ID: 907747522

View in Genome Browser
Species Human (GRCh38)
Location 1:57228091-57228113
Sequence CAGACTGAAGTGCCTATAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907747519_907747522 4 Left 907747519 1:57228064-57228086 CCATACATTAACCTTTTCCTCTA 0: 1
1: 0
2: 1
3: 23
4: 249
Right 907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG 0: 1
1: 0
2: 0
3: 5
4: 83
907747520_907747522 -7 Left 907747520 1:57228075-57228097 CCTTTTCCTCTATCAACAGACTG 0: 1
1: 0
2: 0
3: 17
4: 213
Right 907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907747522 Original CRISPR CAGACTGAAGTGCCTATAAT AGG Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907888533 1:58616559-58616581 CAAACTGAATTGCCTTTAATTGG - Intergenic
910695949 1:90015868-90015890 TAGATTGAAGTGACTCTAATGGG + Intronic
916346271 1:163795077-163795099 CATAGTAAAGTGCTTATAATGGG - Intergenic
917777000 1:178348654-178348676 CAAACTGGAGCGCTTATAATAGG - Intronic
919349846 1:196435769-196435791 GAGACAGAATTGCCTGTAATAGG + Intronic
920269142 1:204750219-204750241 GAGACTCAAGTGCCTCTAGTGGG + Intergenic
921571940 1:216790168-216790190 CAGACTGAAGTGACTATGGCAGG - Intronic
921677960 1:217997851-217997873 CAGACACAGGTGCCTATAATAGG - Intergenic
1070038284 10:72749522-72749544 CAAACACAAGTCCCTATAATAGG - Intronic
1074855133 10:117467716-117467738 CAGAATCAAGTGCCTATGAAAGG - Intergenic
1079744807 11:24111659-24111681 CAGAGTGAAGTTAATATAATAGG - Intergenic
1085916277 11:80891894-80891916 CAGACAGAATTCCCTTTAATAGG - Intergenic
1086030564 11:82350112-82350134 CTGACTGAAGTATATATAATGGG + Intergenic
1087591966 11:100201028-100201050 TGGAATGAAGTGCCTATTATTGG + Intronic
1098814035 12:75134247-75134269 CATAGTGAACTGCCTATAATAGG + Intronic
1099068835 12:78019521-78019543 AAGTATGAAGTGCTTATAATTGG + Intronic
1107894396 13:44946388-44946410 CAAACTGATTTGGCTATAATGGG - Intronic
1109617451 13:64854018-64854040 CATACTCAAGTGAATATAATAGG - Intergenic
1111273929 13:85923520-85923542 TAGACTGAAGAGCCTTTTATTGG - Intergenic
1115777237 14:36729047-36729069 CAGACTGAAGGGCCTTTTATAGG - Intronic
1115895742 14:38084816-38084838 CAGACTGAAGAGCCCAAATTTGG + Intergenic
1116951147 14:50879775-50879797 CAGGCAGCAGTGCCTATATTCGG + Intronic
1118130834 14:62961555-62961577 AAGACTGAAGTGGCCATGATGGG + Intronic
1125346090 15:38720567-38720589 CTGAATGAAGTGCTTAAAATAGG + Intergenic
1125713249 15:41804210-41804232 CAGACTGAGCTGCCCATAAATGG - Intronic
1127327725 15:57911815-57911837 CAAACAGAAGTGCTTATAAAAGG + Intergenic
1130098215 15:80871900-80871922 CTGGCTGAAGTGACTAGAATGGG + Intronic
1130173775 15:81546457-81546479 GAGACTGAAGTGCCTGGAAGAGG - Intergenic
1136498251 16:30657011-30657033 GAGACTGAAAGGCCTATAGTGGG + Intergenic
1140145074 16:72299079-72299101 CAGGGTGAAGTGCATATAACAGG - Intergenic
1142477416 17:197603-197625 CACACTGAAATGACTAGAATTGG + Intergenic
1144555549 17:16279669-16279691 CAGACTGATGTGTCTATCAGAGG + Intronic
1149473461 17:56939175-56939197 CAAAATGAAGTGCCTAAACTGGG - Intronic
1158314524 18:56196036-56196058 CAGACTGTGGTACCTCTAATTGG + Intergenic
1166630129 19:44399577-44399599 CTCACTGAAGAGCCAATAATGGG + Intronic
1166637331 19:44461859-44461881 CTCACTGAAGAGCCAATAATGGG - Intergenic
1168469160 19:56626995-56627017 CAGACTGCAGTGCGTGTGATGGG - Intergenic
928645223 2:33345087-33345109 CAGTGTGAAGTGCGTATCATAGG - Intronic
932027128 2:68145674-68145696 CAGGCTGAAGTTCGTCTAATAGG + Intronic
