ID: 907747520

View in Genome Browser
Species Human (GRCh38)
Location 1:57228075-57228097
Sequence CAGTCTGTTGATAGAGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907747520_907747522 -7 Left 907747520 1:57228075-57228097 CCTTTTCCTCTATCAACAGACTG 0: 1
1: 0
2: 0
3: 17
4: 213
Right 907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG 0: 1
1: 0
2: 0
3: 5
4: 83
907747520_907747524 -1 Left 907747520 1:57228075-57228097 CCTTTTCCTCTATCAACAGACTG 0: 1
1: 0
2: 0
3: 17
4: 213
Right 907747524 1:57228097-57228119 GAAGTGCCTATAATAGGGCCTGG No data
907747520_907747523 -6 Left 907747520 1:57228075-57228097 CCTTTTCCTCTATCAACAGACTG 0: 1
1: 0
2: 0
3: 17
4: 213
Right 907747523 1:57228092-57228114 AGACTGAAGTGCCTATAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907747520 Original CRISPR CAGTCTGTTGATAGAGGAAA AGG (reversed) Intronic
900877362 1:5352704-5352726 CCATCTGTAGATAGAGGAGAAGG + Intergenic
901560252 1:10064638-10064660 AGGGCTGTTGAGAGAGGAAAAGG - Intronic
904775680 1:32904766-32904788 CAGTGAGTTGATGGAGGATAAGG - Intergenic
905564624 1:38954021-38954043 CAATCTGTTGATAGAAGATAAGG - Intergenic
905615285 1:39393057-39393079 GAGTCTGGTTATTGAGGAAAAGG + Intronic
905995148 1:42375150-42375172 CAGCCTCTAGAGAGAGGAAAGGG - Intergenic
906951534 1:50338032-50338054 CAGGATGTTGATAGTGGAACAGG - Intergenic
907747520 1:57228075-57228097 CAGTCTGTTGATAGAGGAAAAGG - Intronic
908181528 1:61610906-61610928 TACTCTTTTGATAGAGGAGAGGG - Intergenic
908298280 1:62735408-62735430 CAGTCTGTGAGTTGAGGAAATGG - Intergenic
908595930 1:65688918-65688940 CAGTTTGAAGATAGAGGACAGGG + Intergenic
908674738 1:66591153-66591175 AAGGCTGTAGATAGAGGGAAGGG - Intronic
908681668 1:66668562-66668584 CAGTCCCTTAAGAGAGGAAATGG + Intronic
910729175 1:90372291-90372313 CAGAATGTTGATAAAGAAAAAGG - Intergenic
910897314 1:92082418-92082440 CACTCTAGTGAGAGAGGAAATGG + Intronic
911728295 1:101265515-101265537 CAGTGTGTTGAAGGATGAAATGG - Intergenic
912016365 1:105041660-105041682 AAGCCTGTTGCTAGAGGAATTGG - Intergenic
912882759 1:113433991-113434013 AAGTCTTTTGAGAGATGAAATGG + Intronic
913018273 1:114761706-114761728 GAGTCAGTTAATAGAGGGAAGGG + Intergenic
913324789 1:117617427-117617449 CAGTCAGATAATAGAAGAAAAGG + Intronic
915452084 1:156012902-156012924 CAGTCTTTTGATTGATGTAAAGG - Intronic
915662118 1:157413138-157413160 CAGTGTTTTGGGAGAGGAAATGG + Intergenic
917910433 1:179638945-179638967 GACTCTGTTGCTAGAGAAAAGGG + Intronic
918328031 1:183428762-183428784 CAGTGTGTGGTTAGAGTAAAGGG - Intergenic
919324022 1:196082466-196082488 CAGCCTATTGTTACAGGAAAGGG - Intergenic
920917638 1:210270842-210270864 CAATCTGGGGATAGAGGAAGAGG + Intergenic
921590387 1:216995800-216995822 TAGTCAGGAGATAGAGGAAATGG - Intronic
923153850 1:231258481-231258503 AAGGCTGAAGATAGAGGAAAGGG - Intronic
923574056 1:235141978-235142000 CATTCTCTTGATGGAGGAGAAGG + Intronic
