ID: 907751790

View in Genome Browser
Species Human (GRCh38)
Location 1:57269831-57269853
Sequence CTGCCATACATGATTTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907751790_907751796 22 Left 907751790 1:57269831-57269853 CCTCCCTAAATCATGTATGGCAG No data
Right 907751796 1:57269876-57269898 TGTGACTGAGACAAGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907751790 Original CRISPR CTGCCATACATGATTTAGGG AGG (reversed) Intronic
No off target data available for this crispr