ID: 907766574

View in Genome Browser
Species Human (GRCh38)
Location 1:57418456-57418478
Sequence TTGTAAATCAATATGAAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907766573_907766574 -10 Left 907766573 1:57418443-57418465 CCAACAAAGAAAATTGTAAATCA No data
Right 907766574 1:57418456-57418478 TTGTAAATCAATATGAAGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 250
907766572_907766574 14 Left 907766572 1:57418419-57418441 CCATTCAAGAGATGCAGAGACTG 0: 1
1: 0
2: 3
3: 54
4: 585
Right 907766574 1:57418456-57418478 TTGTAAATCAATATGAAGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907766574 Original CRISPR TTGTAAATCAATATGAAGCT CGG Intronic
900738475 1:4315504-4315526 TTGTAATTCAACATGAAATTTGG + Intergenic
902156064 1:14487499-14487521 TTGTATGTGGATATGAAGCTGGG - Intergenic
907251110 1:53140490-53140512 TTGTTCAGCAATATGCAGCTTGG + Intronic
907766574 1:57418456-57418478 TTGTAAATCAATATGAAGCTCGG + Intronic
908303253 1:62783704-62783726 TTTTAAATCAAAGTGAGGCTTGG + Intergenic
908306257 1:62821287-62821309 CTGTAAATGATTATGAAGGTAGG + Intronic
908372836 1:63500786-63500808 TTGTAATTCCATATGAATTTTGG - Intronic
908744113 1:67359203-67359225 TTGTAAAACAATGTGGGGCTGGG - Intronic
909567122 1:77065467-77065489 TTTTAAATCTACATGTAGCTAGG + Exonic
909890778 1:81004108-81004130 TTGTAAAACAATTTGAAACTTGG + Intergenic
909924538 1:81423866-81423888 TTGTAAATCTCTTTAAAGCTTGG - Intronic
910855085 1:91686915-91686937 TTGTAAATAAATATCAGACTTGG + Intronic
913085513 1:115433116-115433138 TTATAATTCAAGATGAAGTTTGG - Intergenic
914214665 1:145614300-145614322 TTGTAAAACAATATGAAAGAGGG - Intronic
914466605 1:147934690-147934712 TTGTAAAACAATATGAAAGAGGG - Intronic
915444768 1:155968327-155968349 CTGTAAATCCCTATGAAACTTGG - Intronic
917065084 1:171084111-171084133 CCATAAATCAATATGAACCTGGG + Intergenic
918402679 1:184179374-184179396 GGATAAATCAATATGAAGGTAGG - Intergenic
918689302 1:187460593-187460615 TTGAAAATGATTCTGAAGCTGGG + Intergenic
918761038 1:188407769-188407791 TGGTAAATAAAAATGAATCTTGG - Intergenic
918952344 1:191154793-191154815 TTGTAGAACAATTTGAAGCCAGG - Intergenic
919314839 1:195958812-195958834 TTATAAATAAATATGAACCATGG - Intergenic
919367489 1:196681956-196681978 TTCTAAATCTATAAGAAGTTTGG + Intronic
922646342 1:227290591-227290613 TTGGAAACCAATATGAATCTTGG - Intronic
1065330668 10:24594834-24594856 TTGTAATTCAACATCAAACTGGG - Intronic
1065413623 10:25460028-25460050 TTGCAGATGAATATAAAGCTGGG - Intronic
1065814457 10:29471466-29471488 CTGTACATCAATATAAAGCAAGG - Intronic
1066334074 10:34458496-34458518 TTGTAAAATAATTTGAGGCTGGG - Intronic
1066565121 10:36713897-36713919 TTGTAATACAATTTGAAGCCAGG + Intergenic
1068229074 10:54147306-54147328 ATGAAAATAAATGTGAAGCTAGG + Intronic
1068757477 10:60671018-60671040 AAGTAAATCAATAGGAACCTGGG + Intronic
1069086147 10:64141878-64141900 TGGTAAATCCATAAGAACCTAGG + Intergenic
1072062235 10:91824684-91824706 TTGCAGATTAACATGAAGCTGGG + Intronic
1072348936 10:94538917-94538939 TTATAAAGAAATATGAAGCAGGG - Intronic
1074194450 10:111169181-111169203 TTGAAAATCAACATGAAACAAGG + Intergenic
1079433176 11:20416855-20416877 TTCTTAAACATTATGAAGCTGGG - Intronic
1080124853 11:28720900-28720922 TAGTAAATCAAGAGGAAGGTAGG - Intergenic
1080953853 11:37069038-37069060 TTGTACATAAATATGATGGTAGG + Intergenic
1082894359 11:58174319-58174341 TTGTGAATCAAGCTGCAGCTTGG + Intronic
