ID: 907754863

View in Genome Browser
Species Human (GRCh38)
Location 1:57301658-57301680
Sequence AATGAAATGCAGCTTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907754863 Original CRISPR AATGAAATGCAGCTTGTGGA AGG (reversed) Intronic
900757358 1:4445816-4445838 AGTGAAAAGCAGCTTGTTTATGG - Intergenic
901262605 1:7885158-7885180 AATGAAATAAAAGTTGTGGATGG - Intergenic
902596544 1:17513565-17513587 AACAAAATGCAGGTTGGGGAGGG + Intergenic
907529377 1:55078541-55078563 AATGAAATGCAGCATTGTGAAGG + Exonic
907584404 1:55604003-55604025 TATGAAATGCAGCATTTGCAAGG - Intergenic
907754863 1:57301658-57301680 AATGAAATGCAGCTTGTGGAAGG - Intronic
908251019 1:62265936-62265958 AATAAAATGAAGGTGGTGGATGG - Intronic
911168089 1:94743067-94743089 AATGACATCCACCTTGAGGAGGG - Intergenic
913082832 1:115404949-115404971 AAGGAAATGCAGCCTTTAGAGGG + Intergenic
915683139 1:157602151-157602173 AATAAAATGCGGCTTCTAGATGG - Intergenic
916000994 1:160615600-160615622 AAGGAAATGCACCCTGTGGTGGG + Intronic
916757243 1:167784365-167784387 AATGAAATGGAGGGTGGGGAGGG + Intronic
918251022 1:182703414-182703436 ATAGAATTGGAGCTTGTGGAGGG + Intergenic
918609925 1:186477561-186477583 AGTGAAATGCAGCATGTAAAAGG - Intergenic
919424166 1:197408448-197408470 AATAAAAGCCAGATTGTGGAGGG + Intronic
920455273 1:206096439-206096461 AAAGAAATGAAAATTGTGGAAGG - Intronic
921907305 1:220508731-220508753 AATGAACTGAATCATGTGGAAGG + Intergenic
923146361 1:231201479-231201501 AATGAAGTCCAGCTGGTGGATGG - Exonic
1065198809 10:23294038-23294060 AATTCAATGGAGCCTGTGGAGGG - Intronic
1065840024 10:29694911-29694933 AAGGAAAGGCAGCTAGAGGAAGG + Intronic
1067157060 10:43791168-43791190 AATGCAATCCTGCTTCTGGATGG - Intergenic
1069176315 10:65293221-65293243 AATGAAATACTGCTTTTGGCTGG - Intergenic
1069684716 10:70310284-70310306 AATGACCTGCATTTTGTGGATGG + Intronic
1070381452 10:75884007-75884029 ATTCAAAAGCAGCTTATGGAAGG - Intronic
1071708660 10:88027022-88027044 AAGGAAATAAAGCTTGTGGCCGG + Intergenic
1072428495 10:95350905-95350927 GATAAAATGCAGGATGTGGAGGG + Intronic
1072951904 10:99854729-99854751 AGTGAAATAAAGCTTGTGAAAGG - Intergenic
1073827611 10:107342897-107342919 AAGTAAGTGCAGCTTGGGGAAGG + Intergenic
1075427454 10:122352913-122352935 AATGAGGTGAAGCTTGTGCATGG + Intergenic
1076026842 10:127122484-127122506 AATGAGATGCTGCTTGAGGAAGG - Intronic
1076415890 10:130288234-130288256 AATGAACTGGAGCAGGTGGAAGG + Intergenic
1079505954 11:21152156-21152178 AATGGAATGCAGGGGGTGGAGGG + Intronic
1079589195 11:22162151-22162173 AATGAAATGTTACTTGTGGTTGG - Intergenic
1080497595 11:32835100-32835122 CTTGAAATGTAGCTTGTGGCTGG - Intronic
