ID: 907762259

View in Genome Browser
Species Human (GRCh38)
Location 1:57372863-57372885
Sequence TTCTTTAAGGTAGACATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907762259_907762265 29 Left 907762259 1:57372863-57372885 CCTTCCATGTCTACCTTAAAGAA 0: 1
1: 0
2: 0
3: 17
4: 236
Right 907762265 1:57372915-57372937 GCCTATAATCCCAGCACTTTGGG 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
907762259_907762262 -2 Left 907762259 1:57372863-57372885 CCTTCCATGTCTACCTTAAAGAA 0: 1
1: 0
2: 0
3: 17
4: 236
Right 907762262 1:57372884-57372906 AAATAAAGCAAGTCTGAGCATGG 0: 1
1: 0
2: 4
3: 51
4: 731
907762259_907762264 28 Left 907762259 1:57372863-57372885 CCTTCCATGTCTACCTTAAAGAA 0: 1
1: 0
2: 0
3: 17
4: 236
Right 907762264 1:57372914-57372936 TGCCTATAATCCCAGCACTTTGG 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
907762259_907762263 1 Left 907762259 1:57372863-57372885 CCTTCCATGTCTACCTTAAAGAA 0: 1
1: 0
2: 0
3: 17
4: 236
Right 907762263 1:57372887-57372909 TAAAGCAAGTCTGAGCATGGTGG 0: 1
1: 0
2: 2
3: 50
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907762259 Original CRISPR TTCTTTAAGGTAGACATGGA AGG (reversed) Intronic
900830844 1:4964128-4964150 TTCTTTAATTTAGAAATAGAAGG - Intergenic
906196180 1:43932024-43932046 TTATTTCCGGTAGAAATGGAGGG - Intergenic
907762259 1:57372863-57372885 TTCTTTAAGGTAGACATGGAAGG - Intronic
907788085 1:57633633-57633655 TTCTTTAAAGTAGAGATTGTTGG - Intronic
907830250 1:58057951-58057973 TTCCCTAAGCTAGACTTGGATGG - Intronic
908987045 1:70036815-70036837 TTGGTTAAGGAAGACATGGTAGG + Intronic
909198211 1:72653608-72653630 TTCATTAAAATAGACAGGGATGG + Intergenic
909207086 1:72771944-72771966 TTTTTTATGATAGCCATGGAGGG - Intergenic
909497025 1:76289863-76289885 TTCTTGAAGCTAGTCATGAAGGG + Intronic
909788871 1:79647960-79647982 TTCTTAAAGATAGACCAGGATGG - Intergenic
910487151 1:87727823-87727845 ATCTTTAAGGTACACATGGTAGG + Intergenic
910807824 1:91206150-91206172 TTTTTCAATGTACACATGGAGGG - Intergenic
913131674 1:115843172-115843194 GTCTCTAAGGGAGACATGAAAGG - Exonic
916297918 1:163240526-163240548 TTTTTTAAGAGAGAGATGGAGGG + Intronic
917102213 1:171457860-171457882 TTCATTCAGGTAGAAATGGTAGG + Intergenic
917537525 1:175885053-175885075 TTCTTTAGGGGATACAAGGAAGG - Intergenic
919481213 1:198091950-198091972 TTCTTGAAGGGAGATATGAATGG + Intergenic
919798696 1:201337505-201337527 TTCTTTTAGGTGAACAAGGAAGG + Intergenic
920749288 1:208658775-208658797 TTGTTGAAGGTAGAAAGGGAGGG - Intergenic
921635647 1:217489107-217489129 TTTTTTTTGGTAGAGATGGAGGG + Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1063309060 10:4935867-4935889 ATTTTTAAGGTGGACATGGCAGG + Intronic
1063411784 10:5841890-5841912 TTCTTTGATGTATACATGAAGGG - Intronic