923884863 1:238143212-238143234 CATTCTGTTTATAGAGTCAAAGG - Intergenic
1063199754 10:3776400-3776422 CAGGCTGTGGAAAGAGGAAGGGG + Exonic
1064189343 10:13192089-13192111 GAGTCTGATGATAGAGGTTAAGG + Intronic
1064284790 10:13982810-13982832 CAGTACATTCATAGAGGAAAAGG - Intronic
1066571443 10:36777265-36777287 CAGTCTGATGAATCAGGAAAAGG + Intergenic
1067031466 10:42880704-42880726 TATTCTGTTGGTGGAGGAAATGG + Intergenic
1068714259 10:60170292-60170314 AAGTCTGTTTATAGAGTCAATGG + Intronic
1072762423 10:98067773-98067795 CAGTCTGGTGGGAGAGAAAAAGG - Intergenic
1073074565 10:100815690-100815712 CAGTCCACTGATAGAGGTAAAGG + Intronic
1074192445 10:111149601-111149623 AAGTCTGTTGAGATGGGAAAAGG + Intergenic
1074503859 10:114049931-114049953 CAGTCTGTCGTTAGAGCAATCGG - Intergenic
1075016932 10:118916721-118916743 AAGTGTGTTGATGTAGGAAAAGG - Intergenic
1079219112 11:18543788-18543810 CATTCTTTTGAAATAGGAAAAGG + Intronic
1079433639 11:20422472-20422494 CAGTCTTTTTAGAGAGGAAATGG - Intronic
1079884431 11:25968506-25968528 CAGTCAGTTGATAGAAGAACTGG + Intergenic
1079941049 11:26681106-26681128 TGGTCTGTTGACAGAGGCAAAGG + Exonic
1080342237 11:31278979-31279001 CAGTCTTTTCTTTGAGGAAAGGG - Intronic
1082763796 11:57150598-57150620 AAGTCTGTTTATAGAAGAAAAGG - Intergenic
1085422514 11:76375724-76375746 CAACCTGTTTATAGAAGAAAAGG + Intronic
1086045638 11:82528045-82528067 TAGTCTTTTGTTGGAGGAAATGG - Intergenic
1086657643 11:89379812-89379834 CAGGGTGGTGATAGTGGAAATGG - Intronic
1087063017 11:94000644-94000666 CAGTCTGTTTACAGTGAAAAGGG - Intergenic
1088115440 11:106306771-106306793 CTGTCTATTGATAGAAGAGAGGG - Intergenic
1088732378 11:112694667-112694689 CAGTTTGCTAATAGAGGAAGGGG - Intergenic
1089039105 11:115429077-115429099 AAGTATGTTAATAGAGTAAATGG - Intronic
1090540433 11:127697104-127697126 CAGTATTCTGATAGAGAAAAAGG + Intergenic
1093588828 12:20874450-20874472 CAGTATGTTCATGGAGAAAAAGG + Intronic
1093877216 12:24363205-24363227 GAGTCTGGTGAGAGAGAAAAGGG - Intergenic
1095996445 12:48090479-48090501 CAGTCTGTTTAAACAGAAAAAGG + Intronic
1096312261 12:50531636-50531658 CAGCCTGTTGAAAGTGGATAAGG + Intronic
1097392773 12:59035796-59035818 CAGTCTGGTTGTAGAGTAAAAGG + Intergenic
1100218573 12:92479491-92479513 CAGGCTGTTAATAGATGACATGG - Intergenic
1101118542 12:101555330-101555352 CAGTCTCTTCATTGAGGTAATGG + Intergenic
1101898283 12:108771795-108771817 CCGTCTGTTAAAAAAGGAAATGG + Intergenic
1102641065 12:114367025-114367047 AGGGCTGTTGATAGAAGAAACGG + Intronic
1105958908 13:25310970-25310992 CAGTCTGTTGTGAGGTGAAAGGG + Intronic
1112748866 13:102559933-102559955 CACTCTGTTGACACAGGAAGGGG + Intergenic
1113376446 13:109768786-109768808 CAGTCTGTAGAGAGAGGATGTGG - Intronic
1113716577 13:112513062-112513084 CACTGTTTTGAAAGAGGAAAGGG + Intronic
1114208109 14:20592114-20592136 CAGTTAGTTGATATAGGAACGGG + Intronic
