ID: 907753365

View in Genome Browser
Species Human (GRCh38)
Location 1:57285224-57285246
Sequence CTGTGAGTAAAGAGCTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907753365 Original CRISPR CTGTGAGTAAAGAGCTAGCT TGG (reversed) Intronic
900013597 1:135127-135149 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
900043666 1:491110-491132 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
900065104 1:726113-726135 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
900946203 1:5832690-5832712 CTGTGAGTAAAGCACTTGCCCGG + Intergenic
902989593 1:20177303-20177325 CTGTAAGTAGAGAGCTTGGTGGG - Intronic
905247618 1:36625821-36625843 CAGGGACTAAGGAGCTAGCTGGG + Intergenic
905508916 1:38503030-38503052 CTGTGGGTAAAGAGCTTGCCTGG - Intergenic
905612933 1:39370981-39371003 CTGTGAGTAAAGCCATAGTTTGG + Intronic
906256327 1:44353726-44353748 CTGTAAATAATCAGCTAGCTAGG - Intronic
907753365 1:57285224-57285246 CTGTGAGTAAAGAGCTAGCTTGG - Intronic
907847598 1:58223412-58223434 AGGTGAGACAAGAGCTAGCTAGG + Intronic
917369476 1:174275113-174275135 GTGAGAGTCAAGAGCTGGCTTGG + Intronic
922100007 1:222472128-222472150 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
922100210 1:222472950-222472972 CAGTGAGGTGAGAGCTAGCTGGG + Intergenic
922100420 1:222473778-222473800 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
922262036 1:223951616-223951638 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
922734231 1:227970962-227970984 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
922735035 1:227974120-227974142 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
922768255 1:228167010-228167032 CTGGGTGTAAAAATCTAGCTTGG + Intronic
923357268 1:233171449-233171471 CTAGGAGTAAAGTTCTAGCTTGG + Intronic
924343208 1:243053793-243053815 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
1063095214 10:2903136-2903158 CTGTCAGTGCAGAGCTGGCTAGG - Intergenic
1065521247 10:26575492-26575514 CTGGGACTAGAGAGCAAGCTAGG + Intergenic
1066659603 10:37727422-37727444 CTGGGAGGAAAGAGCTGGGTGGG - Intergenic
1066733281 10:38451777-38451799 CAGTGAGGTGAGAGCTAGCTGGG - Intergenic
1069465127 10:68631611-68631633 CTGTGGGGAAAGAGCCAGCAGGG + Intronic
1073109087 10:101050251-101050273 CTGTGAGGAGGGAGCTGGCTGGG + Intergenic
1074249603 10:111731219-111731241 CATTGGGTAAAGAGCTATCTAGG - Intergenic
1076121269 10:127938524-127938546 CTGTGAGTACAAGGCTAGCTTGG + Intronic
1076121571 10:127940716-127940738 CTGTGAGTTCAAGGCTAGCTTGG - Intronic
1076969939 11:127341-127363 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
1078416533 11:11170802-11170824 CTGTGAGTGAAGAACCAGCTTGG + Intergenic
1079511392 11:21215362-21215384 CTGCTAATAAAGAACTAGCTGGG - Intronic
1079852399 11:25552550-25552572 CTATGTGCAAAGTGCTAGCTAGG + Intergenic
1080700308 11:34638831-34638853 CTGGGAGTCAAAAGCAAGCTGGG - Intronic
1084345654 11:68546543-68546565 CTGTGAGTTAAGATCAAACTTGG + Intronic
1084455964 11:69268379-69268401 CTGAGAGGAGAGAGCAAGCTGGG - Intergenic
1084539651 11:69777806-69777828 TTGTGAGTAAATGGCTGGCTAGG + Intergenic
1084645195 11:70452760-70452782 CTGGGAGTCAGGAGCTTGCTGGG - Intergenic
1090636586 11:128693749-128693771 CTGGGAGATAAGAGCTAGCCGGG - Exonic
1096195873 12:49648497-49648519 CTGTGAGGGATCAGCTAGCTTGG - Intronic
1097649619 12:62280828-62280850 CTGAGTCTAAAGAGGTAGCTAGG + Intronic
1099889993 12:88579486-88579508 CTGTGGGTAAAGCGCTGCCTGGG - Intronic