1081557153 11:44175347-44175369 AAAGAAAGGTAGATTGTGGAGGG - Intronic
1081570829 11:44289840-44289862 CATGAGATGGAGCTTGGGGATGG - Intronic
1083545938 11:63549449-63549471 GCTGAAAAACAGCTTGTGGAAGG - Intergenic
1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG + Intronic
1087474491 11:98619413-98619435 AAAGAAAAAGAGCTTGTGGAGGG - Intergenic
1087483233 11:98728686-98728708 AATGAAAGGCAGCCTGCAGACGG + Intergenic
1087692289 11:101335450-101335472 AAAGAAATGGAGCATGTGGTGGG + Intergenic
1087866572 11:103235198-103235220 AATTAAAGGCAGATTGTGAAAGG - Intronic
1088121704 11:106377788-106377810 AATCAAATGCAGATAGTGAAGGG + Intergenic
1088605768 11:111529716-111529738 AAAGAAATGCAGTTTGTATATGG + Intronic
1088964352 11:114702960-114702982 AATGAAATCCATCTGGGGGAAGG - Intronic
1089726735 11:120487468-120487490 AATGAAATGGAACGTGTGGGAGG - Exonic
1090090505 11:123692794-123692816 ACTGAAAGGCAAGTTGTGGAGGG + Intergenic
1091967757 12:4759789-4759811 AGTGAGATGCAGTTTCTGGAAGG - Intronic
1091995152 12:4987456-4987478 AATGAAAGTCAGCTAGTGGAGGG - Intergenic
1095520690 12:43061602-43061624 ATTGAAAGGGAGCCTGTGGAAGG - Intergenic
1097050577 12:56221046-56221068 AATGAAATGAAGTTTCTGAACGG + Intronic
1099659137 12:85533207-85533229 AAAGAAATGCAGCTTGTCCCTGG - Intergenic
1101321001 12:103673027-103673049 AATGAGATGGTGCATGTGGAAGG + Intronic
1102355568 12:112231953-112231975 AATGAAATGCAGTCTGTGTCGGG - Intronic
1103623012 12:122200356-122200378 ACAGAAGTGCAGCCTGTGGATGG - Intronic
1104625472 12:130350295-130350317 AATGAAATGTTGATTATGGAGGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106749078 13:32739334-32739356 AAGGAAAGACATCTTGTGGATGG - Intronic
1106871500 13:34026665-34026687 AAAGAAATGCAAGTTGTGGCAGG + Intergenic
1107277411 13:38691954-38691976 ACTGACAACCAGCTTGTGGATGG - Exonic
1107920243 13:45198747-45198769 AAAGAAACTCAGCTTGTGAAAGG - Intronic
1108503942 13:51092257-51092279 AATAAAATGCAGCTTATCGCAGG - Intergenic
1109624110 13:64952312-64952334 AATGGAATAGAGCTTGGGGAAGG - Intergenic
1113006257 13:105705885-105705907 AACGATATTCAGCTTCTGGAGGG + Intergenic
1113304926 13:109067322-109067344 AATGAGATGATGCTTGTGAAGGG - Intronic
1113385535 13:109844456-109844478 AATGAAATGCAGCAATTAGATGG - Intergenic
1115731167 14:36271453-36271475 AATGAAGAGCAGCATGTGGCAGG - Intergenic
1116965352 14:51009090-51009112 CACGAAATCCAGCTGGTGGATGG + Exonic
1117122023 14:52578446-52578468 AATAAAAAGGAGCTTATGGAAGG - Intronic
1117521527 14:56556423-56556445 CAGAAAATGTAGCTTGTGGATGG - Intronic
1118361739 14:65062899-65062921 CATGAAGTGCAGTGTGTGGAGGG - Intronic
1120523480 14:85551238-85551260 AATTAAAAGCACCTTGTTGATGG + Intronic
