ID: 907751873

View in Genome Browser
Species Human (GRCh38)
Location 1:57270701-57270723
Sequence GACACTCCTGTGTTCATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907751873_907751876 23 Left 907751873 1:57270701-57270723 CCTGCAATGAACACAGGAGTGTC 0: 1
1: 0
2: 2
3: 15
4: 151
Right 907751876 1:57270747-57270769 TGTGATACTGCATTGTGTTGAGG 0: 1
1: 0
2: 2
3: 38
4: 296
907751873_907751877 24 Left 907751873 1:57270701-57270723 CCTGCAATGAACACAGGAGTGTC 0: 1
1: 0
2: 2
3: 15
4: 151
Right 907751877 1:57270748-57270770 GTGATACTGCATTGTGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907751873 Original CRISPR GACACTCCTGTGTTCATTGC AGG (reversed) Intronic
902248399 1:15137065-15137087 AACACTCCTGTGTGCATGCCTGG + Intergenic
905200467 1:36312403-36312425 GACATTCTTCTGTTTATTGCAGG + Intronic
907048514 1:51314554-51314576 GACACTCCTGTGATCCTTGAGGG + Intronic
907751873 1:57270701-57270723 GACACTCCTGTGTTCATTGCAGG - Intronic
908014770 1:59819568-59819590 GACACTCCAATGTCCATGGCAGG + Intronic
910366746 1:86473825-86473847 CTCACTCCTGATTTCATTGCAGG + Exonic
911717713 1:101153289-101153311 GACACTCCTGTCTTCTTTCTTGG + Intergenic
919993210 1:202723606-202723628 CAAACTCCTGTGCTCATTGGGGG - Intergenic
920924425 1:210328682-210328704 CCCACCCGTGTGTTCATTGCAGG - Intronic
922715745 1:227870503-227870525 GACACAGCTCTGTTCATTGAAGG - Intergenic
922721079 1:227900615-227900637 GACATTCCCGTGTCCATGGCGGG + Intergenic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1073470366 10:103718393-103718415 GTCTCTCCTGTGTGAATTGCTGG - Intronic
1083950302 11:65951149-65951171 TGTACTCCTATGTTCATTGCAGG - Intronic
1086432487 11:86748972-86748994 GACAGTTCTGTTTTCCTTGCTGG - Intergenic
1087503270 11:98987221-98987243 TGCACTCCTGTGTTTGTTGCAGG + Intergenic
1087677003 11:101175177-101175199 CACACTCCCGTGTTCATTGTAGG - Intergenic
1088198364 11:107301131-107301153 GACACTTCTGTGGTCATCGATGG - Intergenic
1089939605 11:122401957-122401979 TGCACACATGTGTTCATTGCAGG + Intergenic
1096977654 12:55708437-55708459 AGCACTGCTGTGGTCATTGCCGG - Intronic
1098386059 12:69920046-69920068 GAAGCTCCTGGGTCCATTGCAGG - Intronic
1098448032 12:70587688-70587710 GACACTGATGTGTTCATGGAAGG + Intronic
1104521627 12:129481020-129481042 CACATTCCTGTGTGCATTTCAGG - Intronic
1107815503 13:44240895-44240917 GACAGTGCTGTGTTCCTTTCTGG - Intergenic
1108920112 13:55662402-55662424 GACACTGCTCTGTTCATGGTGGG - Intergenic
1109402242 13:61849052-61849074 CATACTTCTGTGTTCATTTCAGG + Intergenic
1111685493 13:91496321-91496343 TGCACTCCTATGTTTATTGCAGG + Intronic
1112278875 13:98045341-98045363 GACACTCCAGTGTTCTCTGTGGG + Intergenic
1113812009 13:113148663-113148685 GCCACTCCTGTGTCCTTTGGCGG - Intronic
1113862099 13:113493235-113493257 GACACCTCTATGTTCATTTCTGG - Intronic
1115505981 14:34094604-34094626 GGCACCAATGTGTTCATTGCTGG - Intronic
1118887777 14:69880534-69880556 GACAGTATTGTGTTCATTTCTGG + Intronic
1121537938 14:94704023-94704045 GACACTCATGCGCTCACTGCAGG + Intergenic
1121762375 14:96456745-96456767 CACACACTTGTGTTCATTGCGGG - Intronic
1122727135 14:103764230-103764252 GACACACTGGTGTCCATTGCTGG - Intronic
