ID: 907749862

View in Genome Browser
Species Human (GRCh38)
Location 1:57252700-57252722
Sequence GCACCCAACCCAGGAAAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907749862 Original CRISPR GCACCCAACCCAGGAAAACG GGG Intronic
901405159 1:9040266-9040288 GCACCCCACTCAGGATGACGGGG - Intronic
905468850 1:38176433-38176455 ACTGCCAACCCAGGAAAATGAGG + Intergenic
905740130 1:40362797-40362819 GCATTCAACACAGGAAAAAGAGG + Intronic
907266109 1:53262417-53262439 GCCCCCAACCCAGGAAAGGCAGG + Intronic
907749862 1:57252700-57252722 GCACCCAACCCAGGAAAACGGGG + Intronic
908712808 1:67036448-67036470 GCACCCAACACTGGAACACCCGG - Intronic
909732255 1:78907878-78907900 ACAACCAGCCCAGGCAAACGGGG - Intronic
912628967 1:111229907-111229929 GCACCCAAGCCAGGAGATCCAGG - Intronic
914414407 1:147466454-147466476 GCACCCAACACAGGAGCACCTGG - Intergenic
916085500 1:161266178-161266200 GTACCCCACCCAGGGAAAAGGGG + Intronic
918757658 1:188357799-188357821 GCACCCTGCCCCTGAAAACGTGG - Intergenic
920549390 1:206845911-206845933 GCACCAAAGCCAGGAAGATGGGG - Intergenic
924734427 1:246742908-246742930 GAAACCAAGCCAGGAAAAAGGGG - Intronic
924862990 1:247945669-247945691 GCACCCAATCCAGGAGCACCCGG - Intronic
1063593312 10:7411782-7411804 GCTCACACCCCAGCAAAACGTGG + Intergenic
1070591907 10:77807519-77807541 GCACAGCACACAGGAAAACGGGG + Intronic
1071469145 10:85967369-85967391 GCAACAAACCCAGGATAAAGGGG + Intronic
1078468862 11:11570984-11571006 GTGCTCAACCCAGGAAAACTTGG - Intronic
1089140582 11:116280732-116280754 TCCCCCACCCCAGGAAAACCTGG + Intergenic
1092118790 12:6029224-6029246 GCACCCAACACAGGAGCACCTGG + Intronic
1094010395 12:25803064-25803086 TCACACAACTCAGGAAAATGTGG - Intergenic
1094627320 12:32136411-32136433 TCACCCAAACCCAGAAAACGAGG + Intronic
1094730211 12:33165750-33165772 GCACCCAACACAGGAACACTCGG + Intergenic
1098024754 12:66189569-66189591 GCATCCAACCCAGGAAAGGAGGG - Intronic
1104943754 12:132406549-132406571 GAAACCAACCCAGGAAAGCCCGG - Intergenic
1105029772 12:132874468-132874490 GCACCCAGCACAGGGAAACCAGG + Intronic
1109323332 13:60836638-60836660 GCACACACCCCAGGTAAAAGGGG - Intergenic
1110509304 13:76330046-76330068 GCACCTAACTCAGGAAAAACAGG - Intergenic
1112247453 13:97747724-97747746 GCACCCAACCCAGGCCTCCGGGG + Intergenic
1117478067 14:56117951-56117973 GAACTCCAGCCAGGAAAACGTGG + Intronic
1118787311 14:69056649-69056671 GCATCCAACCCAGAAAACAGTGG + Intronic
1125859640 15:42986861-42986883 GCACCAACCCCAGGAAGACACGG + Intronic
1127122674 15:55785216-55785238 GTACCCAGCCCAGGATAACAGGG - Intergenic
1127889121 15:63232752-63232774 CAACCCAACAGAGGAAAACGGGG - Intronic
1128565607 15:68698871-68698893 CCACCCCACCCACCAAAACGTGG + Intronic
1129522182 15:76192890-76192912 CCACCCAAGCCAGGAAATGGTGG + Intronic
1131436698 15:92428567-92428589 GGACCCAACCCAGGTGAATGTGG + Intronic
1133876661 16:9741088-9741110 GCATCCACCCCAGGAACACTTGG + Intergenic
1135510580 16:23079748-23079770 CGACCCAACTCAGGAAAAGGAGG + Intronic
1139877314 16:70156669-70156691 GCACAAAGCCCAGGCAAACGTGG - Exonic
1141180817 16:81752431-81752453 GCCTCCACCCCAGGAAAAAGAGG - Intronic
1141305694 16:82861888-82861910 GCTCCCAACTCAGGGAAACTTGG + Intronic
1141432359 16:83976996-83977018 GCACCCACCCGAGGAAATGGAGG + Intronic