1120552958 14:85893597-85893619 AATGACAGGCACTTTGTGGATGG - Intergenic
1126532006 15:49720979-49721001 AATGAAATGCTTCATGTGAAAGG + Intergenic
1126804584 15:52333732-52333754 AATTAAATGTAGCTTGTAGGAGG + Intronic
1127213285 15:56797866-56797888 AATGAAATGCTTTTTGAGGATGG + Intronic
1127475798 15:59331679-59331701 AATGAAATTTAGATGGTGGAAGG - Intronic
1129646321 15:77436985-77437007 AGTGAAAGGCGGCTTGTGGCTGG - Intronic
1131335207 15:91542474-91542496 AAAGCAATGTAGTTTGTGGATGG + Intergenic
1131347978 15:91668814-91668836 AATCAAATTCAGGTTTTGGAAGG + Intergenic
1133860544 16:9590895-9590917 AATAAAATTCAGCTGGTGGAAGG + Intergenic
1134759902 16:16705092-16705114 AATGAAATGCAGGCTGGGCATGG + Intergenic
1134986170 16:18654113-18654135 AATGAAATGCAGGCTGGGCATGG - Intergenic
1135460806 16:22641072-22641094 AATGAACTTCAGCCTTTGGAAGG + Intergenic
1136588849 16:31204923-31204945 AAGGAAATGGAGATTCTGGAAGG - Intergenic
1137545713 16:49401822-49401844 CATGTAATACAGCTGGTGGAGGG - Intergenic
1137642253 16:50042780-50042802 AATGACATACAGTTAGTGGATGG + Intergenic
1137952122 16:52793332-52793354 ACTGAAATGCAGCAGTTGGAAGG + Intergenic
1138454155 16:57111810-57111832 AAAGAGTTGCAGCTTGAGGAAGG + Intronic
1138695354 16:58807900-58807922 AATGAAAGCCAGCCTGTGTAAGG + Intergenic
1139006006 16:62572403-62572425 ACTGAAATGCAGCTTTGGGGTGG - Intergenic
1139108074 16:63852682-63852704 AATGAAATTCAGCTACTGAAAGG + Intergenic
1140996146 16:80261380-80261402 CATGTAATGGAGCTTGTGCATGG - Intergenic
1142258790 16:89032470-89032492 ACTGAGATGTAGCGTGTGGATGG - Intergenic
1144487979 17:15683505-15683527 AATGAAAAGTAGCTTGTTGTAGG - Intronic
1144758978 17:17696668-17696690 AATGATATGCAGCTTGGGTCAGG + Intronic
1144913041 17:18698784-18698806 AATGAAAAGTAGCTTGTTGTAGG + Exonic
1145716374 17:27027109-27027131 AAGGAAGTGGAGCCTGTGGATGG - Intergenic
1146256788 17:31396219-31396241 AAAGAAATGCAGATTTTTGAGGG + Intronic
1147369960 17:39985562-39985584 AAGGAAATGCAGGTGCTGGAAGG - Intronic
1155191747 18:23436891-23436913 AAGGAAATGCTGTTTGTCGATGG + Intronic
1155961119 18:31995743-31995765 AAGGCTATGCAGCTTGTGGGTGG - Intergenic
1156390550 18:36646723-36646745 AGTGAAATGAAGCTTTTAGAAGG + Intronic
1159121973 18:64181539-64181561 AATGAAATATAGCATGCGGAAGG - Intergenic
1159392962 18:67818173-67818195 AATGAAATCCACATAGTGGAGGG - Intergenic
1160477480 18:79205529-79205551 AACAAAATACAGTTTGTGGAGGG + Intronic
1167228156 19:48263845-48263867 AATGAAATGCAGGCTGGGCACGG + Intronic
1167637035 19:50661304-50661326 AAGGAAATGCAGCGTGTGCGAGG + Intronic
926592493 2:14754507-14754529 AATGAAATTCATCTTGTCTAGGG + Intergenic
926624588 2:15080640-15080662 AGGGAAATTCAGCTGGTGGATGG + Intergenic