1114715564 14:24820321-24820343 CAGTCTGTGGTTTGTGGAAAAGG + Intronic
1114718491 14:24854176-24854198 CAGTCTGTTAAGGGAGGAAGAGG + Intronic
1115948807 14:38695915-38695937 CAGTCTTTTAATAGCAGAAATGG + Intergenic
1116122884 14:40743045-40743067 AAGTCTGATGAGAGAGGAAAAGG + Intergenic
1116527465 14:45924014-45924036 CAGTCTGTTAACAGAGTAAAGGG - Intergenic
1116878325 14:50137312-50137334 CAGTGTGTTTAAATAGGAAAAGG - Intronic
1117455970 14:55897189-55897211 GAGTCTGTGGATATAGGACAGGG - Intergenic
1118742840 14:68753055-68753077 CAGTCTCTTCAAAGAGAAAATGG + Intergenic
1119923701 14:78471669-78471691 CAGCCTGGTGATATAGGTAATGG + Intronic
1120931869 14:89856881-89856903 CAGTCTGTTGATTGGATAAAAGG - Intronic
1121584085 14:95051016-95051038 CATTCTGTGGATAGGGGAAATGG + Intergenic
1122265417 14:100544534-100544556 CAGTGTGTTCACAGAGAAAATGG + Intronic
1122839893 14:104452372-104452394 TAGTCAGTTGATAAAGAAAAAGG + Intergenic
1202832794 14_GL000009v2_random:55440-55462 CAGTTTGGTGCTAGAGCAAAGGG - Intergenic
1124956551 15:34364115-34364137 AAGGCTGTGGAGAGAGGAAAGGG + Intronic
1126908360 15:53391831-53391853 GAGGATGTTGATAGAGGAAATGG - Intergenic
1127242588 15:57133704-57133726 CAATTTGTTCTTAGAGGAAAAGG - Intronic
1130773960 15:86957300-86957322 CAATGTGATGATAGAGGAAATGG - Intronic
1130999809 15:88930928-88930950 CATTCTGTTTATTGAGGTAATGG - Intergenic
1131615542 15:94013736-94013758 CAGTCTGTTGAAATTGTAAAGGG - Intergenic
1131715283 15:95103107-95103129 CACCCTGTTAATAGAGGAAAGGG + Intergenic
1135419000 16:22291929-22291951 TAGGCTGTGGATAGTGGAAATGG - Intergenic
1137472752 16:48776699-48776721 CAGTCTGTAAATAGTAGAAAGGG - Intergenic
1138451759 16:57097563-57097585 CAGTTTCTTCATACAGGAAATGG - Intronic
1138738098 16:59276085-59276107 CTTTCTGTTGATAGAGCAATTGG - Intergenic
1138973838 16:62179440-62179462 CAGGATGATGAGAGAGGAAAAGG + Intergenic
1139681445 16:68567369-68567391 CAGATTGTTGCAAGAGGAAAAGG - Intronic
1144786575 17:17835686-17835708 CATTTTGTAGATAGAGCAAACGG - Intronic
1147763104 17:42813735-42813757 CAGTCTGTTGAGAAGGGATATGG - Intronic
1149533096 17:57411333-57411355 AAGTCTGTTGATAAAAGAAATGG - Intronic
1149758860 17:59210846-59210868 CATTGAGTTGAAAGAGGAAAAGG - Exonic
1154088033 18:11326514-11326536 CAGTCTTTTCATAGAAAAAATGG + Intergenic
1155977924 18:32151813-32151835 AAGTCTGTTGCTAGATGAATTGG + Intronic
1156255451 18:35391562-35391584 CAGTCTGTTATTACAGAAAATGG - Intergenic
1156698671 18:39797476-39797498 CATTCTGTTGCAAAAGGAAATGG + Intergenic
1157297060 18:46453198-46453220 TAGTGTGCTAATAGAGGAAATGG + Intronic
1157766237 18:50299173-50299195 CAGTCAGATAATCGAGGAAAGGG - Intergenic
1157966893 18:52218458-52218480 AAGTCAGTTGAAGGAGGAAACGG - Intergenic
1158250224 18:55479618-55479640 CAGGCTGATCAAAGAGGAAAAGG - Intronic
1158845757 18:61440941-61440963 GAGTATGTGGATACAGGAAAGGG + Intronic