1082916238 11:58440622-58440644 TTGTAAGTCAATGTGAAGAATGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086335312 11:85794931-85794953 TTGTAAAGGAATGGGAAGCTAGG - Intronic
1086809837 11:91295595-91295617 TTATAATTCAATATGAGGTTTGG - Intergenic
1087621847 11:100552133-100552155 TAGTTGATTAATATGAAGCTTGG - Intergenic
1088105139 11:106198369-106198391 TTATAAAGGAATATGAAGCTGGG - Intergenic
1090260659 11:125316396-125316418 GTGAAATTCAAGATGAAGCTAGG - Intronic
1091887088 12:4024771-4024793 TTGTAAATCACTCTGAAGTTGGG + Intergenic
1092759714 12:11798732-11798754 TTGTAACTCAAAGTGAAGGTAGG - Intronic
1094582494 12:31747259-31747281 TTAGAAATCAAAATGAAGGTCGG + Intergenic
1097418986 12:59350359-59350381 TTATGAATCCATATGAATCTGGG + Intergenic
1097675505 12:62597992-62598014 ATATAAATCAATATTAAGATGGG - Exonic
1099789187 12:87309603-87309625 TTTTACATAAATATGATGCTAGG + Intergenic
1100420997 12:94433383-94433405 TTGAAAATTAATTTGAAGCCAGG + Intronic
1101015038 12:100491444-100491466 TTGTAAATAAAAATGAAGTCTGG - Intronic
1102637075 12:114333935-114333957 TTGGTAATTAATATGCAGCTAGG - Intergenic
1103342339 12:120227793-120227815 TTGGAAATCAAAGTAAAGCTAGG - Intronic
1106850039 13:33780526-33780548 TTGAAAATAAATGTGAAGCATGG - Intergenic
1108091716 13:46856454-46856476 TTTTAAATGAATGTGAGGCTTGG + Intronic
1109913386 13:68946588-68946610 TAGTAGATCAATAAGTAGCTGGG - Intergenic
1111184692 13:84718292-84718314 TTGTAAATAAATAAGAAGCCAGG - Intergenic
1113209983 13:107966280-107966302 ATTAAAATCAAAATGAAGCTGGG + Intergenic
1113699648 13:112375100-112375122 TTATAATTCAAGATGATGCTTGG - Intergenic
1115277912 14:31628741-31628763 TTGTAATTCAGTATGTAGCAGGG + Intronic
1115674544 14:35656344-35656366 TTTTAAAACAATTTGTAGCTAGG - Intronic
1117256600 14:53984612-53984634 CAGCACATCAATATGAAGCTGGG - Intergenic
1117736056 14:58769850-58769872 TTTTCAACCAATATGAAGCATGG - Intergenic
1117932780 14:60862223-60862245 TTTTAAATAAATATTAAGCAAGG + Intronic
1119893134 14:78197924-78197946 ATATAAAGCAATATGAAGCATGG + Intergenic
1120113342 14:80584049-80584071 TTTTAAATCAGTATGAAGAAGGG - Intronic
1120147250 14:80992099-80992121 TTCTAAATCAATATAAAAATGGG + Intronic
1121916534 14:97840845-97840867 TTGAGAATCAAGATGATGCTGGG - Intergenic
1123795270 15:23764700-23764722 TTGTAAATCAAGTTAAAGATAGG - Intergenic
1125013621 15:34908154-34908176 TTATAAAACAATATTCAGCTGGG + Intronic
1126549873 15:49916552-49916574 TTGTAGGTCAGAATGAAGCTAGG + Intronic
1126861996 15:52894075-52894097 TTTTAAGTCAATATGGAGCCTGG + Intergenic
1130162187 15:81413012-81413034 TTGAAAATCAATGAGAAGCTGGG - Intergenic
1134252837 16:12586765-12586787 TTGTAAAACAATCAGAGGCTGGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135712267 16:24728151-24728173 TTGTAAAGCCAGTTGAAGCTGGG + Intergenic
1137739284 16:50750965-50750987 TTGTGAATGAATATTAAGTTTGG - Intronic
1137867010 16:51908531-51908553 TTGTACATCAATATGGGTCTGGG + Intergenic
1137944553 16:52721313-52721335 GAGTAAATCAATATGTAGATAGG + Intergenic
1140567482 16:76061046-76061068 TTTTAAATCAATATAAATATAGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142555268 17:771570-771592 TTTTAAGCCAGTATGAAGCTGGG + Intronic
1147495101 17:40907837-40907859 TTATAATTCAATATAAAACTGGG - Intergenic
1149403172 17:56319830-56319852 ATGTAAATAATTATGAAGTTCGG - Intronic
1149788850 17:59459854-59459876 TTGAAAATGAATATTTAGCTGGG - Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151093355 17:71467566-71467588 TTGAAGATGAATTTGAAGCTTGG + Intergenic
