ID: 907758922

View in Genome Browser
Species Human (GRCh38)
Location 1:57338420-57338442
Sequence CACAGCTACCATCTAAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 7, 3: 19, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907758922_907758924 25 Left 907758922 1:57338420-57338442 CCTCATTTTAGATGGTAGCTGTG 0: 1
1: 0
2: 7
3: 19
4: 145
Right 907758924 1:57338468-57338490 CATTTGTCCTTCTTTTGCAGTGG No data
907758922_907758923 2 Left 907758922 1:57338420-57338442 CCTCATTTTAGATGGTAGCTGTG 0: 1
1: 0
2: 7
3: 19
4: 145
Right 907758923 1:57338445-57338467 TATATGTATTAAAAAATAATAGG 0: 1
1: 1
2: 11
3: 143
4: 1344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907758922 Original CRISPR CACAGCTACCATCTAAAATG AGG (reversed) Intronic
902555121 1:17242348-17242370 CTCAGCTACCACCTGAAATGTGG + Intronic
904787575 1:32994204-32994226 CACAGCTCACAGCTAAAATGTGG - Intergenic
907758922 1:57338420-57338442 CACAGCTACCATCTAAAATGAGG - Intronic
912023068 1:105131140-105131162 CACATATACAAACTAAAATGTGG + Intergenic
916908685 1:169319521-169319543 CACAGGTCTCATCTAAAATACGG + Intronic
917336513 1:173929213-173929235 AACACCTACCATATAAAAAGTGG - Intergenic
920769931 1:208874305-208874327 CACAGATACCATCAGAAAGGAGG - Intergenic
921524407 1:216199807-216199829 CTCAGCTACCATCTGGAATCTGG - Exonic
922038525 1:221873330-221873352 CACAGCTACCTTCTTAACTCAGG + Intergenic
924170410 1:241333532-241333554 CTCATCTACCATATACAATGAGG + Intronic
1063049203 10:2427499-2427521 CACAGCTAACATCATAACTGAGG + Intergenic
1064523966 10:16233454-16233476 TACAGCTGCCATGTCAAATGTGG + Intergenic
1065278057 10:24106088-24106110 CACTGCCACCATCTGATATGTGG - Intronic
1066976288 10:42370939-42370961 CACAGCACCCAGCCAAAATGGGG - Intergenic
1068364118 10:56022379-56022401 CATAGATACCATTTATAATGTGG - Intergenic
1069092486 10:64217979-64218001 GACAGCTAACACCTCAAATGAGG + Intergenic
1070599835 10:77857819-77857841 CACAGCAACCATCCAATTTGTGG + Intronic
1073526689 10:104189634-104189656 CACAGCTTCAATATAAAATGTGG + Intronic
1073669253 10:105569134-105569156 CTAACCTACCATATAAAATGTGG + Intergenic
1076025044 10:127104912-127104934 CTCAGCTACCTTCTAATAGGAGG + Intronic
1076367678 10:129932693-129932715 CACAGAAACAAACTAAAATGTGG + Intronic
1079960296 11:26915255-26915277 CACAGCGACCTCCTAAAGTGAGG - Intergenic
1085539921 11:77257666-77257688 CACAGCTACCATTTGAGCTGAGG - Intronic
1085877427 11:80425680-80425702 CAGGGATCCCATCTAAAATGTGG + Intergenic
1086158679 11:83696191-83696213 CACTGCTGCCATCTAAGATCAGG - Intronic
1093177046 12:15924304-15924326 CACAGCTACCTTGGAAACTGAGG + Intronic
1098685778 12:73418382-73418404 CACAGATTCCATCCAAAATACGG - Intergenic
1099610907 12:84868632-84868654 CACACCTACCAAAGAAAATGAGG + Intronic
1105618013 13:22038522-22038544 CACATGTACCATTTAAAATGAGG - Intergenic
1106235103 13:27854588-27854610 CTCAGCTACCTGCAAAAATGTGG - Intergenic
1108424940 13:50290151-50290173 CACAGCTACCAATTAAACTATGG + Intronic
1109915480 13:68980064-68980086 CACAGCTATCATCCTTAATGGGG - Intergenic
1112414516 13:99193260-99193282 CACAGCTCCCATTTTAAAGGAGG + Intergenic
1112674303 13:101680866-101680888 CACAGGTACAATTAAAAATGTGG - Intronic
1115725782 14:36214919-36214941 CACAGCCACCTCCTAATATGTGG + Intergenic