1063591358 10:7398912-7398934 TTCTGTAAGCCAGACATGCATGG + Intronic
1064634942 10:17355798-17355820 TAATTTCAGGTAGACAAGGAAGG - Intronic
1066224186 10:33366230-33366252 GTTTTTAAGGGAGACATGGAGGG - Intergenic
1066287975 10:33987214-33987236 TTCTTTAAAATAGACATTGTTGG + Intergenic
1068680427 10:59813639-59813661 TTCTCAAGGGTAGACCTGGATGG - Intronic
1070919287 10:80174024-80174046 TTCTTCAAGATAGATATGAAGGG - Intronic
1074076530 10:110131388-110131410 TTGTTTAAGGTACACATTTAGGG + Intronic
1074209507 10:111316926-111316948 TTTTTTAAAGAATACATGGAAGG - Intergenic
1075220502 10:120580519-120580541 TTCTTAAAGATAAACAGGGAGGG + Intronic
1075906142 10:126083550-126083572 TCCTCTAAGGTACACCTGGAAGG - Intronic
1078188974 11:9075908-9075930 TTCTGGAAGGGACACATGGAAGG + Intronic
1078319532 11:10321868-10321890 TCATTTAAAGTAGAAATGGAAGG - Intronic
1080662302 11:34307071-34307093 TTCATTCAGGGAGACATGCAGGG - Intronic
1081308016 11:41537099-41537121 TTCAGTAAGGTAGTCACGGAAGG + Intergenic
1082812764 11:57488626-57488648 TTCTTCAGGGTGGGCATGGAGGG + Intronic
1083007202 11:59357840-59357862 TACTTAAAGGAAGAAATGGATGG - Intergenic
1083096987 11:60261013-60261035 TTAGATAAGGTAGACATGTAAGG - Intergenic
1086070718 11:82795956-82795978 TGCTCTAAGCTAGATATGGAAGG - Intergenic
1086806514 11:91250429-91250451 TTTTTTAAGTTAGTCATAGAAGG + Intergenic
1087343950 11:96945498-96945520 TATTTTAAGGTAGACACTGATGG + Intergenic
1087362114 11:97174156-97174178 CTCTTACAAGTAGACATGGAGGG - Intergenic
1087676727 11:101171471-101171493 TAGTTTAAGGAAGAAATGGAAGG - Intergenic
1088747999 11:112820607-112820629 TGCTTTTAGGTAGAAAGGGAAGG - Intergenic
1093261465 12:16942584-16942606 TTCTTCATGGTAGATATTGATGG + Intergenic
1093491661 12:19711582-19711604 TTATTTGCGGTAGACATGGATGG + Intronic
1093503679 12:19839773-19839795 TTCTTTAAGATAGATAGTGACGG + Intergenic
1095463103 12:42462724-42462746 TTCTGTAATGTAGACAGGAAAGG - Intronic
1095680544 12:44970318-44970340 TTCTTGAATGTAGACATCAAGGG - Intergenic
1095695386 12:45137961-45137983 TTTTTTCAGCTAAACATGGATGG - Intergenic
1096863210 12:54545260-54545282 TTCTGCAAGGTAGCCAGGGAAGG + Exonic
1097260433 12:57716754-57716776 TTCAGTAAAGGAGACATGGAAGG - Intronic
1097382290 12:58909326-58909348 TTCTTTAATGTAGTCAGGAAAGG - Intronic
1097693346 12:62754701-62754723 TTCTTTTAGCTGGACAAGGAAGG - Intronic
1098027117 12:66215356-66215378 TTCTTTAAGAAAGAAAGGGAAGG - Intronic
1099214906 12:79841675-79841697 TTCTTTAAAGTAAACATTTAAGG - Intronic
1100277326 12:93082974-93082996 TTTTTTAATGTGGGCATGGAGGG + Intergenic
1100317365 12:93457221-93457243 TTTTTTAATGTAGAGATGGGGGG - Intergenic
1106341527 13:28833177-28833199 TTCAAGAAGGTAGACAAGGAGGG + Intronic
