ID: 907749655

View in Genome Browser
Species Human (GRCh38)
Location 1:57250207-57250229
Sequence GCCATGGACCATGTGGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907749651_907749655 -3 Left 907749651 1:57250187-57250209 CCAGATTAATCAGATTCCTTGCC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 126
907749648_907749655 4 Left 907749648 1:57250180-57250202 CCCTTGCCCAGATTAATCAGATT No data
Right 907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 126
907749647_907749655 15 Left 907749647 1:57250169-57250191 CCAGATCAGTGCCCTTGCCCAGA No data
Right 907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 126
907749650_907749655 -2 Left 907749650 1:57250186-57250208 CCCAGATTAATCAGATTCCTTGC 0: 1
1: 0
2: 0
3: 11
4: 149
Right 907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 126
907749649_907749655 3 Left 907749649 1:57250181-57250203 CCTTGCCCAGATTAATCAGATTC No data
Right 907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907749655 Original CRISPR GCCATGGACCATGTGGTTTG TGG Intronic
902756950 1:18555363-18555385 GCCATGTGCAATGTGGCTTGTGG - Intergenic
902809176 1:18878593-18878615 CCCATGGACCAAGTGTTTTGTGG - Intronic
902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG + Intronic
904010730 1:27388732-27388754 GCCATTTACTATGTGATTTGGGG + Intergenic
904908021 1:33912578-33912600 TCTCTGGACCATGTGGTTGGAGG - Intronic
907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG + Intronic
909227522 1:73044587-73044609 GCCATGGACCTTGTGGGGTTGGG - Intergenic
912761408 1:112370748-112370770 GCAATGAACCATTTGGTATGAGG - Intergenic
917580181 1:176369059-176369081 GCAATGGACCATGTGGTGTTGGG + Intergenic
918229189 1:182512962-182512984 TCCATGGAGCCTGGGGTTTGGGG + Intronic
923103071 1:230832708-230832730 GCCAGGGCCCATGTGGTTTCCGG + Intergenic
923255934 1:232221460-232221482 GCCATTTACCATGTGATTTTAGG + Intergenic
1067733125 10:48828179-48828201 CCCATGAACCATGTGCTCTGGGG - Intronic
1077047116 11:551551-551573 GCCATGCAGCATGGGGATTGGGG + Intronic
1079056924 11:17214179-17214201 GCCCTGGATCAGGGGGTTTGTGG - Intronic
1082762945 11:57144576-57144598 GCCATGGGCCATGGGGAATGGGG - Intergenic
1083024754 11:59541034-59541056 CCCAAGGACCAAGTGGTTTCAGG - Intergenic
1084115797 11:67042322-67042344 GCCATGTTGCCTGTGGTTTGGGG + Intronic
1084533264 11:69741896-69741918 AGCAGGGACCATGTGCTTTGTGG - Intergenic
1084708457 11:70829525-70829547 CCCATGTCCCATCTGGTTTGGGG + Intronic
1085846690 11:80074121-80074143 ACCATGTACCATGTCGTTTCTGG + Intergenic
1089362187 11:117898260-117898282 GGCTTAGACCATGTGGTTTCTGG - Intergenic
1089992131 11:122871408-122871430 GCAATGGAACATGTGATTTCAGG + Exonic
1091200747 11:133778546-133778568 GCCATGGTCCATGAAGTTTCAGG - Intergenic
1096448139 12:51713377-51713399 CCCCTGGACCATTTTGTTTGGGG + Intronic
1096504755 12:52085762-52085784 GCTTTGGACCCTGTGGTCTGTGG - Intergenic
1102426282 12:112846750-112846772 GTCATGGACCATGGTGTTAGTGG + Intronic
1102631979 12:114288819-114288841 GCCCTGTACCATGTGACTTGGGG + Intergenic
1103335539 12:120186636-120186658 GCATTGGTCCATGTGATTTGGGG + Intronic
1103886778 12:124208389-124208411 GCCATGGCCCATGGGTTTTTAGG + Intronic
1104276450 12:127333082-127333104 TCCATGGACCCTGGGGCTTGAGG + Intergenic
1114598135 14:23931807-23931829 TCCATGGACTGTGGGGTTTGCGG - Intergenic
1115154555 14:30323128-30323150 TCCATCTACCTTGTGGTTTGGGG + Intergenic
1115770798 14:36662746-36662768 TTCAGGGACCATATGGTTTGGGG + Intronic