1118811058 14:69274129-69274151 CAGAGCAACCCTCTAAAACGCGG - Intronic
1118963117 14:70553819-70553841 CACAGCTAGCATCATGAATGGGG + Intergenic
1123103386 14:105821184-105821206 CAGAGCTACAATCTAAAAGCAGG + Intergenic
1126205263 15:46038119-46038141 CATAGCTCCCATTTAGAATGAGG - Intergenic
1130088367 15:80797545-80797567 CACAACTAACATCGAAAGTGTGG - Intronic
1131334837 15:91538870-91538892 CAGAGCTAGAATCTAAAATAAGG + Intergenic
1131829042 15:96342818-96342840 CACAGATGCCATATTAAATGAGG - Intergenic
1132536963 16:486987-487009 CACAGCCGCCATCTAAAATTAGG - Intronic
1140562208 16:75996766-75996788 CACAGCTACCATATGGTATGTGG - Intergenic
1146733140 17:35212863-35212885 CACAGCTACCAATTACACTGAGG + Intergenic
1146783615 17:35698615-35698637 CACTGCAGCCATCTAAACTGTGG - Intronic
1146928845 17:36763837-36763859 CACAGTTACCATCCACTATGAGG - Intergenic
1147808106 17:43146907-43146929 CATGGTTCCCATCTAAAATGAGG - Intergenic
1148169632 17:45508227-45508249 CACAGGTCCCATCTAAAATGAGG - Intergenic
1148279578 17:46337586-46337608 CACAGTTCCCATCTAAAATGAGG + Intronic
1148301795 17:46555442-46555464 CACAGTTCCCATCTAAAATGAGG + Exonic
1148365717 17:47054429-47054451 CACAGTTCCCATCTAAAATGAGG + Intergenic
1148922842 17:51054409-51054431 CACTGCTCCCAGCCAAAATGTGG + Intronic
1150271888 17:63872134-63872156 CACAGCTACCCTCTACAGAGCGG + Exonic
1150400821 17:64854711-64854733 CACAGTTCCCATCTAAAATGAGG - Intronic
1150781002 17:68122113-68122135 CACGGTTCCCATCTAAAATGAGG - Intergenic
1151030119 17:70727757-70727779 CACAGCTGCAATCTAAATTAAGG + Intergenic
1153527556 18:6012142-6012164 CACAGCTAACATCTAGAAACTGG + Intronic
1154181908 18:12145533-12145555 CACAGCTGCCCTGTGAAATGAGG + Intergenic
1156925597 18:42574271-42574293 CACAGCTACGATGTGAAACGAGG + Intergenic
1160031671 18:75267183-75267205 CAGAGCTGCAATGTAAAATGAGG - Intronic
1163811597 19:19435982-19436004 CTCAGCTACCTTCCACAATGGGG - Intronic
1164282437 19:23780696-23780718 TAGAGTTACCATCTCAAATGTGG - Intronic
1166546510 19:43637303-43637325 AACAGATACCCCCTAAAATGTGG + Intronic
1167916499 19:52744166-52744188 CACAGCTGCAATGTCAAATGCGG + Intergenic
925481553 2:4280316-4280338 GTCTGCCACCATCTAAAATGAGG - Intergenic
927894034 2:26770029-26770051 CAGAGTCCCCATCTAAAATGAGG + Intronic
930219185 2:48728282-48728304 CACAGCTACCATGCAGAGTGGGG - Intronic
932972674 2:76564144-76564166 CACTGCTACCATCAATAATGAGG + Intergenic
935502463 2:103858061-103858083 CACTACTGCCATCTACAATGGGG - Intergenic
936584564 2:113743876-113743898 CACAAATACCATCTAAAACGTGG + Intronic
938276112 2:130025288-130025310 CACTGGTACTGTCTAAAATGAGG + Intergenic
938327068 2:130416045-130416067 CACTGCTACTATCTAAAATGAGG + Intergenic
938362871 2:130705432-130705454 CACTGCTACTATCTAAAATGAGG - Intergenic
938439260 2:131312061-131312083 CACTGGTACTGTCTAAAATGAGG - Intronic
942566900 2:177274734-177274756 CACAGCTAGTATCTAAACTCAGG - Intronic
943481417 2:188423977-188423999 CACAGCTTCCTCCTGAAATGAGG - Intronic
944243019 2:197504042-197504064 CACAAGTACCATGTAAATTGAGG + Intronic
945229219 2:207567146-207567168 CAAAACTACCAACTAAAATAAGG - Intronic
945692867 2:213063449-213063471 CACTAGTACCATCTAAAATATGG + Intronic
