ID: 907755233

View in Genome Browser
Species Human (GRCh38)
Location 1:57304460-57304482
Sequence CCGTGAGACGGTGATGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907755233_907755238 3 Left 907755233 1:57304460-57304482 CCATGAGCATCACCGTCTCACGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 907755238 1:57304486-57304508 TGCCCTGGGAATTCAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907755233 Original CRISPR CCGTGAGACGGTGATGCTCA TGG (reversed) Intronic