929992644 2:46802722-46802744 AGTGAAATGAAGATTGAGGATGG - Intergenic
930044370 2:47155888-47155910 AATGAAATTAAGGTTGTGGAGGG - Intronic
935570580 2:104656619-104656641 AGTTAAATGAAGCTTGTCGACGG - Intergenic
936729693 2:115365803-115365825 TTTGAAATGATGCTTGTGGATGG - Intronic
939169450 2:138677505-138677527 AATTAAATGAAGCAGGTGGAAGG + Intronic
940635838 2:156295588-156295610 AATGAAATTAAGCTTTTGGTAGG + Intergenic
940741527 2:157515050-157515072 AAAGAAATGCAGATTGGGGCTGG - Intergenic
941360457 2:164545232-164545254 AATGCAATGAAGTTTGTGGCAGG + Intronic
944679500 2:202064295-202064317 AATGAAATCCATATTGTGGAAGG - Intergenic
945179489 2:207077261-207077283 AAAGAAATGGGGCTTTTGGATGG - Exonic
946987727 2:225291915-225291937 AATAAAATGAAACTTTTGGAGGG + Intergenic
947105700 2:226665698-226665720 AATAAAATGCAGTTTGTGGGAGG - Intergenic
947501950 2:230677323-230677345 CTTGAAATCCAGCTTGTGGGTGG + Intergenic
948702645 2:239769886-239769908 AATCAAATGCATCTTCTGGCCGG - Intronic
1169548213 20:6672803-6672825 AATTTAATGCATCTTGAGGATGG - Intergenic
1171209165 20:23303675-23303697 GATGAAATGTGACTTGTGGAAGG - Intergenic
1173163509 20:40670040-40670062 AAAGAGAGGCAGCTTTTGGAGGG + Intergenic
1177149348 21:17438962-17438984 AATGAAATGCAGCTGGAGGATGG - Exonic
1177241007 21:18457262-18457284 AATGAAAGACAGCATGTGAATGG + Intronic
1177306228 21:19320474-19320496 AATTAAATGCAGAATGTGGCTGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1179677738 21:42995689-42995711 AATGAAATGTATCTTGTGGCAGG + Intronic
1179956472 21:44742194-44742216 AATCCAAGGCAGTTTGTGGAGGG - Intergenic
1182151566 22:28030767-28030789 ACTGGACTGCAGCTTGTGCAGGG - Intronic
1182480509 22:30605892-30605914 ATTGCAATGCAGATTGTGCATGG + Intronic
950775727 3:15348593-15348615 AACAAAATGCATCTTGTAGAAGG + Intergenic
950920996 3:16694639-16694661 TATGAAATTGAGCTTGTGAAAGG - Intergenic
950939634 3:16880120-16880142 AAAGAAATGCAGACTTTGGAAGG + Intronic
951304991 3:21048618-21048640 CAGGAAATGCAGCTTTTAGATGG - Intergenic
951391832 3:22114547-22114569 AATGAAAAGAAGCCAGTGGAAGG + Intronic
952009555 3:28884776-28884798 ATTGAAATGGAGCATATGGATGG + Intergenic
952198092 3:31097089-31097111 ATTGAAAATGAGCTTGTGGAAGG - Intergenic
952385213 3:32836205-32836227 GAGGAAATGCGGCTGGTGGAAGG - Intronic
953796142 3:45987436-45987458 AATCTAATTCAGCTTGGGGAAGG + Intronic
955452565 3:59085610-59085632 AATAAAATGCAGCCTGAGGGAGG + Intergenic
955761738 3:62292267-62292289 AATGAAATGCTGGTGGGGGAGGG - Intronic
955763675 3:62317609-62317631 AATGAAATAGAGCTTTTGCATGG - Intergenic
957525703 3:81376093-81376115 AAGGAAATGCAGCTGTTGGGTGG - Intergenic