1124452405 15:29807902-29807924 GAAATTCATGTGTTCATTGTAGG - Intronic
1125356745 15:38824609-38824631 AGCACTCCTATGTTCATTGCAGG + Intergenic
1133649773 16:7800940-7800962 GACACTCCTGACTTCAAAGCAGG + Intergenic
1135784522 16:25336608-25336630 TGCACTCCTGTGTTCATTGCAGG - Intergenic
1136428903 16:30185920-30185942 CACACTCCTGTGCTCTTTGGGGG + Intronic
1137032912 16:35541701-35541723 CACACTCATATGTTTATTGCAGG + Intergenic
1137496267 16:48971598-48971620 GACACTGCTGTGATCAGGGCTGG - Intergenic
1138204048 16:55111702-55111724 TGTACTCCCGTGTTCATTGCAGG + Intergenic
1139077413 16:63469144-63469166 TACACTCCTATGTTTGTTGCAGG + Intergenic
1141528229 16:84627156-84627178 GACAATCCTGTCTTCTTTGCAGG - Intergenic
1142873367 17:2835903-2835925 GACACTCCTGTTTTATCTGCTGG + Intronic
1143835179 17:9686265-9686287 TGCACTCCTGTGTTTACTGCAGG - Intronic
1144517498 17:15928784-15928806 GACACTCCTATGCTCATTTCTGG - Intergenic
1145956190 17:28856483-28856505 GAGACTCCTTTGTTCCTGGCAGG + Exonic
1148242046 17:46006131-46006153 GGCGCTCCTGTGTTGATTGCAGG + Intronic
1152614818 17:81333240-81333262 GACTCCCCTGTGCTCAGTGCAGG + Intergenic
1152799407 17:82323906-82323928 GCCACTCCTGTCTTCAGGGCTGG - Intronic
1153129320 18:1836501-1836523 GACACTCCCATGTTTATTGCAGG + Intergenic
1158686751 18:59621590-59621612 GACAATCCTGTGTTACTTGAAGG - Intronic
1162353184 19:10163994-10164016 GCCTCTCCTGTCTTCACTGCAGG + Intronic
1162353640 19:10166800-10166822 GCCTCTCCTGTCTTCACTGCAGG + Intronic
1165020117 19:32917323-32917345 GAAACTCCTGTGTGCATCTCTGG + Intronic
1166602778 19:44112884-44112906 AACACTCCTGTTATCATTGGAGG + Intronic
1166656825 19:44618372-44618394 CACACTCCTGTGTCCCCTGCTGG - Intronic
1167399716 19:49256797-49256819 GATACTCCAGTGTTTATGGCTGG - Intergenic
926630410 2:15130556-15130578 TATTCTCCTGTGTTCATTGGAGG - Intergenic
927143499 2:20145463-20145485 GGCACTCCTCTGTGCTTTGCTGG + Intergenic
930968597 2:57365034-57365056 TGCACTCCTGTGTTTGTTGCAGG + Intergenic
931309095 2:61061633-61061655 TACATTCTTGTGTTCATTGCAGG + Intergenic
932927639 2:75994898-75994920 GCAGCTCCTGTGTTCATTTCAGG + Intergenic
933351844 2:81162899-81162921 GAAACTCCTCTGTGCATTGAGGG + Intergenic
933943380 2:87263944-87263966 GACACACCTGTGTTGCTTTCTGG + Intergenic
935887609 2:107639874-107639896 TGCACTCCTATGCTCATTGCAGG - Intergenic
936336836 2:111597617-111597639 GACACACCTGTGTTGCTTTCTGG - Intergenic
936671862 2:114665463-114665485 GAAGCTGCTGTGTCCATTGCAGG + Intronic
939757113 2:146128220-146128242 TGCACTCATCTGTTCATTGCAGG - Intergenic
940460458 2:153958044-153958066 GTCAAACCTGTGTCCATTGCAGG - Intronic
944144004 2:196486502-196486524 GTCACTCCTGTGTATAATGCTGG - Intronic
944277897 2:197860324-197860346 TGCACACATGTGTTCATTGCAGG - Intronic
944847451 2:203682848-203682870 GACTCTGCTTTGTTCATTTCTGG - Intergenic
946229874 2:218284616-218284638 GAAACTGCTGTGTGCAGTGCAGG - Intronic
946876621 2:224136080-224136102 GACAGTCCTGTGATAAGTGCTGG + Intergenic
947463536 2:230322994-230323016 GACACTCCTGCAGTCCTTGCAGG - Intergenic
947472373 2:230411558-230411580 GACACTCCTGCTGTCCTTGCGGG - Intergenic
948182908 2:235997019-235997041 CACACTCCTGTCTTCATTATGGG - Intronic