949077015 2:242066553-242066575 CACAGCTACCATCTTCTCTGAGG + Intergenic
1170195987 20:13690008-13690030 CACACCTGCCATCTCAGATGGGG - Intergenic
1173342396 20:42164143-42164165 CAAAGCTACCATCAAACATGGGG + Intronic
1175304035 20:57963882-57963904 CAAAGCTTCCATCTACAGTGAGG + Intergenic
1177135391 21:17301452-17301474 CACAACTACCATAAACAATGAGG - Intergenic
1178589812 21:33899957-33899979 CACAGCTACAATCTTATCTGTGG - Intronic
1182128756 22:27835290-27835312 CAGTGCTACCATCTGAAAAGAGG + Intergenic
1182839495 22:33376241-33376263 CACAGCTATCATCTAATAACAGG - Intronic
949886938 3:8702856-8702878 CACAGCAACCATGTAAGATGGGG - Intronic
950645130 3:14372570-14372592 CAGTTCCACCATCTAAAATGGGG - Intergenic
951255351 3:20443004-20443026 CACAGCTAATATTTCAAATGGGG + Intergenic
951905109 3:27698465-27698487 TATAGTTACTATCTAAAATGAGG - Intergenic
951915836 3:27799852-27799874 CACAGCTACCAACTAATACTAGG - Intergenic
953811191 3:46114251-46114273 CACAGCCACCACCAAGAATGTGG - Intergenic
955249585 3:57265760-57265782 CTCATCTTCCATCTAAAAGGTGG + Intronic
957134979 3:76275061-76275083 CACTTTTTCCATCTAAAATGTGG - Intronic
957174733 3:76792167-76792189 TAGAGCTAGCTTCTAAAATGTGG + Intronic
957174777 3:76792817-76792839 TAGAGCTAGCTTCTAAAATGAGG + Intronic
957274024 3:78066831-78066853 TGCAGCTATCATTTAAAATGAGG + Intergenic
960868756 3:122228780-122228802 CACAGCTACCATGTTGAAAGGGG + Intronic
963113643 3:141707496-141707518 CAGAGAAACCATCTAAACTGAGG - Intergenic
963485936 3:145934541-145934563 AACAGCTAAAATCTAAACTGTGG + Intergenic
964717731 3:159740438-159740460 CACAGCTTCCAACTAAGCTGAGG + Intronic
970089773 4:12391950-12391972 GACTGTTAACATCTAAAATGTGG + Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
977132335 4:93256159-93256181 TACTTCTACCATCAAAAATGTGG - Intronic
977426764 4:96876437-96876459 CTCCTCTACCATCTAAAATTAGG + Intergenic
978112778 4:104982967-104982989 CACAGCTAATATACAAAATGGGG + Intergenic
978382988 4:108150179-108150201 CACAGCAAGCAATTAAAATGTGG - Intronic
978652103 4:111018304-111018326 ACCAGCTGCCATTTAAAATGTGG + Intergenic
980004117 4:127521562-127521584 CACAGGTACCATGATAAATGTGG + Intergenic
984107627 4:175569414-175569436 CGCAGGTAGCATATAAAATGGGG + Intergenic
984377011 4:178944878-178944900 CACAGCTTCCATGTGAAAGGAGG + Intergenic
984860321 4:184231915-184231937 TACAGCTGGCATCTGAAATGGGG - Intergenic
985354015 4:189097666-189097688 CACATGTAACATGTAAAATGAGG + Intergenic
988890782 5:35614805-35614827 CACAGCTAACATATTGAATGGGG + Intergenic
991263185 5:64688699-64688721 TACAGCTACCACGTAAAATGAGG - Intergenic
995113353 5:108452650-108452672 GAAAGCTACCATAGAAAATGAGG + Intergenic
995725355 5:115176187-115176209 CACAACTAAAATCTAAACTGGGG - Intronic
998637534 5:143972540-143972562 AATAGCTATCAACTAAAATGGGG + Intergenic
1000009718 5:157219797-157219819 CACACCTCCCATCTTAAGTGAGG + Intronic
1000130815 5:158296437-158296459 AATAGCTACTACCTAAAATGTGG + Intergenic
1000293293 5:159891063-159891085 CATAGCTACCATCTTAGAGGGGG - Intergenic
1002850709 6:994376-994398 CACAGCTTCTATCTATAGTGGGG + Intergenic
1004398164 6:15264589-15264611 CACACCTACCTTCTAAACTGAGG - Intronic
1004761823 6:18675638-18675660 CACAGTGTCCATCTAAAATATGG - Intergenic