957642772 3:82879310-82879332 AAGGAAATGTAGCAGGTGGAAGG + Intergenic
960189947 3:114691919-114691941 AATGAAAAGCTCCTTGGGGAAGG - Intronic
960244783 3:115388174-115388196 AAAGAAATGCAGCTCTTGGACGG - Intergenic
963087219 3:141449257-141449279 AAAGTAATGCAGCTTTAGGATGG + Exonic
964097038 3:152943945-152943967 AATGGAATGTAGGGTGTGGAGGG + Intergenic
964238185 3:154559170-154559192 AATGAAAAACAGCTTCTTGATGG - Intergenic
966030669 3:175343539-175343561 AAAGAAATGCAGATTGTAGAAGG - Intronic
967046811 3:185745107-185745129 AGTGCAAAGCAGCGTGTGGAGGG - Intronic
967531422 3:190553007-190553029 AATCCAATGCAGTTTGTGGAGGG + Intronic
967936822 3:194735226-194735248 AAAGAAAAGCAGCTTTTGTAAGG - Intergenic
970052203 4:11927095-11927117 AATAAAATGGAGCTTGTAAATGG + Intergenic
970755751 4:19424216-19424238 AATGAAATTCAGCTTTTCTATGG + Intergenic
974446584 4:61992210-61992232 ACTGAAGTCCAGCTTGTGAATGG - Intronic
977036286 4:91957841-91957863 ATTGAAATTCAGCCAGTGGAAGG - Intergenic
977271128 4:94918378-94918400 AAAGAAATGCAACTTCTGGATGG + Intronic
977648424 4:99440767-99440789 AATAAAATGTAGTTTGAGGAAGG + Intergenic
978329106 4:107592540-107592562 AATAAAATGCCACTTGTGCAGGG + Intronic
980569794 4:134599939-134599961 AGTGCAATGCAGTTTCTGGAAGG + Intergenic
980991315 4:139740895-139740917 CCAGAAAGGCAGCTTGTGGAAGG - Intronic
981828213 4:148969464-148969486 AATAAATTGTAGATTGTGGATGG - Intergenic
982021342 4:151208227-151208249 AAAGAAATTCCACTTGTGGATGG + Intronic
984951644 4:185012267-185012289 AAAGAAAAGCAGCAAGTGGAGGG - Intergenic
989786315 5:45335893-45335915 ATTTAAATGAGGCTTGTGGAAGG + Intronic
991491123 5:67183502-67183524 AAGGAAATGGAGGTTTTGGAAGG + Exonic
991562117 5:67964895-67964917 ACTGCAATGCAGTTTGTGAAAGG - Intergenic
991619858 5:68534273-68534295 AATGAATTGCAGCTTGTAAAAGG - Intergenic
991685078 5:69174343-69174365 AATGAAATTCAGGTTGTTGCAGG + Exonic
992102702 5:73422543-73422565 AGTGCAGTGCAGCTGGTGGATGG + Intergenic
993778333 5:92031318-92031340 AATGCAAAGCAAATTGTGGAAGG - Intergenic
996796154 5:127350636-127350658 AATGAAATACAAACTGTGGAAGG + Intronic
997460368 5:134047646-134047668 AATGGGTTGCAGCTTATGGATGG - Intergenic
997703013 5:135918022-135918044 AATGAGAGGAAGCTTTTGGAGGG + Intergenic
998952586 5:147406923-147406945 AATAAAGTGCAGCTTGGGGGAGG - Intronic
999218804 5:149958252-149958274 AATCAAAGGCAGCGGGTGGAGGG - Intergenic
999517701 5:152317559-152317581 AATCAAAAGCTGCATGTGGAAGG + Intergenic
1001727522 5:173918625-173918647 AACTAAATGCATCTTGTGCATGG + Intronic
1002793672 6:453158-453180 AATTAAATGCAGCTTTTGATGGG + Intergenic
1004511004 6:16284721-16284743 AAGAAAATGCAGCTAGTGGCTGG + Intronic
1004525708 6:16405451-16405473 GATGTCATGCACCTTGTGGATGG + Intronic