1117390330 14:55256359-55256381 CCCATGGAGCCTGGGGTTTGGGG - Intergenic
1118723868 14:68613010-68613032 CTCATTAACCATGTGGTTTGTGG - Intronic
1119733449 14:76965716-76965738 CCCTTGGATCCTGTGGTTTGAGG + Intergenic
1123927850 15:25135712-25135734 GCCTTGGTCCATGTGGAATGTGG + Intergenic
1125401633 15:39310669-39310691 GCCATGGAGCATGTGGGCTATGG - Intergenic
1125867604 15:43067890-43067912 GCCATTGACAAAGAGGTTTGTGG - Exonic
1126322955 15:47445162-47445184 TCCATGGAGCGTATGGTTTGTGG + Intronic
1132130703 15:99275815-99275837 ACCATGGATTATGAGGTTTGTGG + Intronic
1133170923 16:3982141-3982163 GCCATGGGCCATGCTGTCTGTGG - Intronic
1135101971 16:19613799-19613821 CTCTTGGACCATGAGGTTTGTGG - Intronic
1135867886 16:26121465-26121487 GCGATGGTCCATGCTGTTTGAGG + Intronic
1138560658 16:57799075-57799097 GCCAGGCACCAGGTGGTGTGGGG + Intronic
1141765185 16:86053391-86053413 GTCATGGACCCTGTGGTAGGTGG + Intergenic
1145785612 17:27591906-27591928 GCAATGGACCGTGAGGTCTGAGG - Intronic
1146481842 17:33211183-33211205 TCCACGGACCAAGGGGTTTGTGG + Intronic
1147166500 17:38596255-38596277 GCCATGGGCCATGGGGTTGGGGG + Intronic
1150310483 17:64124955-64124977 GCCAAGGACTAGGAGGTTTGGGG + Intronic
1151975057 17:77479929-77479951 GCCATGGACCATGTGGCTTTGGG - Intronic
1155013651 18:21809292-21809314 GCCTTGGACCTTATGGTTTCAGG + Intronic
1155612488 18:27682640-27682662 TCCATGGACCAGGGGGTGTGTGG + Intergenic
1159524426 18:69569050-69569072 TCCATGGACCAGGGGGTTTGTGG - Intronic
1163057552 19:14731989-14732011 GCAATGGACTCTGTGGTCTGGGG - Intronic
1163578137 19:18122618-18122640 GGCCTGGCCCCTGTGGTTTGTGG - Intronic
1168635283 19:57991391-57991413 GTCATTGACCATGGGGGTTGGGG - Intronic
926434650 2:12825347-12825369 GACAGGAACCATGTGGTGTGAGG + Intergenic
927899200 2:26806702-26806724 ATCAAGGACCATGTGTTTTGAGG - Intergenic
928204661 2:29275349-29275371 GCCATGGGCCATGGGGGTTGGGG + Intronic
930553151 2:52861256-52861278 GCCACGGACTTTGTGGTTTTTGG - Intergenic
931387974 2:61814123-61814145 GACAAGGAGCATGAGGTTTGTGG + Intergenic
931597865 2:63969698-63969720 TCCATAGACCAAGGGGTTTGCGG - Intronic
933787128 2:85852259-85852281 GCCATGGATCACGTGATCTGGGG + Intronic
936969429 2:118163262-118163284 GCCATGGAACATGGGAATTGTGG - Intergenic
937594662 2:123659325-123659347 GCCTTGAGCCATGGGGTTTGAGG + Intergenic
941883897 2:170508792-170508814 GCCATTTGCCATGTAGTTTGGGG + Intronic
942392991 2:175515575-175515597 GCCATGCACTATGTGGCTTCAGG - Intergenic
944917135 2:204372678-204372700 GCCCTGGGCCATAAGGTTTGAGG + Intergenic
945983571 2:216336697-216336719 GCCATGGAGGAAGTGGTTTTGGG - Intronic
946478460 2:220031305-220031327 GCCATGATCCATCTGGTTTCAGG - Intergenic
948667968 2:239548053-239548075 TCCAAGGACCATCTGGTCTGGGG + Intergenic
1168877607 20:1182149-1182171 TCCATGGACCTTGTTGTATGAGG + Intronic
1169362200 20:4960172-4960194 GAGATAGGCCATGTGGTTTGTGG - Intronic
1170444621 20:16413083-16413105 ACCATGAACCATTTGGTCTGAGG + Intronic
1171780449 20:29411799-29411821 GCCCTGGTCCCTGTGGTTTTCGG - Intergenic
1174401892 20:50280446-50280468 GCCCAGGACCATGTGGGGTGGGG + Intergenic
1178274425 21:31223987-31224009 GCAATGGACCAAGTGCTTTTGGG + Intronic
1178398220 21:32261141-32261163 GCCATGGGGCCTGGGGTTTGTGG - Intergenic
1179040493 21:37798189-37798211 GCCTTGGAACACGTGGTTGGTGG + Intronic
1181590774 22:23883715-23883737 GCCATGGTCCCTGAGGTCTGGGG - Intronic
1183315742 22:37136020-37136042 GCCATGGGCCTTGTGAGTTGGGG - Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
1185343852 22:50302975-50302997 GCCATGGAGAGTGGGGTTTGAGG - Intronic