1107103125 13:36615371-36615393 TTCTTTAAAGTAGAAATTAAAGG - Intergenic
1108310304 13:49182893-49182915 TTCTTCAAGACAGAAATGGAAGG - Intronic
1109692077 13:65907616-65907638 TTCTTTAATGTTGACATAGTGGG + Intergenic
1112464253 13:99629692-99629714 TTCTTTAAAGTGGACACAGATGG + Intronic
1113873228 13:113577212-113577234 TCCTTCAAGGTTGAAATGGAAGG + Intergenic
1115183886 14:30662330-30662352 TTCTTTAATGTAGGCGAGGATGG + Intronic
1115333473 14:32222155-32222177 TTCTTTATGGTAATCATGGGAGG - Intergenic
1117451545 14:55855143-55855165 TTCTCTAAGGTATACAAGTACGG + Intergenic
1119354543 14:73994854-73994876 TTAAATAAGGTAGACAAGGAAGG - Intronic
1120816020 14:88859137-88859159 TTCTTTAATGTATGAATGGATGG + Intronic
1122025593 14:98873416-98873438 TTATAGAAGGTAGACAAGGAAGG - Intergenic
1122031773 14:98917586-98917608 TTCCTTTAGGTAGAAAGGGATGG - Intergenic
1122162490 14:99794017-99794039 TTCATTAAAGTAGACCTGAATGG - Intronic
1123671129 15:22659223-22659245 GTCATTAAGGTAGACAAAGATGG + Intergenic
1124323170 15:28732448-28732470 GTCATTAAGGTAGACAAAGATGG + Intronic
1124527065 15:30465596-30465618 GTCATTAAGGTAGACAAAGATGG + Intergenic
1124659414 15:31533635-31533657 TTCTTTAAGGTAGGCTTGCTAGG - Intronic
1124771588 15:32542087-32542109 GTCATTAAGGTAGACAAAGATGG - Intergenic
1126290833 15:47076176-47076198 TTCTTGAAGACAGACATGAAAGG + Intergenic
1127599864 15:60524563-60524585 CTCTTAAAGGTACACATGGGAGG - Intronic
1127734480 15:61828564-61828586 TTTTTTAATGTAGAGATGGCGGG + Intergenic
1128241275 15:66102750-66102772 TTTCTTTAGGTAGACAGGGAGGG + Intronic
1128458154 15:67844616-67844638 TTCTTTAAGGTAAAAATAGCAGG + Intergenic
1128599188 15:68981230-68981252 TACTCTCAGGTAGACATTGATGG + Intronic
1129421821 15:75434140-75434162 TTATTTAAGGCACACATGCAGGG + Intronic
1132513607 16:355579-355601 TTCTTCAATGTAGACATAAAAGG + Intergenic
1136460128 16:30405185-30405207 TTCTTTAATGCAGGCAGGGAAGG - Intergenic
1137327691 16:47458651-47458673 GTTTTTAAGGTTGACTTGGAAGG - Intronic
1137905631 16:52319206-52319228 TTAAGTAAGGTAGACAGGGAAGG + Intergenic
1140186754 16:72780376-72780398 ATCTGTAAGGTAGACAAGGTGGG - Intergenic
1140915203 16:79487300-79487322 TTTTTTAAGGGAGGCATCGACGG + Intergenic
1146251632 17:31350753-31350775 TTCTATAATGTAGACATAGATGG + Intronic
1147510681 17:41066381-41066403 ATCTTTAAGTGAGTCATGGAAGG - Intergenic
1147814388 17:43198352-43198374 TTGTTTAAAGTATACATGTAAGG + Intronic
1148842133 17:50505839-50505861 TTCTTGAAGGGAGACAGGAATGG - Intergenic
1148996424 17:51714208-51714230 CTCTTTAAGAAAGAGATGGATGG - Intronic
1149377776 17:56063187-56063209 TTCTCTAAGGTTGAAATGAAGGG - Intergenic
1150019519 17:61596945-61596967 TTCTTCCAGGTAGACATAGCTGG - Intergenic