1160132367 18:76237460-76237482 GTCTCTGTTGATAGAGGAAGAGG - Intergenic
1160468524 18:79104304-79104326 CAGGATGTTCATAGAGGAAGTGG + Intronic
1164381831 19:27742500-27742522 CAGTCTAATGATAGAGAAACTGG - Intergenic
1165949602 19:39466660-39466682 CAGTCTTTCTATGGAGGAAAGGG - Exonic
1202639889 1_KI270706v1_random:72284-72306 CAGTTTGGTGCTAGAGCAAAGGG + Intergenic
926423944 2:12724542-12724564 CAGTTTGTTAATAAAGGTAAAGG - Intronic
931204805 2:60136844-60136866 CAGGCTGTGGATATAGGAAAGGG + Intergenic
941012222 2:160313414-160313436 CTGTCTGGTGATAGACGACAGGG - Intronic
942148595 2:173051621-173051643 GGATCTGTTGAAAGAGGAAAGGG - Exonic
943473815 2:188329735-188329757 GAGTCTGTTGAGAAAGGCAATGG + Intronic
943775160 2:191757502-191757524 TAGTTTGTTAACAGAGGAAATGG + Intergenic
943961042 2:194264430-194264452 CATTCTGTTGAGAGGTGAAAAGG + Intergenic
944989058 2:205213567-205213589 CAATCTTTTGATGTAGGAAAAGG - Intronic
945416396 2:209578232-209578254 CAGTATTTGGATAGAGGCAAGGG + Intronic
1174185373 20:48702588-48702610 CAGCCTCTGGAAAGAGGAAAGGG - Intronic
1174784273 20:53418151-53418173 CAGCCTGCTGAGAGAGTAAAGGG + Intronic
1175608284 20:60329252-60329274 CAGACTGTGGAAAGTGGAAATGG - Intergenic
1176648220 21:9369883-9369905 CAGTTTGGTGCTAGAGCAAAGGG + Intergenic
1180362051 22:11909586-11909608 CAGTTTGGTGCTAGAGCAAAGGG - Intergenic
1181838832 22:25636641-25636663 CTGTCTTTTGATAGAGGTAGGGG - Intronic
1181904409 22:26182593-26182615 AAGTGTCTTGATACAGGAAAGGG + Intronic
1183420732 22:37709897-37709919 CAGTTTGATGGTAGAGGAGATGG - Intronic
1184249728 22:43253255-43253277 CAGGCTGTTCTTAGAGGAGATGG + Intronic
1184576537 22:45372412-45372434 CAGTCTCTTATCAGAGGAAAGGG - Intronic
1185056288 22:48580146-48580168 CAGACTGTTGATTGAGTCAACGG + Intronic
1185130234 22:49034879-49034901 CACTCTGTGCATAGAGGAACAGG + Intergenic
952595359 3:35010926-35010948 CAGCGTGGAGATAGAGGAAATGG - Intergenic
953247937 3:41213163-41213185 TAGTTTGATTATAGAGGAAAAGG - Intronic
957166911 3:76686190-76686212 CAGTCGGTGTAGAGAGGAAAAGG + Intronic
957447365 3:80331409-80331431 CAGTCTCTTGCAACAGGAAAGGG - Intergenic
959660154 3:108859275-108859297 CAGTATGTTGATAGAAGGAAGGG + Intergenic
959730187 3:109592167-109592189 CTATCAGTTGATAGAGAAAATGG + Intergenic
961726337 3:128933379-128933401 CTGGCTGTTAATAGAGGAGAAGG + Intronic
961768199 3:129228693-129228715 CAGTCTGTTGGGAATGGAAATGG - Intergenic
961857962 3:129892324-129892346 AACTCTGTTGGTAGAGGACAGGG + Intronic
964586499 3:158311566-158311588 CAGTATGTGTGTAGAGGAAAAGG - Intronic
1202738667 3_GL000221v1_random:35103-35125 CAGTTTGGTGCTAGAGCAAAGGG - Intergenic
972764963 4:42144203-42144225 CAGTCTCTTGCTCTAGGAAACGG + Intronic
973370134 4:49238636-49238658 CAGTTTGGTGCTAGAGCAAAGGG + Intergenic
973390892 4:49556776-49556798 CAGTTTGGTGCTAGAGCAAAGGG - Intergenic
974294772 4:59983177-59983199 TAGCCTCTTGATAGAGGATAGGG - Intergenic