1141544252 16:84753609-84753631 GCACACAAACCAGGAAGACGGGG - Intronic
1142997427 17:3769132-3769154 GCACCTACCCCACCAAAACGGGG - Intronic
1144659668 17:17059994-17060016 CCACCCACCCCAGGAAAAGCTGG - Intronic
1147140841 17:38459851-38459873 GCACCCCACACAGGAGGACGGGG + Intronic
1152118363 17:78402817-78402839 GCATCCAACTCAGGAAGACAGGG - Intronic
1152923651 17:83078256-83078278 GCCCCCAGCCCAGGAAAGCTGGG - Intergenic
1154055490 18:11009351-11009373 GCCCCCACCCCAGAAAAATGAGG - Intronic
1160041923 18:75353321-75353343 GCACACAACACAGGAAACCTGGG - Intergenic
1160932361 19:1576792-1576814 GCACCAACCTCAGGAAGACGTGG + Exonic
1161056477 19:2193134-2193156 GCACACAACCCAGCAACACCCGG - Intronic
1161219143 19:3110037-3110059 GCACCCAGCACAGGAAACCAAGG - Intronic
1161586996 19:5111022-5111044 CCACCCACCCCAGCAAAGCGAGG - Intronic
1163464760 19:17460866-17460888 GCACCCAACCCAGGTTACCATGG - Exonic
1166848437 19:45745069-45745091 GCACCCCACCCTGGACACCGAGG - Intronic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
926172021 2:10558553-10558575 CCACCCTCCCCAGGAAAACCAGG + Intergenic
926217242 2:10913080-10913102 GCACCCGACGCTGGAGAACGTGG + Exonic
926720718 2:15958194-15958216 GCCCTCAACCCAGGGAAACAAGG - Intergenic
929440658 2:41963843-41963865 GCCCCGAGCCCAGGAAAAGGGGG + Intergenic
930586203 2:53269780-53269802 GCACCCAACACAGGAGCACCCGG + Intergenic
943548595 2:189311460-189311482 GCACCAAGCCCAGGAATAGGAGG - Intergenic
947605547 2:231483366-231483388 GAACCCACGCAAGGAAAACGGGG + Intronic
948524972 2:238566034-238566056 GGACCCAGCCCAGAAAGACGGGG - Intergenic
948850591 2:240703613-240703635 GCTCCCAGCCCAGGAAAGCAAGG - Intergenic
1168805806 20:671785-671807 GCATCCAACCCAGGCAGATGAGG - Intronic
1168985724 20:2047021-2047043 ACTCCCAACCCATGAAAACTAGG + Intergenic
1174787532 20:53446656-53446678 ACACCCATCCAAGGAAAAGGAGG - Intronic
1178003846 21:28194323-28194345 GCACCCAACCCTGGAGCACATGG + Intergenic
1178713893 21:34945979-34946001 GCATCCAAACCTGGAAAACCAGG - Intronic
1180970049 22:19810535-19810557 GGACCCAGCCCAGGTAGACGTGG - Intronic
1181629878 22:24145162-24145184 GCACCTGGCCCAGGAAAACAGGG - Intronic
950551445 3:13668656-13668678 GCCCCCAACCCAGGATAATGGGG + Intergenic
952522324 3:34174209-34174231 GCTCCCACCCCAGGGAAACGGGG - Intergenic
953306229 3:41832370-41832392 GCAAACAACCCATAAAAACGTGG - Intronic
953586407 3:44205227-44205249 GCACCCAACCTAGGGAAGAGCGG - Intergenic
953902934 3:46853496-46853518 GAACCAAACCCAGGAACATGTGG + Intergenic
954134012 3:48573766-48573788 GCACCCCACCAAGGAAACTGAGG + Intronic
954591920 3:51790152-51790174 GCACCCAGCCCAAGACAATGTGG - Intergenic
955041589 3:55322694-55322716 GCTCCCACCCCAGGAAAGCTGGG + Intergenic
958778127 3:98509872-98509894 GCACCCAACACAGGAGAAAGAGG + Intronic
958929886 3:100197671-100197693 GCACCCAACCCAGGAATGTCAGG - Intergenic
960758540 3:121047526-121047548 GCACCCAACACAGGAGTACCCGG - Intronic
960974739 3:123162983-123163005 GCACCCATCCATGGAAAACGTGG - Intronic
964290961 3:155179567-155179589 CCTCCCAACCCAAGCAAACGTGG + Intronic
964315647 3:155441309-155441331 GCACCCAACCTAGAAAAATGTGG + Intronic
967225973 3:187291627-187291649 GCACCCAAGGCAGGAAAATGAGG - Exonic
969052850 4:4385605-4385627 GCCCCCAACCCAGGGAAAGCGGG - Intronic
974741990 4:66019249-66019271 GCACCCAACACAGGAGCACCTGG - Intergenic