948646994 2:239411557-239411579 GAGAGTCCTGTGTTCCTTGTGGG - Intergenic
1169556574 20:6757491-6757513 GAAACTCCAGTGTTCATTTTGGG + Intergenic
1169922078 20:10745996-10746018 TGCACTCCCGTGTTTATTGCAGG + Intergenic
1174674030 20:52336360-52336382 GACACTGCTGTCATCATTGCTGG + Intergenic
1176182249 20:63755645-63755667 GACAGTACTGTGATCATTGAGGG + Intronic
1179101237 21:38357134-38357156 CACCCTCCTGTGTTCCTAGCGGG + Intergenic
949345051 3:3068736-3068758 GACACTCCTCTGCACATTTCTGG + Intronic
949954443 3:9256056-9256078 GAGGTTCCTGTGTGCATTGCAGG - Intronic
951634412 3:24757180-24757202 AACATTCCTGTGTTCTCTGCTGG - Intergenic
955724131 3:61914476-61914498 TACACTGCTGTATTCATAGCAGG - Intronic
955777268 3:62447207-62447229 GACAATACTGTGTACTTTGCAGG + Intronic
958599118 3:96271318-96271340 TATACTCCAGTGTTTATTGCAGG - Intergenic
960593731 3:119389916-119389938 GGCACTGCTCTGTGCATTGCAGG + Intronic
961430536 3:126879309-126879331 GACATTGCTGTGGCCATTGCTGG + Intronic
961718343 3:128874525-128874547 GATACTTCTGTGTCCATTGCTGG - Intergenic
961909798 3:130302575-130302597 GTCAAACCTGTGTTCATTGTGGG + Intergenic
967688469 3:192445168-192445190 CACACTCCTCTGTGAATTGCTGG - Intronic
967770647 3:193330346-193330368 GCCACTGCTGTGTACAATGCTGG - Intronic
969270449 4:6096095-6096117 GGCACTCCTGTGTCCTTGGCCGG - Intronic
972690943 4:41397059-41397081 GGCATTCCTGTGCTCCTTGCTGG + Intronic
972897101 4:43636992-43637014 GTCATTCATGTGTTCATTCCAGG - Intergenic
975710101 4:77153111-77153133 GGCATTCCTGTCTCCATTGCAGG + Intergenic
977713095 4:100149875-100149897 GAGACTCATGGGCTCATTGCTGG + Intergenic
979933137 4:126657258-126657280 GTTACTCCTGTGTTCATTCTTGG + Intergenic
980466131 4:133185356-133185378 AACACTACTGTGCTCATTTCTGG + Intronic
983029246 4:162778904-162778926 GACACACCTCTGTTAATTTCAGG + Intergenic
983029275 4:162779260-162779282 GACACACCTCTGTTAATTTCAGG - Intergenic
986657112 5:10025015-10025037 TGCACTCCTATGTTTATTGCAGG - Intergenic
986991723 5:13561564-13561586 TTCACGCCTATGTTCATTGCAGG - Intergenic
991277070 5:64861532-64861554 CACACTTCTGTGTTCATATCAGG + Intronic
992264923 5:75009005-75009027 ACCACTCATGTGTTCATTGATGG + Intergenic
992415201 5:76546107-76546129 TAGACACCTGTGTTCATTTCTGG - Intronic
993252624 5:85548665-85548687 GGCACTCCTGTGACCACTGCTGG - Intergenic
996982944 5:129521941-129521963 CACCTTCCTGTCTTCATTGCTGG - Intronic
997287315 5:132689877-132689899 GAAACTCCTCTGGTCATTCCAGG - Intergenic
997739648 5:136242394-136242416 GCCACTTCTGTGTCCAGTGCTGG - Intronic
1000650587 5:163813567-163813589 GGCAGTTCTGTGTTTATTGCAGG + Intergenic
1001105622 5:168851698-168851720 GAAACTCCTGTGTTCGATCCTGG + Intronic
1002312360 5:178322723-178322745 GTCACTCATGTGGTCATTCCAGG + Intronic
1002956214 6:1867877-1867899 AACACTCCTGTGTTATTTGTAGG + Intronic
1004708468 6:18147364-18147386 GAAACTCCTGTGTTCCCTGGTGG + Intronic
1009035590 6:58114132-58114154 CTCCCTCCTGTGTTAATTGCAGG - Intergenic
1013433100 6:110073545-110073567 TGCACTCATATGTTCATTGCAGG + Intergenic
1015003213 6:128245664-128245686 CACCCTCCTGTGTTCATAGATGG - Intronic