976536680 4:86225402-86225424 CAATCTGTTGCTGTAGGAAATGG + Intronic
978645570 4:110927098-110927120 CAGTCTGTTTGTTGAGGAATTGG + Intergenic
978648255 4:110968461-110968483 AAGGCTGTTGATAGAAAAAAGGG + Intergenic
978824784 4:113008864-113008886 CAGCCTGTTCATTGGGGAAAAGG + Intronic
979769449 4:124504668-124504690 CCATCTGTTGATAAATGAAATGG - Intergenic
979825923 4:125231922-125231944 CAGTTTGAAGATGGAGGAAAAGG + Intergenic
979935955 4:126696059-126696081 CAGCCTGTTTACAGAGAAAATGG + Intergenic
980108831 4:128615128-128615150 CAGTCTGTTGTTGGACCAAAAGG + Intergenic
981923116 4:150108703-150108725 TATTCTGTTGAGAGATGAAAAGG + Intronic
986336692 5:6760657-6760679 CAGGCTGTTCACAGAGCAAAAGG + Intergenic
987886250 5:23816821-23816843 CAATATATGGATAGAGGAAATGG + Intergenic
992845370 5:80741613-80741635 CAGTCTGTTTTTAGAGGTACAGG + Intronic
993429351 5:87813122-87813144 CTGTCTTTTGATTTAGGAAAGGG - Intergenic
993997249 5:94737604-94737626 CTGGTTATTGATAGAGGAAATGG - Intronic
994653774 5:102563198-102563220 AAGTCTGTTGTCAGAGGAATTGG - Intergenic
995432059 5:112090504-112090526 AAGTCTGTTGATAGATGTATTGG - Intergenic
996597661 5:125223902-125223924 CAGTGTGTTGATTGAGGGAATGG - Intergenic
998978013 5:147669379-147669401 CAGTCAATTGTTAGAGGAAGGGG + Intronic
999417881 5:151415776-151415798 CAGTCTATTCATAGAGAAACGGG - Intergenic
999520505 5:152346232-152346254 CAGTCTGTTCAAATATGAAATGG - Intergenic
999862494 5:155663460-155663482 CAGTCAGTAGGTAGAGGCAAGGG + Intergenic
1000926624 5:167202316-167202338 CAGTAGGCTGACAGAGGAAAAGG - Intergenic
1001488827 5:172141102-172141124 CGGGCTGATGGTAGAGGAAATGG + Intronic
1002878560 6:1232692-1232714 CACTCAGTGGATAGAGGATAGGG + Intergenic
1003540305 6:7012713-7012735 CAGTGAGTTTATGGAGGAAAGGG + Intergenic
1004230625 6:13829972-13829994 CAGGCTCTTGAGAGGGGAAAAGG + Intergenic
1004423458 6:15491721-15491743 CAGTATGATGACAGATGAAAAGG - Intronic
1005250186 6:23936745-23936767 CAGTCTGTGGAAAAAGGTAACGG - Intergenic
1006672440 6:35737782-35737804 CAGACAGTTGTTAGAGTAAATGG + Intronic
1007134989 6:39512180-39512202 CAGTCTCTTGGCAGAGGCAAAGG - Intronic
1007542626 6:42662528-42662550 CAGTCTGTGGATGAAGAAAAGGG + Intronic
1007825124 6:44594591-44594613 CATTCGGCTGTTAGAGGAAAAGG + Intergenic
1008279802 6:49583181-49583203 CGGTCTGGTGGTAAAGGAAAGGG + Intergenic
1009388436 6:63115460-63115482 CAGTCTCTTGATAAAGGTTAAGG + Intergenic
1010107961 6:72190593-72190615 CAATCAGTTGACAGAGGAAGAGG - Intronic
1010673120 6:78710379-78710401 CAGTACTGTGATAGAGGAAATGG + Intergenic
1012227591 6:96722525-96722547 CAGTCTGCTGATAAATGAAAAGG + Intergenic
1015502456 6:133948500-133948522 CAGTCTAATGATAGACCAAATGG - Intergenic
1017083498 6:150691688-150691710 CATTCTATTGATAGAAGAAGAGG - Intronic
1017549918 6:155495217-155495239 CAGCCTGTTTACAGAAGAAATGG - Intergenic