975361013 4:73472241-73472263 GCACCCAACACAGGAGCACTTGG - Intergenic
977325875 4:95573906-95573928 GCACCTATCCCAGGAATACAAGG - Intergenic
985351226 4:189064177-189064199 GCACCCAACACAGAACACCGAGG + Intergenic
987799478 5:22675188-22675210 GCGCCCAGCACAGGAAAACTGGG - Intronic
988270420 5:29007056-29007078 GCACTCAACCCAGGAGCAAGTGG + Intergenic
991198590 5:63962516-63962538 GCCTCCAACCCAGCAAAACTGGG + Intergenic
995994158 5:118279553-118279575 GCACACAACTCAGGAAAACGGGG + Intergenic
998395207 5:141813870-141813892 GCACCGAAGTCAGGAAAACCTGG - Intergenic
998460211 5:142304420-142304442 GCACCCAGCCCAGGGGAACTGGG + Intergenic
1000765771 5:165286831-165286853 GCACCCAGCCTAGGAACACTGGG + Intergenic
1002047402 5:176549696-176549718 GCAGGCACCCCAGGGAAACGAGG + Intronic
1002839281 6:892386-892408 GCACCTATCCCAGGAAGAGGAGG - Intergenic
1003318584 6:5033211-5033233 TCACCTAAACAAGGAAAACGGGG - Intergenic
1005703774 6:28430477-28430499 ACACCCACCTGAGGAAAACGGGG + Intergenic
1006396122 6:33788766-33788788 GCTCCCTACCCAGGAAGCCGCGG + Exonic
1007776594 6:44227487-44227509 GCACCCAGCCAAGGCACACGGGG - Intronic
1008254395 6:49278229-49278251 GCACCCAATACAGGAACACCCGG + Intergenic
1009336309 6:62494498-62494520 GCACCCAACACAGGAACACCCGG + Intergenic
1011720079 6:90147065-90147087 GTACCAAACCCAGCAAAAAGAGG + Intronic
1014704409 6:124728025-124728047 GCACCCAACACAGGAGCACCCGG + Intronic
1014849972 6:126329058-126329080 GCACCCAACACAGGAGCACCCGG + Intergenic
1017172444 6:151470670-151470692 GCACTCCAGCCAGGAAAACAGGG - Intergenic
1018747587 6:166774502-166774524 GCACCCATCCCAGCACCACGTGG + Intronic
1019774773 7:2906019-2906041 TCACCCTACCCAGGAACATGGGG + Intergenic
1031993812 7:128215615-128215637 GCATCAAACCCAGGAAAGAGGGG + Intergenic
1039455733 8:37704836-37704858 GCCACCATCCCAGGAAAACCTGG - Intergenic
1045530639 8:102981955-102981977 GCACCCACCCCAGGAAGAGGAGG + Intergenic
1048027561 8:130600863-130600885 GAACCCACCCCAGGAAATAGGGG + Intergenic
1048468448 8:134686335-134686357 GCCCCCAACCCAGGATAACCAGG - Intronic
1049482822 8:142834985-142835007 GCACCCCATCCAGGGAAGCGCGG - Intronic
1050727555 9:8669161-8669183 GCATCCAACCAAGGAATAAGAGG - Intronic
1062282541 9:135758494-135758516 GCACTCACCCCGTGAAAACGAGG - Exonic
1203491886 Un_GL000224v1:114652-114674 GCACCCAACACAGGAGGACCCGG - Intergenic
1203504510 Un_KI270741v1:56523-56545 GCACCCAACACAGGAGGACCCGG - Intergenic
1185877801 X:3713869-3713891 GCACCCAAGCCCGGAAGATGGGG + Intergenic
1190283434 X:48946500-48946522 GCCCACACCCCAGGAAAATGTGG + Intronic
1191646863 X:63491276-63491298 GCACCCAACACAGGAGCACCTGG + Intergenic
1191823868 X:65342234-65342256 GCACCCAACACAGGAGCACCTGG + Intergenic
1193270401 X:79522812-79522834 GCACCCAACACTGGAACACATGG + Intergenic
1193580983 X:83262368-83262390 GCACCCAACATAGGAGAACCTGG + Intergenic
1194578509 X:95642145-95642167 GGGCCCAACCCAGGAAACCATGG + Intergenic
1196513584 X:116544240-116544262 GCACCCAATACAGGAGAACCTGG - Intergenic
1197062068 X:122193253-122193275 GCACCCAATACAGGAACACCTGG - Intergenic
1200242884 X:154507037-154507059 CCACCCATCCCAGGGAAACATGG + Intronic
1200360995 X:155606065-155606087 GCACCCAACACAGGAGCACCCGG + Intronic
1200787521 Y:7273670-7273692 GCACCCAAACCCGGAAGATGGGG - Intergenic