1151036001 17:70800703-70800725 TTATTTAAGGTAGATTTGCAGGG - Intergenic
1154008665 18:10557270-10557292 GTCTCTAAAGTAGGCATGGAGGG - Intergenic
1155604638 18:27590581-27590603 TTTTTTAAGGTAGATATTTATGG + Intergenic
1157298982 18:46466169-46466191 TTCTTTAAAGTAGACCCTGAGGG + Intergenic
1158962751 18:62600293-62600315 TTCTTTCAGGAAGAAATGGAGGG + Intergenic
1160801467 19:972030-972052 TTATTTGAGGTAGATGTGGAGGG - Exonic
1163918952 19:20270059-20270081 TCCTTTAAAGTAGACACAGATGG - Intergenic
1164100970 19:22053969-22053991 TTCTTTAAAGTAGAAATCCAGGG + Intronic
924980772 2:219033-219055 TTCTTTAAGGGAGAAATTGGGGG + Intronic
926900450 2:17746054-17746076 ATTTTTAAGGTAAAAATGGATGG - Intronic
928613985 2:33018239-33018261 TGTTTTAAGGAAGACATGGATGG - Intronic
931976706 2:67651210-67651232 TTCTCTAAGGAAGAGATGGGAGG + Intergenic
932235646 2:70119149-70119171 TTATTTAGGGTAGGCAGGGAAGG + Intergenic
932300470 2:70663492-70663514 TTCTTTGAGGGAGACTTGGAAGG + Exonic
932402333 2:71489619-71489641 TTCTTCAGGGTAGCCATGCATGG + Intronic
932536811 2:72606433-72606455 TTTTTTCAAGTAGAGATGGATGG - Intronic
932633248 2:73365053-73365075 TTCTTAAAGGTAGGAATGCAGGG - Intergenic
934620723 2:95803064-95803086 TTGCTTAAGGTATACATTGAAGG + Intergenic
934812716 2:97296653-97296675 TTGCTTAAGGTATACATTGAAGG - Intergenic
934824978 2:97411819-97411841 TTGCTTAAGGTATACATTGAAGG + Intergenic
935524865 2:104153143-104153165 GTCTTGAATGTAGACATGTAAGG + Intergenic
935550607 2:104449555-104449577 TGCATAAAGGAAGACATGGAAGG - Intergenic
935785785 2:106547504-106547526 TTCATTAAGGTAGCCAAAGATGG + Intergenic
936547266 2:113403481-113403503 TTGCTTAAGGTATACATTGAAGG - Intergenic
936705876 2:115073093-115073115 TTCTTTAAGATAGAAATAGTAGG + Intronic
938222824 2:129586720-129586742 TTTTTTAAAGTAGACATTGCTGG + Intergenic
939110979 2:138007172-138007194 TTCTTTTAGGAAGAAATAGATGG - Intronic
940342760 2:152598713-152598735 TTCTTTATTGAAGAAATGGAAGG + Intronic
940838807 2:158555332-158555354 TTCTTTAATATACACATGTATGG - Intronic
941443312 2:165566384-165566406 TTATCTAAGGTAGTCATGGTGGG - Intronic
942628419 2:177928982-177929004 CTCTTTTAGGTCGACATGGGGGG + Intronic
946555975 2:220857861-220857883 TTCTTTAAAATAGAGATGGAAGG + Intergenic
947126797 2:226877590-226877612 TTCTTTTAAGTAAACATGGCAGG + Intronic
948879180 2:240847457-240847479 TTATTTAGGGTTGACAGGGAAGG - Intergenic
1169306374 20:4494452-4494474 TACTCCAAGGTAGAAATGGAAGG + Intergenic
1171538612 20:25923541-25923563 TTCTTGAAGACAGACATGAAAGG - Intergenic
1171802418 20:29636739-29636761 TTCTTGAAGACAGACATGAAAGG + Intergenic
1171989680 20:31686193-31686215 TTATTTTATGAAGACATGGATGG + Intronic
1172333208 20:34090920-34090942 TTTTTTTTGGTAGAGATGGAGGG + Intronic