1004879210 6:19989489-19989511 AAAGCAATGCAGCCTGTGGCAGG - Intergenic
1005622035 6:27629094-27629116 AATGAAATTCAACTTGAGGCCGG + Intergenic
1005839648 6:29734133-29734155 AGTGAAATGCAGTTGATGGATGG + Intronic
1008365780 6:50678153-50678175 AAAGCATTGCAGCTTCTGGAAGG + Intergenic
1008817162 6:55581633-55581655 AATAAAAAGAAGTTTGTGGAAGG + Intergenic
1011525754 6:88263007-88263029 AATGAAAAAGAGCTTGTTGATGG - Intergenic
1012097499 6:94981543-94981565 AATGAATTGCAGTTAGTGAATGG - Intergenic
1012194050 6:96317327-96317349 AAAGAAAGAGAGCTTGTGGAGGG + Intergenic
1012423100 6:99085705-99085727 AATGAAAAGCAGCTAGTCAATGG + Intergenic
1013431559 6:110060953-110060975 CTTGAACTGCAGTTTGTGGAGGG - Intergenic
1013434540 6:110089113-110089135 ATTGAATTGCAGCCTTTGGAAGG - Intergenic
1013485471 6:110592197-110592219 AATGAAATACACATTGTAGACGG + Intergenic
1014694517 6:124602524-124602546 AAATAAATGCAAATTGTGGATGG + Intronic
1015966874 6:138703069-138703091 AATGAAATGCAGACTGGGCATGG + Intergenic
1017369136 6:153683964-153683986 AAAGAAAGACAGCTTGTGCAGGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017625074 6:156339759-156339781 AAAGAAATGCAGATGCTGGAAGG - Intergenic
1017765472 6:157603636-157603658 AAAGAAATGCTGCTTGTTAAGGG - Intronic
1020760863 7:12267081-12267103 AAGGAAAGGGAGCTTGTTGATGG + Intergenic
1022618063 7:31952742-31952764 AATGAGATGCCGCATGTGAATGG + Intronic
1022860795 7:34364513-34364535 AATGAAATGAAGCATGTAGCTGG + Intergenic
1024844456 7:53625460-53625482 AATAAACTGCCCCTTGTGGAAGG - Intergenic
1026197146 7:68183063-68183085 AATCAAATGCAGGTAGGGGATGG - Intergenic
1026510258 7:71021495-71021517 AATGAAATCCAGGTTCTGGGAGG - Intergenic
1026597815 7:71749087-71749109 AATGAAATGTGGCTGGTGCAAGG + Intergenic
1026851530 7:73726803-73726825 TGTGAAATGCAGCTAGTAGAGGG - Intergenic
1027333644 7:77126278-77126300 GATGAAATGTAGCTTATTGAGGG - Intronic
1027358893 7:77387714-77387736 AATAAAATGCAGCTTCTTCAGGG - Intronic
1027558014 7:79690603-79690625 AATGAAATGCACTTTGTGTGTGG - Intergenic
1027619701 7:80469060-80469082 ATTGAAATGTAGCTGCTGGATGG + Intronic
1027837947 7:83270006-83270028 TATAAAATGCAGAGTGTGGATGG + Intergenic
1028217095 7:88147028-88147050 AATTAAATGCATTTTGTAGATGG - Intronic
1029105461 7:98171647-98171669 CAGGAAGTGCAGCTTGTGCATGG - Exonic
1029782148 7:102745054-102745076 GATGAAATGTAGCTTATTGAGGG + Intergenic
1030379285 7:108793970-108793992 AGTGAAATGCAGCTTGAGACTGG - Intergenic
1033629006 7:143139101-143139123 AGTTAAATGCACCTTGTAGAGGG - Exonic
1034364339 7:150533606-150533628 GATGAAATGTAGCTTGTTGGAGG + Intergenic
1035981032 8:4372358-4372380 AATGGAAAACAGCATGTGGAAGG - Intronic
