ID: 907749655

View in Genome Browser
Species Human (GRCh38)
Location 1:57250207-57250229
Sequence GCCATGGACCATGTGGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907749649_907749655 3 Left 907749649 1:57250181-57250203 CCTTGCCCAGATTAATCAGATTC No data
Right 907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 126
907749651_907749655 -3 Left 907749651 1:57250187-57250209 CCAGATTAATCAGATTCCTTGCC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 126
907749647_907749655 15 Left 907749647 1:57250169-57250191 CCAGATCAGTGCCCTTGCCCAGA No data
Right 907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 126
907749650_907749655 -2 Left 907749650 1:57250186-57250208 CCCAGATTAATCAGATTCCTTGC 0: 1
1: 0
2: 0
3: 11
4: 149
Right 907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 126
907749648_907749655 4 Left 907749648 1:57250180-57250202 CCCTTGCCCAGATTAATCAGATT No data
Right 907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907749655 Original CRISPR GCCATGGACCATGTGGTTTG TGG Intronic