1172982154 20:38951530-38951552 ATCTTTAAGTTTTACATGGACGG + Exonic
1175093769 20:56525544-56525566 CTCTTTCAGGTAGAAAAGGAAGG + Intronic
1175991118 20:62789758-62789780 TTTTTTTTGGTAGAGATGGAGGG + Intergenic
1177169010 21:17635039-17635061 TTCTATAGGGAAGAAATGGATGG + Intergenic
1178112185 21:29379523-29379545 TGCTTTAAGTCAGACTTGGAGGG + Intronic
1184418717 22:44366939-44366961 TTATTTAAGGAAGATATGGTTGG - Intergenic
949334891 3:2963630-2963652 TTCTTTAGGTTAAACATGGAAGG - Intronic
950808442 3:15628502-15628524 TTCTTTAAGGTAGTCCAAGAAGG + Intronic
950970916 3:17186979-17187001 AGCATTAAGGTAGACAAGGATGG + Intronic
953405727 3:42658917-42658939 TTCTTTAAGGAGGAGAAGGAGGG + Exonic
954014450 3:47674550-47674572 ATCTTAAAAGCAGACATGGAGGG - Intronic
954107532 3:48417488-48417510 TTCAGGAAGGTAGACTTGGAAGG - Intronic
955785488 3:62533524-62533546 CTCTGTAAGGTAGACAGAGAAGG + Intronic
956595542 3:70962821-70962843 TTCATTAAGATGGAGATGGATGG - Intronic
956825252 3:72992022-72992044 TTCTTCCAGGAAGAGATGGAAGG - Intronic
957322282 3:78647457-78647479 GTGTTTAAGGTAGAAATGGTTGG - Intronic
957508465 3:81155991-81156013 CTCTTTAAGGCAGAGTTGGATGG - Intergenic
957964686 3:87307039-87307061 TTTTTTAAGGGACACAGGGAGGG - Intergenic
958443395 3:94184138-94184160 TGCTTCAAGGTACACATGGTGGG + Intergenic
960842269 3:121972194-121972216 TTCCTTACGGTACACATGGTTGG - Intergenic
960874838 3:122286068-122286090 TTCTTTGGGGTAGAGATGGGAGG - Exonic
964416499 3:156453729-156453751 TTCTTGCAGGTAGACACGGAAGG - Intronic
964946253 3:162228636-162228658 TGCTTTAATGTAGACTGGGAAGG - Intergenic
965581982 3:170278477-170278499 TTATTTTTTGTAGACATGGAGGG - Intronic
965690043 3:171346039-171346061 TTCTATAAGGTGGTCAGGGAAGG + Intronic
966109134 3:176375986-176376008 TTCTTTTATGTAGAGATGAAGGG - Intergenic
969079933 4:4610507-4610529 TTCTTTAACATAAACAGGGATGG + Intergenic
970076911 4:12232775-12232797 TTCTATAATGCAGACATGGTTGG - Intergenic
971350639 4:25852769-25852791 GTTTTTAAGGTATACATGAAAGG - Intronic
971845996 4:31918133-31918155 TTATTTGAGGCAGACAGGGAAGG - Intergenic
975014782 4:69401588-69401610 ATTTTTAAAGTAGAAATGGAAGG - Intronic
975965268 4:79965461-79965483 TTTTTTTAGTTAGAAATGGATGG - Intronic
978057256 4:104286333-104286355 TTCGTTAAGTTAGATTTGGAGGG + Intergenic
979505577 4:121491868-121491890 TTCTTTAATGTAGATAGGAATGG - Intergenic
981043143 4:140241646-140241668 TTCTATAAGGTAGCTAAGGAAGG + Intergenic
981043146 4:140241674-140241696 TTCTATAAGGTAGCTAAGGAAGG + Intergenic
982933850 4:161444575-161444597 GGCTTTAAGGTAGACTTTGAAGG + Intronic
983019268 4:162654947-162654969 TTCAATAAGGTAGTCAGGGAAGG + Intergenic
983059786 4:163145181-163145203 TACATTAAGGTGGACATGCAGGG + Intronic
