ID: 907754681

View in Genome Browser
Species Human (GRCh38)
Location 1:57300103-57300125
Sequence ACATGGAAGGCTCTGTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907754681_907754688 9 Left 907754681 1:57300103-57300125 CCCCTGCACAGAGCCTTCCATGT No data
Right 907754688 1:57300135-57300157 TGGCAACAAATATTTAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907754681 Original CRISPR ACATGGAAGGCTCTGTGCAG GGG (reversed) Intronic
No off target data available for this crispr