ID: 907765250

View in Genome Browser
Species Human (GRCh38)
Location 1:57403410-57403432
Sequence CTCTAGCCATAGCTGCAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907765245_907765250 30 Left 907765245 1:57403357-57403379 CCAGCACTGAGAAGGCAAAGCTG 0: 1
1: 1
2: 2
3: 30
4: 315
Right 907765250 1:57403410-57403432 CTCTAGCCATAGCTGCAACTAGG 0: 1
1: 0
2: 0
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907765250 Original CRISPR CTCTAGCCATAGCTGCAACT AGG Intronic
900520238 1:3101881-3101903 CTCTAGCACTAGCTCCAGCTGGG - Intronic
902690122 1:18105864-18105886 CTCTGGCCCCAGCTGCAAATCGG - Intergenic
902904559 1:19546095-19546117 GTCTCGACATGGCTGCAACTAGG - Intergenic
905915231 1:41679764-41679786 TTCTAGCCCTAGATGGAACTGGG - Intronic
907765250 1:57403410-57403432 CTCTAGCCATAGCTGCAACTAGG + Intronic
918008129 1:180561292-180561314 TTCTTGCCATAACTGCAGCTGGG - Intergenic
923205151 1:231752145-231752167 CTTTAGCCATACCTGCAATTTGG + Intronic
1065160607 10:22917163-22917185 CTGTAGCCATGGCTTCTACTAGG - Intergenic
1066988732 10:42492178-42492200 GTCTTGACATGGCTGCAACTGGG - Intergenic
1069999341 10:72364694-72364716 CTCTAGCCAGAACTAAAACTAGG + Intergenic
1070844436 10:79510329-79510351 CTCTAGCCCTAGCTGTCCCTGGG + Intergenic
1070929361 10:80249979-80250001 CTCTAGCCCTAGCTGTCCCTGGG - Intergenic
1074043940 10:109819731-109819753 CTATAGGCAGAGCTGGAACTAGG + Intergenic
1078364143 11:10692874-10692896 CTCTAGGAATCGCTTCAACTCGG + Intronic
1078544245 11:12235222-12235244 CTCCAGCCATAGCATCAGCTCGG + Intronic
1081233559 11:40617566-40617588 CTCTTCCCATAGGTCCAACTTGG + Intronic
1087175323 11:95090289-95090311 CCCTCGCGGTAGCTGCAACTGGG - Intronic
1090766222 11:129878488-129878510 CTCTAGCCATAGCTGGAAGAGGG + Exonic
1091194786 11:133721334-133721356 CTCTATCAAAACCTGCAACTTGG - Intergenic
1093104207 12:15066127-15066149 CTCCACCCATAGCTGCCACCTGG - Intergenic
1101501087 12:105304340-105304362 GTCTCGACATGGCTGCAACTGGG + Intronic
1102041460 12:109803574-109803596 CTGTAGTCTTAGCTGCTACTTGG - Intronic
1102542371 12:113631140-113631162 CTGAAGGCATAACTGCAACTAGG - Intergenic
1104919999 12:132285738-132285760 CTCCTGCCATAGCTGCATCTGGG - Intronic
1112739553 13:102457512-102457534 CTGTAGCCATTGCTGCCACATGG - Intergenic
1113310036 13:109122144-109122166 CTGCAGCCTTAGCTGAAACTGGG + Intronic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1117357385 14:54937980-54938002 TTCTAGCCACATCTGGAACTCGG - Intergenic
1118688849 14:68318683-68318705 CTCTAGCTACAGCTGCAGCCTGG - Intronic
1119640975 14:76314707-76314729 CTCCAGCCAGAGAAGCAACTTGG + Intronic
1122860638 14:104580923-104580945 CTCGAGCCCTAACTGCACCTCGG + Intronic
1123213056 14:106779528-106779550 CTCTGGCCATGGCTTCATCTAGG - Intergenic
1134045796 16:11099952-11099974 ATCTAGCCAGAGTTGCACCTGGG + Intronic
1135157097 16:20061837-20061859 CTTTGGCCATTGCTGCAATTTGG - Intronic
1136370865 16:29835222-29835244 CTGTTGGCATAGCAGCAACTTGG + Intronic
1140931459 16:79632058-79632080 CTCTTGCCAAACCTGAAACTTGG - Intergenic