1102387358 12:112520805-112520827 CTGAGAGTCAAGAGCTGGTTAGG + Intergenic
1102921346 12:116793928-116793950 CTGTGAGTCAAGAGCAACCTAGG - Intronic
1105822650 13:24093665-24093687 CTGTGAGGAAACTGCTAGATAGG + Intronic
1110871421 13:80456655-80456677 TTCTGAGTAAAGATTTAGCTGGG + Intergenic
1112000608 13:95206134-95206156 CTGGAAGGAAAGAGCTTGCTGGG - Intronic
1112093363 13:96106492-96106514 CTGTCTGTAAAGAGCTGACTGGG - Intronic
1114528240 14:23379451-23379473 CTGTGAGGATAGAGCCAGGTAGG - Intronic
1115192259 14:30758213-30758235 CTGTTAAAAAAGAGCTAGTTTGG - Intergenic
1116323863 14:43505347-43505369 CTGTGTGTCAAGAGCCAGCAAGG + Intergenic
1119892823 14:78195825-78195847 CTGTCAATAAACTGCTAGCTGGG + Intergenic
1121691263 14:95878492-95878514 CTGTTAGTAAAGAGCAAGGGTGG + Intergenic
1123221675 14:106863293-106863315 CTGTGAGTAAAGAGCTCGCTTGG - Intergenic
1124366663 15:29076674-29076696 CTCAGAGTAAAGAGCTTGTTCGG + Intronic
1128475304 15:67992231-67992253 TTGTGGGTAAAAAGCTAGCTTGG + Intergenic
1130110513 15:80960021-80960043 CTGTCAGTGATGAGCTGGCTGGG - Intronic
1130324083 15:82865174-82865196 CTGTGAGTAAAGCCACAGCTGGG + Intronic
1132315395 15:100886542-100886564 CTGTGTGTCCAGAGCTGGCTTGG - Intronic
1132351677 15:101143158-101143180 ATGTCAATAAAGACCTAGCTGGG + Intergenic
1132501675 16:287186-287208 TTGTGAATAAAGAGTGAGCTTGG + Exonic
1134194006 16:12144512-12144534 CTGTTATAAAAGGGCTAGCTGGG + Intronic
1135755519 16:25094087-25094109 CTGTTTGGAAAGAGGTAGCTAGG + Intergenic
1137750648 16:50858912-50858934 CTCTGAGTTCAGAGCTAGCCCGG - Intergenic
1139229097 16:65265294-65265316 CTGTGAGTCTAGAGATGGCTAGG - Intergenic
1139841544 16:69885492-69885514 CTGTTTGTTAAGATCTAGCTTGG + Intronic
1142449688 16:90167684-90167706 CAGTGAGGCAACAGCTAGCTGGG - Intergenic
1142450741 16:90171791-90171813 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
1142456824 17:61900-61922 CAGTGAGACGAGAGCTAGCTGGG + Intergenic
1142956864 17:3528547-3528569 CTGTAAATATAGAACTAGCTGGG - Intronic
1143449587 17:7027842-7027864 TTCTGAGGAGAGAGCTAGCTAGG + Exonic
1147673956 17:42192464-42192486 CTGATGGTGAAGAGCTAGCTGGG - Exonic
1148715860 17:49715356-49715378 GTGTGAGTGAAGATGTAGCTGGG - Intronic
1149042064 17:52202168-52202190 CTGTGAGTACAGAAATACCTTGG + Intergenic
1149306737 17:55355151-55355173 CTGGGATTAAATAGCTAACTAGG - Intergenic
1149771721 17:59327771-59327793 CTCTGAGTAAAGTGCTATGTAGG + Intergenic
1149895516 17:60425883-60425905 CTGTGAGTAAAGAGCCAGCCTGG + Exonic
1160646741 19:197259-197281 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
1162578675 19:11514279-11514301 CTCTGAGGAAAGAGCCAGCCTGG - Intronic
1167805844 19:51784594-51784616 CTGTGAGACAAGAGTAAGCTTGG - Intronic
927945287 2:27131851-27131873 CAGTGAGGAAAGGCCTAGCTGGG + Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930493643 2:52109755-52109777 CTGAAAGTAAAGAGCTGGCCGGG + Intergenic
932641713 2:73454365-73454387 CAGAGAGTAAAGAGGTCGCTTGG + Intronic
935502924 2:103864000-103864022 CTATGAGGAAAGAGCTCACTAGG + Intergenic
939962549 2:148578217-148578239 CTGTGAGTAAAGAGGTCAGTAGG - Intergenic
941044008 2:160652413-160652435 CTCTGAGAAAGGAACTAGCTTGG - Intergenic
942562257 2:177232920-177232942 TGGTGAGTAAAGAGCCAGCTGGG - Intronic
943479549 2:188400668-188400690 CTGGAAGAAAAAAGCTAGCTAGG + Intronic
943683866 2:190796262-190796284 CTGGGAGGAAAGGGGTAGCTGGG - Intergenic
943955258 2:194180612-194180634 CTCTGACTATGGAGCTAGCTAGG + Intergenic