1015345968 6:132159995-132160017 GACACTCTCCTGTTTATTGCAGG + Intergenic
1023134039 7:37033179-37033201 GACACTTCTGTGTGCAGTTCTGG + Intronic
1028296639 7:89140789-89140811 GTCATTCATGTGTTCATTGTAGG + Intronic
1031116115 7:117670585-117670607 GTCAATTATGTGTTCATTGCAGG - Intronic
1031677654 7:124631481-124631503 TAGACTCCTGTGTTCCTTGCTGG - Intergenic
1031697141 7:124872268-124872290 TGCACTCCCATGTTCATTGCAGG - Intronic
1034159847 7:148985420-148985442 GACAGTCCTGTGTTCATAGCTGG + Intergenic
1035639691 8:1175205-1175227 GACATTTCTGTGCTCACTGCGGG - Intergenic
1037648387 8:20814686-20814708 GCCACTCCTGTCTTCAGTGGGGG - Intergenic
1039120207 8:34137169-34137191 GACGCCCTTGTGTACATTGCAGG - Intergenic
1039761285 8:40578950-40578972 GACACCACTGTGATCAGTGCTGG + Intronic
1040341723 8:46444457-46444479 GAGACTCCGTTTTTCATTGCGGG + Intergenic
1042764638 8:72308013-72308035 GACACTGGTGTGGTCATTGAGGG + Intergenic
1044104967 8:88193098-88193120 TACACTCCCTTGTTTATTGCAGG + Intronic
1046359064 8:113126838-113126860 GAGCTTCCTGTGTTAATTGCAGG - Intronic
1047155807 8:122316710-122316732 GACACACCTGGGTTCAATCCTGG - Intergenic
1048280899 8:133104992-133105014 AACACTCCTTTGTTCATTAGAGG - Intronic
1050768473 9:9166321-9166343 GACTCTCTTGTGTTTATTCCTGG + Intronic
1051473709 9:17479236-17479258 AGGACTCCTGTGTTCATTGCAGG + Intronic
1051604474 9:18906724-18906746 GACTCTCCAGTGTACACTGCAGG - Exonic
1052012659 9:23429247-23429269 GACACTTCTGTGTTACTTGTAGG - Intergenic
1054712495 9:68525217-68525239 GAGACTCCTGTGGGCATTCCTGG - Intronic
1056067043 9:82947134-82947156 GACACTCCTGTCTTCTTGCCTGG + Intergenic
1056175749 9:84033726-84033748 CACACTCGTGTGTTAGTTGCAGG - Intergenic
1056830227 9:89910933-89910955 TGCACTCCCCTGTTCATTGCAGG - Intergenic
1057970083 9:99546522-99546544 GGCACTACTATGTTTATTGCAGG - Intergenic
1058087159 9:100760868-100760890 ATCACACCTGTGTTCAGTGCAGG + Intergenic
1058748257 9:108013328-108013350 GACAAGCATGTCTTCATTGCAGG - Intergenic
1059490140 9:114660033-114660055 GAGTCTCCTGTGTTCACTGCTGG + Intergenic
1059738134 9:117122725-117122747 GCTACGGCTGTGTTCATTGCTGG + Intronic
1062577573 9:137215718-137215740 GACACACCTGTGATCATGGTGGG + Exonic
1186300073 X:8191096-8191118 TAGACTTCTGAGTTCATTGCAGG + Intergenic
1186420751 X:9424026-9424048 TACACACCAGTGTTCATCGCAGG - Intergenic
1186810065 X:13179416-13179438 GCCACTTCTGTGCTCATTGCTGG - Intergenic
1190335383 X:49258603-49258625 GACACTCCTCTGGTCAAAGCAGG + Intronic
1190512550 X:51188470-51188492 TGCACTCCCATGTTCATTGCAGG + Intergenic
1191154950 X:57264726-57264748 TGCACACATGTGTTCATTGCAGG + Intergenic
1192910696 X:75601513-75601535 CATCCACCTGTGTTCATTGCTGG + Intergenic
1193218251 X:78890818-78890840 TTCACTCCTATGTTTATTGCAGG + Intergenic
1194430356 X:93795903-93795925 GACACACCTGTGTATATTACAGG - Intergenic
1194657885 X:96595698-96595720 GAGACTCCTGTGTAGATTTCCGG + Intergenic
1197424372 X:126277124-126277146 GAAAAACCTGTGTTCATTGATGG + Intergenic
1198800317 X:140440877-140440899 CACTCTTCTGTGTTCATTTCTGG + Intergenic
1199609689 X:149601890-149601912 GACACTCCAGTGTTACTGGCGGG - Intronic
1199629427 X:149767462-149767484 GACACTCCAGTGTTACTGGCGGG + Intergenic