1039688458 8:39835271-39835293 GATGAAATGCAACATGTGAAAGG - Intronic
1040633779 8:49247986-49248008 AATGAAATGCAGCTAATTGGTGG - Intergenic
1041855523 8:62449336-62449358 AATGGAATACAGCAGGTGGATGG - Intronic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1045601286 8:103720064-103720086 ATTGAAATGAAGGGTGTGGAAGG + Intronic
1046283315 8:112062141-112062163 AATGAAATGTAAGTTTTGGAGGG - Intergenic
1046890268 8:119415099-119415121 AATCAAAGGCAGCTTGCGGAAGG - Intergenic
1048452323 8:134544212-134544234 AAGGATTTGCAGCCTGTGGAGGG - Intronic
1048699067 8:137066309-137066331 ACTGAAATGCAGTTTATGTAAGG - Intergenic
1049268674 8:141682825-141682847 CAGGAGATGCAGCTTGTGAAGGG + Intergenic
1050153571 9:2642134-2642156 AATAAAATGCTGCATGTTGAAGG + Intronic
1051339624 9:16099586-16099608 TCTGAGAAGCAGCTTGTGGAAGG + Intergenic
1052421501 9:28248485-28248507 AAGGATATGCAGATTGTTGACGG + Intronic
1052686329 9:31762424-31762446 AATGACATGCAGTTTCTGGCAGG + Intergenic
1053518483 9:38752918-38752940 AGTTAAATCCAGCTGGTGGAGGG - Intergenic
1055417232 9:76096896-76096918 AAAGAAATGCACCTTTTGGTGGG - Intronic
1057197936 9:93125400-93125422 ATAGAACTGCAGCTTGTGGCAGG - Intronic
1058645593 9:107128764-107128786 AATGAAATGCAACTTTTGTTAGG + Intergenic
1059160836 9:112033894-112033916 AATGAAAAGCCACTTCTGGAGGG - Intergenic
1059859654 9:118445098-118445120 AATAAAATGCAGCTTGCAGTTGG + Intergenic
1059936138 9:119312999-119313021 AATCAAAAACAGCTTGTGGAAGG + Intronic
1060647890 9:125297686-125297708 CATGAAATAAAGCCTGTGGATGG + Intronic
1061633542 9:131890004-131890026 AATGAAATGTGGCGTCTGGAAGG - Intronic
1187501735 X:19844593-19844615 AATGAAATGCAGGGCCTGGATGG + Intronic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188228572 X:27632387-27632409 AATAAAATGGAGCTGCTGGAGGG - Intronic
1188686998 X:33081583-33081605 AATGAAATGCAGGGTATGGCCGG - Intronic
1188994333 X:36864200-36864222 AATGAACTACACATTGTGGAGGG - Intergenic
1189600362 X:42617517-42617539 AATGGCAGGCAGATTGTGGAGGG - Intergenic
1189921652 X:45908601-45908623 AAAGAAAGGCAGCTTGTGGCAGG - Intergenic
1190680611 X:52824691-52824713 AATGAAATGCAGTTTTCTGAAGG + Intergenic
1191202464 X:57798657-57798679 AGTCAACTGCAGCTTGTGGTGGG + Intergenic
1191675271 X:63785984-63786006 CATGAAAGGTAGCTTGTTGATGG + Intergenic
1193692059 X:84658527-84658549 AATCCAATGCAGTTTGTGGAGGG + Intergenic
1194808886 X:98365409-98365431 AATGTAATCCAGATTGTGGTTGG - Intergenic
1195576609 X:106458799-106458821 AATGATATGCAGCTAGTATATGG - Intergenic
1196524287 X:116713519-116713541 GAGGCAATGCAGTTTGTGGAGGG + Intergenic
1199700512 X:150372087-150372109 AAAGAAATGCAGCCAATGGAGGG + Intronic