1005952583 6:30642762-30642784 CACAGCTACCTTCAGAACTGGGG - Exonic
1008891042 6:56491153-56491175 CACACCTCCCATTCAAAATGGGG + Intronic
1009688741 6:66998608-66998630 CACAGATACAAGCTACAATGTGG + Intergenic
1010363308 6:75020107-75020129 CACAGCTAGTATATTAAATGGGG - Intergenic
1012619306 6:101321000-101321022 TAGAGCTACCATATAAAATATGG - Intergenic
1012620317 6:101336564-101336586 CACAGCTACTATACTAAATGGGG - Intergenic
1013617864 6:111861406-111861428 CACAACTACCACCTTAAATGTGG - Intronic
1014643900 6:123949906-123949928 CACAGCTAACATATTGAATGTGG - Intronic
1016112702 6:140245361-140245383 CACAGCTACCATTTAAATCCAGG - Intergenic
1018438970 6:163790789-163790811 CAAAGCTACTATGTAAAATGAGG + Intergenic
1020188416 7:5975844-5975866 CTCAGCTGCCATCTAAAAGGTGG - Intronic
1020294499 7:6748925-6748947 CTCAGCTGCCATCTAAAAGGTGG + Intergenic
1020625792 7:10577879-10577901 CACAGTTTCAAACTAAAATGGGG + Intergenic
1021389832 7:20078419-20078441 AACAGCTACAAGCTAATATGTGG - Intergenic
1021927989 7:25551772-25551794 CCCACCTACCCTCCAAAATGTGG + Intergenic
1022038714 7:26558800-26558822 CACAGCCACCCCCTAGAATGAGG + Intergenic
1022272203 7:28819624-28819646 CACAGCTTTTAGCTAAAATGAGG + Exonic
1022772666 7:33491294-33491316 CAAAGCTACCACATTAAATGTGG + Intronic
1028000603 7:85493278-85493300 CACAGCTAGCTTTTAAAATAAGG - Intergenic
1031281022 7:119799264-119799286 TACAGGTACCATCTCATATGTGG + Intergenic
1031565902 7:123296667-123296689 GGCAGCTATGATCTAAAATGAGG - Intergenic
1031939017 7:127767368-127767390 CACAGCTGCCTTCTTATATGTGG + Intronic
1032710974 7:134459657-134459679 CACAGCTAACACCTAGAGTGGGG - Intergenic
1037056474 8:14448248-14448270 CACTGGTACCGTCTAAAATGAGG + Intronic
1039714287 8:40091372-40091394 CACAGCTACTAAATATAATGTGG - Intergenic
1042259921 8:66848123-66848145 CAGAGCTACCAGCTGAACTGGGG - Intronic
1042423482 8:68619596-68619618 AAAAGGTACCATCTAAAATAAGG + Intronic
1044913787 8:97090428-97090450 ACAAGCTATCATCTAAAATGGGG - Intronic
1045750493 8:105478119-105478141 GACATCTTCCATCTTAAATGCGG + Intronic
1049079090 8:140427449-140427471 CAAAGCTACCTTCTAAAAGCTGG - Intronic
1050139458 9:2502380-2502402 TACAGCTAGCATCTAAAGTGAGG - Intergenic
1050712920 9:8486235-8486257 CAGGGCTACCGTCTAAAATTTGG - Exonic
1051671117 9:19511779-19511801 CACAGCTGCCACCTATAATAGGG + Exonic
1057447861 9:95130876-95130898 CACATCTATCATGTACAATGAGG + Intronic
1057477690 9:95417275-95417297 CAAAGCAAACATATAAAATGAGG + Intergenic
1062347103 9:136119780-136119802 CACAGCTACCTTCTCCACTGTGG + Intergenic
1185577030 X:1182586-1182608 CACTGCTGCCATAAAAAATGGGG - Intergenic
1186588965 X:10908608-10908630 GATAGCTATGATCTAAAATGGGG - Intergenic
1186761465 X:12727510-12727532 CACATCTACAGTCTCAAATGAGG + Intergenic
1187102030 X:16203042-16203064 CACAGCTTCCAACTAAATAGAGG - Intergenic
1192055549 X:67769593-67769615 CACAGCCACCATACAAAGTGTGG + Intergenic
1192179454 X:68907272-68907294 CACAGACAGCATCTAATATGGGG + Intergenic
1196007100 X:110848779-110848801 TACAGCTACCATGTAAATTGAGG - Intergenic
1198040037 X:132841607-132841629 GTGAGCTACCATATAAAATGGGG + Intronic
1199397558 X:147357226-147357248 CTCTGCTACCATGTAAGATGTGG + Intergenic
1201972991 Y:19816521-19816543 CACAACTACTAACTAACATGTGG - Intergenic