1143232420 17:5368076-5368098 CTTTAAACATAGCTACAACTAGG + Intronic
1143430236 17:6876721-6876743 GTCTTGACATGGCTGCAACTGGG + Intronic
1147445851 17:40474928-40474950 CTCCAGACTTCGCTGCAACTAGG - Intergenic
1155649946 18:28129497-28129519 CTCTAGGCCTAGCTACAACTTGG + Intronic
1159623747 18:70669084-70669106 TCCAAGCCACAGCTGCAACTTGG - Intergenic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1162282800 19:9713082-9713104 GTCTTGACATGGCTGCAACTGGG + Intergenic
1163548656 19:17953067-17953089 CTCTAGCCAGAGGAGAAACTTGG - Intronic
1163698740 19:18776761-18776783 CTCCAGCCCTAGCAGCAGCTGGG + Intronic
1165920718 19:39296414-39296436 ATTTAGCCATGGCTGCAGCTTGG + Exonic
1167863189 19:52302010-52302032 GTCTCGACATGGCTGCAACTGGG + Intronic
931624800 2:64247615-64247637 CTCTACCCATTCCTGCAAGTAGG - Intergenic
932485190 2:72080472-72080494 CCCAAGCCACAGCTGCAACCTGG + Intergenic
936604352 2:113934283-113934305 TTCTTGCCTTAGCTGCATCTTGG + Exonic
937465323 2:122127326-122127348 TTTTAGCCACAGCTGAAACTGGG - Intergenic
945899217 2:215519021-215519043 AGCTGGCCATAGCTCCAACTTGG - Intergenic
948466825 2:238156266-238156288 CTTGAGCCATAGCTGCAGCCAGG + Intergenic
1171229540 20:23472476-23472498 GTCTTGACATGGCTGCAACTGGG - Intergenic
1173176994 20:40771949-40771971 CTCTGGCCAGAGATGGAACTGGG + Intergenic
1173618237 20:44416661-44416683 CTCTAGCTCTAGCTGCTCCTGGG - Intronic
1180628346 22:17209576-17209598 CTCTATCCATAGATGAAACACGG - Exonic
1182569900 22:31229175-31229197 CTCAAGGTAAAGCTGCAACTAGG - Intronic
949470448 3:4390470-4390492 CTCTAGCCAAAGGAGCAAGTAGG - Intronic
952271067 3:31831882-31831904 CTCCAGACATACCTGCAGCTGGG + Intronic
955821873 3:62905078-62905100 CTACAGCTATAGCTGCCACTAGG - Intergenic
957603348 3:82367325-82367347 CTGTAGCAATAGCTGAATCTTGG - Intergenic
958584174 3:96064812-96064834 TTCTAGCCATAAGTGCAAGTGGG + Intergenic
959337764 3:105087636-105087658 TTTTAGTCATAGCTGCAATTGGG - Intergenic
962627934 3:137245914-137245936 CTCTAACCATTTCTCCAACTTGG - Intergenic
963234242 3:142940716-142940738 AACTAGTCATAGCTGAAACTAGG + Intergenic
965314822 3:167178532-167178554 GTCTTGACATGGCTGCAACTGGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
971156323 4:24087191-24087213 CACTAGCCAGCGCTGGAACTTGG + Intergenic
975353175 4:73368687-73368709 GTCTTGACATGGCTGCAACTGGG - Intergenic
976331377 4:83834713-83834735 CTTTAGCCACAGATGCATCTTGG + Intergenic
977625808 4:99188703-99188725 GTCTCGACATGGCTGCAACTGGG + Intergenic
977705586 4:100066789-100066811 CTCTAGAATTAGATGCAACTGGG - Intergenic
977890667 4:102307931-102307953 CTTGAGCCATAGATGAAACTAGG - Intronic
980514730 4:133841025-133841047 ATCTAGCCATTGCTGAAAGTAGG + Intergenic
980654086 4:135759514-135759536 CTCTAGCCATAGCTAAAAAGGGG - Intergenic
980745624 4:137010494-137010516 CTCTAGTCATTGCTGAAAGTGGG + Intergenic
983188888 4:164733271-164733293 TTCTAGCCACCCCTGCAACTGGG - Intergenic
983270653 4:165557867-165557889 CTGAAGCCCTAGCTGCCACTGGG + Intergenic
984170118 4:176349177-176349199 GTCTTGACATGGCTGCAACTGGG - Intergenic