1020501897 7:8933643-8933665 CAGGCTGTTAGAAGAGGAAAGGG - Intergenic
1020517231 7:9138347-9138369 CAGTTTGTAGGTAGAGAAAACGG + Intergenic
1022856271 7:34317846-34317868 CAGTGTGTTGTTAGAGGTTATGG - Intergenic
1022866403 7:34426128-34426150 CAGTATGTTGATTGAGCATAAGG + Intergenic
1023201474 7:37701952-37701974 CAGCCTGTTGAAAGGGAAAAGGG - Intronic
1024111469 7:46151318-46151340 CACTCTGTTGCTAAAGGATATGG + Intergenic
1024448513 7:49511296-49511318 GAGTCTGTTGTTAGATGCAATGG - Intergenic
1024584389 7:50828839-50828861 GAGTGTGTGGACAGAGGAAAGGG + Intergenic
1027523885 7:79243630-79243652 CATTCTGGTGATAGAGGGTAGGG + Intronic
1027599991 7:80228160-80228182 CAGCCTCTAGAAAGAGGAAAAGG - Intergenic
1029662698 7:101973426-101973448 CAGTCTGCTGACAGGGGAATTGG + Intronic
1031452041 7:121933904-121933926 CAGTCTGTTTATATAAGAAGTGG - Intronic
1031458419 7:122013139-122013161 CATTCTGTTCCTATAGGAAATGG + Exonic
1033849188 7:145473765-145473787 CAGTTTGTTAATAGTGAAAAGGG - Intergenic
1035075978 7:156177869-156177891 CTGTCTGCTGACAAAGGAAAAGG - Intergenic
1036134026 8:6142348-6142370 CACTCTGTTTGTAGAAGAAATGG + Intergenic
1036679800 8:10863775-10863797 CAGGCTGTTGCGAGAGGAAGAGG + Intergenic
1037366727 8:18130237-18130259 AAGTCTGTTGACAGATGAATTGG - Intergenic
1039742587 8:40396077-40396099 CACTCTGTTGGGAGAAGAAAGGG + Intergenic
1040101251 8:43508607-43508629 CAGTTTGGTGCTAGAGCAAAGGG - Intergenic
1042506731 8:69568601-69568623 CAGCCTGTGGAAAGATGAAATGG + Intronic
1044096516 8:88072898-88072920 CTGGCTGTTGAAAGATGAAAAGG + Intronic
1046234910 8:111410853-111410875 CAGTGTGTGGATAGAAGTAAAGG + Intergenic
1047201488 8:122771325-122771347 CAGCCTCTAGAAAGAGGAAAAGG - Intergenic
1047923551 8:129659209-129659231 CAGTTTGTTGAAAAAGAAAAAGG + Intergenic
1050290220 9:4146442-4146464 CAGCCTGTGGAATGAGGAAAGGG - Intronic
1051980073 9:23003316-23003338 TTATCTGTTGGTAGAGGAAAGGG - Intergenic
1053363850 9:37508989-37509011 CAGTCTGTTGGTTGAGGGCAGGG - Intergenic
1053374782 9:37596502-37596524 TAGTCTGATCACAGAGGAAATGG + Intronic
1054760966 9:69003660-69003682 CAGTCGGTTGATGGGGGCAAGGG + Intronic
1059895703 9:118862130-118862152 CTTTTTGTTCATAGAGGAAATGG + Intergenic
1060207984 9:121693727-121693749 CAGTCTGTTGAAAGGGGAGAGGG + Intronic
1061302991 9:129716761-129716783 CTTTCTTTTGATAGAAGAAAGGG + Intronic
1203707397 Un_KI270742v1:65547-65569 CAGTTTGGTGCTAGAGCAAAGGG - Intergenic
1203547998 Un_KI270743v1:143016-143038 CAGTTTGGTGCTAGAGCAAAGGG + Intergenic
1186547234 X:10462845-10462867 CAGTCTGTTGGAAGAGACAAAGG - Intronic
1189515409 X:41708960-41708982 CTGGCTTTTGATAGAGGAAAGGG + Intronic
1194131367 X:90085808-90085830 CATTCTGTTGAAAAAGAAAATGG + Intergenic
1195463652 X:105155809-105155831 CAGGCAGTTGGGAGAGGAAATGG + Intronic
1198229242 X:134673737-134673759 CCATCTGTTGAGGGAGGAAAGGG + Intronic
1199038810 X:143085746-143085768 TAGTCTGTGGAAAGAAGAAAGGG + Intergenic