983107690 4:163709826-163709848 TTCTATGAGGTAAACATGCAAGG - Intronic
984339050 4:178430154-178430176 TTCTTTTAGGTAGAAAGGAAGGG + Intergenic
988136911 5:27185166-27185188 TTCTGTAAGGTAGACAAGGTAGG - Intergenic
988777117 5:34487204-34487226 TTATTTAAGGTACCCTTGGAAGG - Intergenic
988852307 5:35191945-35191967 AACTTGAAGGTAGAGATGGAAGG - Intronic
989811185 5:45677630-45677652 TTCTTCAAGGTAGGAATGAAAGG + Intronic
990078430 5:51881024-51881046 TTCTTTCACATAGACATTGATGG - Intergenic
990113393 5:52356840-52356862 TTTTGTAAAGTAGTCATGGATGG - Intergenic
992650777 5:78857632-78857654 TTCTTTAAGGTAGGCACCCATGG + Intronic
994643325 5:102437370-102437392 TTTTTTAAGATAGACCTTGATGG + Intronic
995539309 5:113169051-113169073 TTCTTTAAGGGAGGCATTCAGGG - Intronic
995912227 5:117201730-117201752 TTCTTTGGGGAAGACAGGGAGGG + Intergenic
996042982 5:118837354-118837376 TTCTTTAAAATAGGTATGGATGG - Intronic
997439181 5:133897248-133897270 TTTTTGAAGGCAGAAATGGAAGG + Intergenic
998274111 5:140735620-140735642 TTCTTTATGATTGAGATGGATGG - Intergenic
1000231771 5:159322238-159322260 TTCTTCAATGTAGACAAGGAAGG + Intronic
1000235574 5:159356510-159356532 TTATATAACGTAGTCATGGAAGG - Intergenic
1003230601 6:4249542-4249564 TAATTTAAGGTGGACATTGATGG - Intergenic
1003576496 6:7301264-7301286 TTGTTTAAGTTAGAGATGGATGG - Intronic
1003585727 6:7387706-7387728 ATTTTTAAAGGAGACATGGACGG - Intronic
1003855517 6:10269938-10269960 TTCTCTAAGGAAGTCAGGGAAGG + Intergenic
1005713096 6:28521435-28521457 TTCTCTAAGTTAGACTTGGGTGG + Intronic
1006654555 6:35579327-35579349 ATCTTAAAGGTAGACATAAAAGG - Intronic
1007330446 6:41102819-41102841 ATCCTTAAGGAACACATGGAAGG + Intergenic
1008375590 6:50787665-50787687 ATATTTAACTTAGACATGGAGGG + Intergenic
1010279221 6:74004650-74004672 TTCCTTGAGGTAGATATAGATGG - Intergenic
1013210224 6:107980287-107980309 TTCTTTAAGGTCCACAGGGTTGG - Intergenic
1013289368 6:108707498-108707520 TTCCTTGAGGTACACATTGACGG - Intergenic
1014196919 6:118571663-118571685 TTCTTTAATGTAGATCTGGAGGG - Intronic
1014744352 6:125182489-125182511 TGGTTTAAGGTAGAAAGGGAGGG + Intronic
1015522716 6:134147596-134147618 TGATTTAAGGCAGGCATGGAGGG - Intergenic
1016492617 6:144624048-144624070 TTCCTAAAGGTAGAAATGGTGGG + Intronic
1016847789 6:148586338-148586360 TTCTTCAAGGTCGAAATGAAAGG - Intergenic
1018576081 6:165261809-165261831 TTGAATAAGGTAGTCATGGAAGG + Intergenic
1021641858 7:22745388-22745410 TTCTTTATGGTTGAAATGGATGG + Intergenic
1024148554 7:46542984-46543006 TTCTTTATGGTTGGGATGGATGG - Intergenic
1025907686 7:65800643-65800665 CTCTTTGATGTAGACATGAAGGG + Intergenic
1026720572 7:72827728-72827750 TTTTTTAAGAGAGATATGGAAGG + Intronic
1027704853 7:81517128-81517150 TTTTTTAAGCTATACTTGGAAGG - Intergenic