945283463 2:208059513-208059535 CTGGGAATAAAGAGCTGCCTAGG + Intergenic
946032363 2:216715396-216715418 CTGGGAAGAAGGAGCTAGCTGGG + Intergenic
947433044 2:230047172-230047194 CTGAGACTAAAGAGCCAGGTTGG - Intronic
1169378110 20:5083382-5083404 CTGAGAGGAAAGACCCAGCTAGG + Intronic
1169988370 20:11472232-11472254 CTGGAGGTAAAGAGCTACCTGGG - Intergenic
1170192449 20:13657736-13657758 CTGTGAGTGAAGGGCAAGCCTGG + Intergenic
1175822215 20:61916301-61916323 AAGTGAGCAAAGAGCTAGCGTGG - Intronic
1176278764 20:64288967-64288989 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
1180922051 22:19526024-19526046 CAGTGACTAAAGTGATAGCTGGG - Intronic
1181674694 22:24444143-24444165 CTTTGAGTACTGAGCTAGATGGG + Intergenic
949474634 3:4431720-4431742 CTGTGACTTCAGGGCTAGCTTGG - Intronic
950197900 3:11022188-11022210 CCGTGATTCAAGAGGTAGCTGGG - Intronic
951941223 3:28080877-28080899 CTATGAGTAAAGTGCTTTCTTGG - Intergenic
952539402 3:34351611-34351633 ATTTTAGTAAAGAGCAAGCTTGG + Intergenic
959112954 3:102143748-102143770 CTGGGAGTACAGAACTAGCCTGG - Intronic
963779932 3:149476856-149476878 CTGTGAGCCAAGATCTAGCCTGG - Intronic
964255392 3:154769411-154769433 GTGTGAGTAAAGGGATTGCTGGG + Intergenic
964820933 3:160768599-160768621 CTGTTTGTAAAGAGCTAGTCTGG + Intronic
965941180 3:174183458-174183480 GTTTGAGTAAATAGCTAGTTCGG - Intronic
966675569 3:182583710-182583732 CTGTGAGTCATGAGACAGCTTGG - Intergenic
968370940 3:198222263-198222285 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
973185593 4:47324389-47324411 CTGTGAGAAAAGAGGTAGACAGG - Intronic
976999133 4:91473562-91473584 CTGAGATAAAAGAGCTAGCTAGG - Intronic
977899221 4:102399279-102399301 ATGAGAGTAAAGAGATAGATAGG - Intronic
979259395 4:118633862-118633884 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
979259626 4:118634751-118634773 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
979328747 4:119405873-119405895 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
979328957 4:119406701-119406723 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
982757853 4:159245477-159245499 CTGTCACTAAAGAACTATCTTGG + Intronic
982839354 4:160162957-160162979 CTGTAAGTAAAGAGATATTTGGG + Intergenic
983750280 4:171259772-171259794 CTTTGAGTAATGAGATTGCTGGG + Intergenic
984428174 4:179614544-179614566 CTGTGAGGACACAGCAAGCTAGG + Intergenic
986232704 5:5881440-5881462 GTGTGAGGAAAGAGCCAGCCGGG + Intergenic
987508361 5:18801410-18801432 CAGTGAGTAAAGGGGTAACTTGG - Intergenic
996512158 5:124328736-124328758 CTGTTAGGAGACAGCTAGCTGGG + Intergenic
998566439 5:143220057-143220079 CTGTGGGTGAACAGCTAGCCAGG + Intronic
999517167 5:152313277-152313299 CAGTAAGTAAATAGCAAGCTGGG - Intergenic
999700586 5:154224265-154224287 CTGTGGCTAATGACCTAGCTGGG - Intronic
1001744390 5:174079972-174079994 CTCTGTGTGAAGAGCAAGCTGGG + Intronic
1002146953 5:177191348-177191370 CTGAAAGTAAAGTGTTAGCTGGG + Intronic
1002367227 5:178723079-178723101 CTGAGAGTGAAGAGGTAGCCAGG + Intronic
1002720028 5:181253344-181253366 CTTTTAATAAAGTGCTAGCTAGG + Intergenic
1002730177 5:181327819-181327841 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
1002754355 6:146280-146302 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
1005022016 6:21427378-21427400 CTGAGAGTAACTAACTAGCTGGG - Intergenic
1005979054 6:30822255-30822277 CTGTGTATAAAAAGCCAGCTAGG - Intergenic
1009628332 6:66164633-66164655 ATGTGATTAAAAAGTTAGCTCGG - Intergenic
1010013598 6:71078542-71078564 CAGTCAGAAATGAGCTAGCTGGG - Intergenic
