330746-110330768 GAGAGAAAAGGGTTAATGAATGG - Intronic
1196917325 X:120550784-120550806 TACAGGAAAAGCTTGATGGAAGG - Intronic
1201269459 Y:12240712-12240734 TAGGGAAAAAGGTTAATTAAGGG + Intergenic
1201855287 Y:18534532-18534554 TAGAGCTTAAGGTTAATGTTGGG + Intergenic
1201878035 Y:18785853-18785875 TAGAGCTTAAGGTTAATGTTGGG - Intronic