1030629947 7:111884867-111884889 TTCTAGAAGGTAGACTTGTAAGG + Intronic
1031331117 7:120465905-120465927 TTCCTTAAGCTTGACCTGGAGGG + Intronic
1032236971 7:130133010-130133032 TTCTTTGAGGTAGACCTTGGAGG + Exonic
1033440524 7:141374017-141374039 CTCTTTAAGGAATAAATGGAAGG - Intronic
1035664744 8:1372672-1372694 TTCAATAAGTTGGACATGGACGG + Intergenic
1039412706 8:37368732-37368754 TTTTATAAAGCAGACATGGAAGG + Intergenic
1042317589 8:67440251-67440273 TTCTTTAAGTGATACATGGCTGG - Intronic
1043191079 8:77224054-77224076 TTCTTCAAGGTTGAAATGAAAGG - Intergenic
1045495811 8:102707556-102707578 GACTTGGAGGTAGACATGGAAGG + Intergenic
1046485157 8:114877710-114877732 TTCCTTAAGGTTGAAATGGCAGG - Intergenic
1046537840 8:115538951-115538973 TTCTTTGATGTAGATATGCAAGG - Intronic
1047097923 8:121643491-121643513 TTCTTTGGGGTAGAGATGGGAGG - Intergenic
1048831970 8:138486365-138486387 GTCTTAAAGGAAGACCTGGAGGG + Intronic
1049506854 8:143007029-143007051 TTCTTCAAGGTCGAAATGAAAGG - Intergenic
1051200376 9:14613124-14613146 TTTTTTTAGGTAGGCATGTATGG - Exonic
1052793687 9:32902482-32902504 ATATTTAAGCTGGACATGGATGG + Intergenic
1055429609 9:76230297-76230319 TTTGTTAGGGTGGACATGGAGGG + Intronic
1055715353 9:79111401-79111423 TTCTTTAAGAAAGACCTGTAGGG + Intergenic
1055951867 9:81736966-81736988 TTTTTTAAGCTAGCCATTGATGG - Intergenic
1057969800 9:99543723-99543745 TTCTTTAGGGTAGAGATGCAAGG - Intergenic
1059998480 9:119936917-119936939 TTCTTTAAGATAGGGATGGGAGG - Intergenic
1060547910 9:124471437-124471459 TTCTTCAAGGAAAAGATGGAGGG - Intronic
1061051988 9:128202315-128202337 TTCTTAAATGCAGAGATGGACGG + Intronic
1186952961 X:14647638-14647660 TTATTTAAGGTAAAGATGGATGG + Intronic
1187032696 X:15504120-15504142 TTCCTTAAGGTAGCCAAGTAAGG - Intronic
1187971972 X:24667906-24667928 TTCCTTAAAGAAGACAAGGAAGG + Intronic
1188092342 X:25978465-25978487 TTCTCTAAGGTTGAAATGAAGGG + Intergenic
1188318280 X:28703737-28703759 TGCTTTAGAGTAGACATGTAAGG - Intronic
1189613246 X:42759691-42759713 GCCTTTAAGGTAGACATGTCAGG + Intergenic
1192969467 X:76216620-76216642 TTTTTTAAGGTAGGCATTTAGGG + Intergenic
1194724000 X:97373535-97373557 TTTTTTAAGGTGGTCAGGGAAGG + Intronic
1194971484 X:100348929-100348951 TTCTTTTTGGTAGAGATGGTGGG + Intronic
1195577634 X:106468514-106468536 TTCTCAGAGGTAGACATGGCAGG + Intergenic
1197299946 X:124766099-124766121 GTCTGTGAGATAGACATGGAAGG + Intronic
1197822903 X:130559725-130559747 TTGTTTAGGGAAGTCATGGATGG + Intergenic
1198831952 X:140760167-140760189 CTCTTTAAGGAAAACAAGGAAGG + Intergenic
1199245418 X:145598843-145598865 TTCTTTCATGTGGGCATGGAGGG - Intergenic
1202576817 Y:26336568-26336590 TTTTTTATGGTAGAGATGGGGGG - Intergenic