949828482 3:8187691-8187713 GCCATGGACCCTGAGGCTTTGGG - Intergenic
951637749 3:24798456-24798478 GCTCTGGACCCTGGGGTTTGGGG - Intergenic
956782811 3:72617734-72617756 ACAACGTACCATGTGGTTTGTGG - Intergenic
957084630 3:75668712-75668734 GCCCTGGTCCCTGTGGTTTTCGG + Intergenic
957145573 3:76419250-76419272 GCCATTAAACATGTGTTTTGGGG + Intronic
957704686 3:83765254-83765276 GCCAGGCACAATGTGGTTTTGGG - Intergenic
960455052 3:117860722-117860744 GCCATAGGCAATGTGGTTTTGGG - Intergenic
962847706 3:139286237-139286259 GCCATCCACCATGGGTTTTGGGG + Intronic
969347262 4:6577124-6577146 GCGATAGTCCCTGTGGTTTGAGG + Intronic
974134300 4:57795265-57795287 TCCAGGCACCTTGTGGTTTGTGG + Intergenic
974363989 4:60921691-60921713 TCCACGGACCATGGGGGTTGTGG + Intergenic
974610154 4:64206301-64206323 CCCATGGAGCCTGGGGTTTGGGG + Intergenic
976222802 4:82771641-82771663 GCATGGGACCATGTGGTCTGTGG - Intronic
976555088 4:86441466-86441488 TCCCTGGAACATGTGCTTTGTGG - Intronic
984456534 4:179976274-179976296 GCCAATGGCCATGTGGATTGTGG - Intergenic
985446342 4:190022861-190022883 GCCCTGGTCCCTGTGGTTTTCGG - Intergenic
987518115 5:18941989-18942011 GACTGGGACTATGTGGTTTGGGG - Intergenic
990281630 5:54257564-54257586 GCCAGTGACCATGTGGAATGTGG + Intronic
991456753 5:66812068-66812090 GCCTTGCATCATGTTGTTTGCGG - Intronic
992080217 5:73229970-73229992 GCAATGAAACATGTGTTTTGTGG - Intergenic
992942341 5:81774733-81774755 TCCAGGGAACATGTGATTTGAGG - Intergenic
996672560 5:126135268-126135290 CTCATGGAGCCTGTGGTTTGGGG + Intergenic
1003507038 6:6748637-6748659 GCCATGGAGCATGTGGTCCAGGG + Intergenic
1005271964 6:24175531-24175553 GTCATGGCCTGTGTGGTTTGGGG - Intronic
1006393111 6:33770536-33770558 GCCATGCCCCATGGGGCTTGTGG - Intergenic
1006483440 6:34317608-34317630 GCCATGTACCATGTTGTCTAGGG - Intronic
1008555115 6:52666325-52666347 GCCAAGGACTAAGGGGTTTGGGG - Intergenic
1009975155 6:70664233-70664255 GCCAAGGACCATCTGGCTGGTGG - Intergenic
1010510600 6:76713968-76713990 GCAATGAACCATGTTGTTTAAGG + Intergenic
1015011811 6:128358357-128358379 ACCATGGGTCATGGGGTTTGTGG + Intronic
1015264345 6:131275721-131275743 ATCCTGAACCATGTGGTTTGGGG + Intronic
1015353113 6:132246346-132246368 GGGAAGGACCATGTGGCTTGGGG - Intergenic
1017519560 6:155189900-155189922 GCCATGGACCTGGAGGTGTGTGG + Intronic
1022628102 7:32059211-32059233 GCCTTTGACAGTGTGGTTTGGGG + Intronic
1024044668 7:45578539-45578561 GCCAAGGACCATGGGGTATTAGG + Intronic
1034423454 7:151001055-151001077 ACCATGCATGATGTGGTTTGGGG + Intronic
1036085913 8:5612642-5612664 GCCTTGCAGCAAGTGGTTTGTGG + Intergenic
1036207067 8:6813439-6813461 TCCAGAGGCCATGTGGTTTGAGG + Intronic
1036765719 8:11548190-11548212 GCCATGGAGGATGTGGTGGGTGG - Intronic
1037936035 8:22915627-22915649 GCCATGGACTATTTGGTGTTGGG - Intronic
1041745190 8:61200926-61200948 GCCATGTACCATATGATTTTGGG + Intronic
1044780171 8:95735464-95735486 GCCCTGGACCATGAAGTTTAAGG + Intergenic
1057187142 9:93063224-93063246 TCCATGGACCTTGGGGATTGAGG + Intronic
1057472501 9:95370170-95370192 GAACTGGACCATGTGGTGTGTGG - Intergenic
1057832323 9:98416915-98416937 TCCATCTACCATGTGGTTTTGGG + Intronic
1186588949 X:10908324-10908346 TCCATAGACCATGGGGTCTGTGG + Intergenic
1187684834 X:21805562-21805584 GGCATGGAACATGTTGTTTCTGG - Intergenic
1192080767 X:68045839-68045861 GCAAGGGACCTTGTGGTTTGTGG - Exonic
1192195145 X:69022995-69023017 GGCAGGGACCATTTGGTTCGGGG - Intergenic
1196847241 X:119905918-119905940 CTCATGGACCATATGGTCTGGGG - Intronic