ID: 907763225

View in Genome Browser
Species Human (GRCh38)
Location 1:57382553-57382575
Sequence ATTCCTTTCTGGAGCTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907763221_907763225 24 Left 907763221 1:57382506-57382528 CCAATAAAGGTATTTCTAGACTA No data
Right 907763225 1:57382553-57382575 ATTCCTTTCTGGAGCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907763225 Original CRISPR ATTCCTTTCTGGAGCTTCAA AGG Intronic
No off target data available for this crispr