1012818457 6:104054623-104054645 CTGCGAGTAGAGAGCCAGGTAGG - Intergenic
1013202191 6:107909664-107909686 CTGTGTGTCAAGAACCAGCTTGG - Intronic
1016012090 6:139147684-139147706 GTGTGAGTAAAGTGCTTCCTTGG - Intronic
1016223567 6:141706287-141706309 CTGTCAGTAAAGAACCAGGTTGG - Intergenic
1018719976 6:166565130-166565152 CTGGGAGAAAAGAGCAGGCTGGG + Intronic
1020128314 7:5545522-5545544 CTGTGAGGAAGGAGCTGGGTGGG - Intronic
1020150787 7:5680296-5680318 CTATGATGACAGAGCTAGCTGGG - Intronic
1020844115 7:13261277-13261299 TTGTCAGAAAAGAACTAGCTCGG - Intergenic
1023400837 7:39792391-39792413 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
1023401349 7:39794369-39794391 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
1023665084 7:42514494-42514516 CTGTGTGCCAAGAGCTGGCTTGG - Intergenic
1024074294 7:45810859-45810881 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
1024075334 7:45815013-45815035 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
1024648263 7:51386310-51386332 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
1024648792 7:51388383-51388405 CAGTGAGGCAAGAGCTAGCTGGG + Intergenic
1024649024 7:51389268-51389290 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
1025052117 7:55740779-55740801 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
1025129075 7:56366462-56366484 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
1025177464 7:56809351-56809373 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
1025177730 7:56810466-56810488 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic
1025694023 7:63765773-63765795 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
1025694328 7:63767037-63767059 CAGTGAGGTGAGAGCTAGCTGGG - Intergenic
1026669408 7:72375184-72375206 CCGTGAGAAAAGAGCCAGCTGGG - Intronic
1030750310 7:113224692-113224714 CTGGGAGCAAAGAGTTACCTAGG + Intergenic
1032051849 7:128654742-128654764 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
1043126760 8:76406123-76406145 TTGTGAGTAAAGAGCTACCTTGG - Intergenic
1043373095 8:79615285-79615307 CTGTGAGCAATGAGCTACCAAGG - Intronic
1048175432 8:132148291-132148313 CAGTGAGCCAAGAGCTAGCCTGG - Intronic
1049609645 8:143548510-143548532 CTGAGAGCAAAGTGCCAGCTTGG - Intergenic
1049919138 9:346979-347001 CTCTGAATACAGAGCTAACTGGG - Intronic
1050909438 9:11049036-11049058 CTATGAGTAAAGTGCAACCTTGG + Intergenic
1060431004 9:123551562-123551584 CTGTGTGTAAAGGGCTAGTGAGG + Intronic
1060511728 9:124239659-124239681 CTGTGAGTGAAGGGATTGCTGGG - Intergenic
1062754589 9:138280333-138280355 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
1203578495 Un_KI270745v1:24493-24515 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
1203654743 Un_KI270752v1:12535-12557 CTGTGAGCAAAAAGCCAGCCTGG - Intergenic
1186645656 X:11504614-11504636 ATGTGAGTAAAGATATAGTTGGG - Intronic
1187736264 X:22307024-22307046 ATGTGAGTAAAAAGTTATCTTGG + Intergenic
1189843671 X:45110265-45110287 ATGTGAGTACATAGTTAGCTGGG + Intronic
1195418060 X:104641770-104641792 CTGTGACTGAGGAGCAAGCTGGG - Intronic
1195867846 X:109452674-109452696 ATGTGAGTGAAGAGGTAGTTGGG + Intronic
1201854098 Y:18521540-18521562 CTGTGAGAAAAGGGATGGCTGGG + Intergenic
1201879223 Y:18798844-18798866 CTGTGAGAAAAGGGATGGCTGGG - Intronic
1202381132 Y:24277113-24277135 CAGTGAGGCGAGAGCTAGCTGGG - Intergenic
1202489653 Y:25393013-25393035 CAGTGAGGCGAGAGCTAGCTGGG + Intergenic