939657890 2:144850429-144850451 GAAACTTAAGTGCCTTTAATTGG + Intergenic
941086507 2:161124335-161124357 CAGACTGGTGTGCTTATAAGAGG + Intergenic
943838547 2:192548088-192548110 CATATTAAAGTGCCTAAAATGGG + Intergenic
946297711 2:218799001-218799023 AAGACTGAAGTCCCTAGAAGGGG + Intronic
1178808372 21:35858623-35858645 CAGAATGGAGTGCTTATATTAGG - Intronic
1182358628 22:29734123-29734145 CAAACTGAAGAGCCAACAATGGG + Intronic
1184574825 22:45355103-45355125 CAGACTGTAGAGCCTATTATGGG + Exonic
1184978384 22:48079257-48079279 CTGACTGAAGCCCCTATTATGGG + Intergenic
950348157 3:12318684-12318706 CAGACTGTAGAGCTCATAATTGG - Intronic
950910782 3:16589077-16589099 CTGACTGAACTGCATCTAATAGG + Intronic
950969381 3:17170886-17170908 GAGACTGAATTGCCTTTAACTGG + Intronic
952150969 3:30591271-30591293 CAGAATGGAGTGCATAGAATTGG + Intergenic
961706961 3:128794476-128794498 CTGACAGCAGTGCCTATAGTGGG - Intronic
970114872 4:12683705-12683727 CAGAGTGAAGAAGCTATAATAGG + Intergenic
972274147 4:37541409-37541431 AAGACTTAAGTACCTCTAATAGG - Intronic
973203655 4:47534460-47534482 CAGACTGAAATGCCTAATAGAGG + Intronic
975957451 4:79858265-79858287 CAGAGTGAAGTAGCTATAAGGGG - Intergenic
977061236 4:92259143-92259165 CAGCCTGATCTGCCTATAAAAGG + Intergenic
981191560 4:141871027-141871049 CAGACTGAACAACCCATAATAGG + Intergenic
985019139 4:185669202-185669224 CAAACTCAAGTGCCCATCATGGG + Intronic
986013254 5:3736275-3736297 CAGACTGAAGTTCAAAAAATAGG - Intergenic
991153274 5:63397884-63397906 AAGACTGAAGGGCCTGTACTTGG + Intergenic
992411661 5:76511111-76511133 CAGAATGTAGTCCATATAATAGG - Intronic
993744703 5:91582966-91582988 CAGAATGAAGTGCCTTTAGGGGG + Intergenic
993932455 5:93956421-93956443 AAGACTGAAATTCCTAAAATTGG - Intronic
995206196 5:109484135-109484157 CAAACTCAAGTGGCTAAAATTGG + Intergenic
995950911 5:117712826-117712848 TAGCATGAAGTGCATATAATAGG - Intergenic
997916990 5:137936857-137936879 CAGAATGAAGTGCCTCTGACAGG + Intronic
999977525 5:156926670-156926692 CACACTGCATGGCCTATAATAGG - Intronic
1001929205 5:175660757-175660779 TAGACTGAATTGCCTCTAAAAGG + Intronic
1003066169 6:2904913-2904935 CAGCATGAAATGCCTATATTAGG + Intergenic
1006958489 6:37901128-37901150 CAGAATGAATTGCCAAAAATTGG - Intronic
1010757394 6:79682344-79682366 CAGGCTGGAGTCCCAATAATGGG + Intronic
1011497352 6:87949776-87949798 GGGACTGCAGTGTCTATAATAGG + Intergenic
1012519422 6:100103214-100103236 CAGACTAAAGAGCCTGTGATTGG - Intergenic
1015001651 6:128224066-128224088 CAGAATAAAGAGCCTATAAAAGG - Intronic
1022829387 7:34049954-34049976 TAGACAGAAGTGATTATAATGGG + Intronic
1031493553 7:122419046-122419068 CAGACTCATGAGCCTGTAATAGG - Intronic
1039182044 8:34877970-34877992 CAGAGTGAAGTGAAGATAATGGG - Intergenic
1041326303 8:56669802-56669824 CAGACTCAAATACCTAGAATTGG - Intergenic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1053448789 9:38175238-38175260 GATACTGAGGTGCCTAGAATAGG + Intergenic
1060041082 9:120301850-120301872 CAGACTTAATTGCATATATTAGG + Intergenic
1060673219 9:125488844-125488866 CAGAAAGAAGTGCCTAAAAATGG + Intronic
1060853871 9:126899513-126899535 CCAACTTAAGTGCCCATAATGGG + Intergenic
1189645579 X:43126082-43126104 AACACTGAAGTGTATATAATAGG - Intergenic
1194010229 X:88553065-88553087 CAGACTGAAATGTCTTAAATGGG - Intergenic
1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG + Intronic
1197238738 X:124098626-124098648 CAAACTGAAGTGTCTACATTAGG - Intronic