985142597 4:186857553-186857575 CTCTTACCATGGCTGCATCTGGG + Intergenic
985735623 5:1579383-1579405 GTCTTGACATGGCTGCAACTGGG + Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
990627616 5:57632264-57632286 ATCCAGCCATATCTGAAACTGGG - Intergenic
994026502 5:95090605-95090627 CTCTACTCATCGCTGCTACTTGG + Intronic
1008422624 6:51319960-51319982 CTCTAGCCATATATGGCACTAGG + Intergenic
1009702050 6:67196870-67196892 CTCAACCCATAGCTACAACCAGG + Intergenic
1015255750 6:131177855-131177877 TTCTTGCCTTAGCTGAAACTCGG + Intronic
1018594374 6:165462582-165462604 GTCTCGACATGGCTGCAACTAGG - Intronic
1019176404 6:170161415-170161437 CTTTAGGCATAGCTGCAGCGCGG - Intergenic
1021097128 7:16547405-16547427 CCCAAGCCATGGCTGCAACCTGG + Intronic
1023804357 7:43861255-43861277 GTCTTGACATGGCTGCAACTGGG + Intergenic
1025819541 7:64949214-64949236 GTCTTGACATGGCTGCAACTGGG - Intergenic
1025855836 7:65277465-65277487 CTCAAGCCATCCCTGCACCTTGG + Intergenic
1028556062 7:92126241-92126263 CTTTATCCATACCTGAAACTAGG + Exonic
1033659013 7:143391063-143391085 TTGTAGCTATAGCTACAACTTGG - Exonic
1034580852 7:152041063-152041085 GTCTTGACATGGCTGCAACTGGG + Intronic
1036560104 8:9894423-9894445 CTCCAGGCAAAGCTGGAACTTGG - Intergenic
1038423108 8:27446158-27446180 CTCTAGCCATAGCACCAGCATGG - Intronic
1038708180 8:29915755-29915777 CTGTAGCCCCAGCTGCTACTTGG - Intergenic
1039045316 8:33444288-33444310 CACTTGCCATTGCTCCAACTGGG - Intronic
1040592857 8:48811243-48811265 CTCGGGCCATAGCTACACCTAGG - Intergenic
1041299222 8:56393612-56393634 CTCTAGCCATGGCCTCAAATTGG - Intergenic
1043024434 8:75048517-75048539 GTCTAGACATGGCTGCAACCAGG - Intergenic
1044442774 8:92241128-92241150 GTCTTGACATGGCTGCAACTGGG - Intergenic
1044806200 8:96010789-96010811 CTCAAGCCACAGCTGCTTCTTGG + Intergenic
1045287558 8:100805119-100805141 CCCAAGCCATTGCTGCAATTTGG - Intergenic
1045597576 8:103673576-103673598 CTCTAGCTACAGCTACAGCTGGG - Intronic
1047176418 8:122545184-122545206 CTATAGCTACTGCTGCAACTGGG + Intergenic
1048006013 8:130419795-130419817 CCCTGGCCAGAGCTGAAACTTGG - Intronic
1048888508 8:138928183-138928205 CTGTGTCCATAGCAGCAACTTGG + Intergenic
1049218907 8:141420043-141420065 CTCAAGCCCTACCTGCACCTGGG + Intronic
1050312969 9:4371954-4371976 CTCTGGCCATAATTGCACCTGGG + Intergenic
1051606320 9:18920783-18920805 CTTTAGGCATAGCTGGAACCAGG - Intergenic
1056446091 9:86667377-86667399 CTCTAGCTATTGCTGCAATCAGG - Intergenic
1062457577 9:136646743-136646765 CCCCAGCCGTAGCTGCTACTGGG - Intergenic
1186457951 X:9725493-9725515 CTCTAGCCTTAGTTGCCACTAGG - Exonic
1188844846 X:35059891-35059913 CCCAAGCCACAGCTGCAGCTAGG + Intergenic
1191152537 X:57235161-57235183 CTTAAGCCATAGCTACAGCTTGG - Intergenic
1192159394 X:68771756-68771778 TTCTTGCCTTAGCTGCATCTTGG + Intergenic
1193314351 X:80046696-80046718 GTCTTGACATGGCTGCAACTGGG - Intergenic
1199614621 X:149647144-149647166 CTGTATCCAAAGCTGCGACTTGG - Intergenic
1199614636 X:149647225-149647247 CTGTATCCAAAGCTGCGACTTGG - Intergenic