1151912961 17:77096262-77096284 TTAAAAATCACTATGAGGCTGGG + Intronic
1154013222 18:10593248-10593270 TTATAAATAAGTATGAAGCTTGG - Intergenic
1154152387 18:11916511-11916533 TTATAAATAAGTATGAAGCTTGG - Intergenic
1154370650 18:13759258-13759280 TTGTAAAGCTAAATAAAGCTAGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155494581 18:26429909-26429931 TTAAAAATCAATACGAAGGTGGG + Intergenic
1157062517 18:44308183-44308205 TTTTCAATCAATATGAAATTTGG + Intergenic
1157137442 18:45070442-45070464 TTTTAAATCATTATAAAGCATGG + Intergenic
1157396691 18:47347411-47347433 TTATAATTCAACATGAAGTTTGG + Intergenic
1158510502 18:58086307-58086329 TTGTAGATCCATAAGAAACTTGG + Intronic
1159143108 18:64420971-64420993 TTTTAAACAAATATGAGGCTTGG - Intergenic
1159904755 18:74079100-74079122 TTCTAAATCTATATGGAGATTGG - Intronic
1161841934 19:6687176-6687198 TTGTAAATCATTATAAACCAAGG - Intronic
1162663136 19:12186262-12186284 AAATAAATCAATTTGAAGCTTGG - Intronic
1167029323 19:46946874-46946896 TTGAAAATAAATGTGAAGCTGGG - Intronic
1167990521 19:53357121-53357143 AAGTAATTCAAAATGAAGCTGGG + Intergenic
926527146 2:13994962-13994984 TTGCAATTCAAGATGAAGTTTGG - Intergenic
927311874 2:21640840-21640862 TTGAAAATAATTATGAATCTGGG + Intergenic
929755709 2:44762491-44762513 TTTAAAATAAATCTGAAGCTGGG + Intronic
929958664 2:46479877-46479899 TTGTGAAGTCATATGAAGCTGGG + Intronic
932653932 2:73591103-73591125 TTAAAAATCAATAGGAAGCCAGG - Intronic
933506646 2:83184210-83184232 TTGTAAAATAATTTGAAGTTAGG - Intergenic
935004849 2:99063506-99063528 TTAAAAATCAATATGAAGGCAGG + Intronic
936561620 2:113543486-113543508 TAGTAGATAAATATGAAGCATGG - Intergenic
936807530 2:116354831-116354853 TTGTAAATCAATAAAATGTTAGG + Intergenic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
939577546 2:143914586-143914608 TTGGAAAGCAGTATGAAGATGGG + Intergenic
940103691 2:150072797-150072819 TTGTAATATAATTTGAAGCTGGG - Intergenic
940629112 2:156215344-156215366 TCTTAAATCAATGTGAAGTTTGG - Intergenic
941187747 2:162338221-162338243 TTGTACATAAATATGAAGGGGGG + Intronic
941199947 2:162495983-162496005 CTGTAAATCAAAATGAATCAAGG - Intronic
941942322 2:171053659-171053681 TTGTAAAAAAATCTGTAGCTAGG - Intronic
942912127 2:181256942-181256964 TTTTAAAACAAAATGAGGCTTGG - Intergenic
943492534 2:188573781-188573803 TTGTAATTCAATATGCATCACGG - Intronic
944128431 2:196319492-196319514 ATCTGAATCAATATGAAGCATGG + Exonic
945387104 2:209215186-209215208 TTATTAACCAATATGAATCTTGG - Intergenic
946903834 2:224397102-224397124 TTATAATTCAATATGAAATTTGG - Intronic
946917317 2:224537616-224537638 CAGTAAAGGAATATGAAGCTTGG - Intronic
947199338 2:227600506-227600528 TTGTAAATAAATAAGAAAGTTGG + Intergenic
947330148 2:229020487-229020509 TTGAAGATCAATAAGAATCTGGG + Intronic
1169723708 20:8706047-8706069 TTGTAAATCACTGTGATCCTAGG - Intronic
1170048290 20:12111380-12111402 TTGTAAATAAAATTGAAGCAAGG + Intergenic
1170165149 20:13354103-13354125 TTTGAAATCAATAGAAAGCTTGG + Intergenic
1175693859 20:61086450-61086472 TTGTAAATTAATAAGAGGATGGG - Intergenic
1178176664 21:30107977-30107999 TTTTAAATAAATATAGAGCTGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179265634 21:39800135-39800157 TTTTATTTCAATATGAAGCCAGG + Intronic
1180595633 22:16971347-16971369 TTGGAAATCACTGTGACGCTGGG - Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1181935434 22:26434937-26434959 CTGGACATCATTATGAAGCTCGG - Intronic
1182166716 22:28182174-28182196 TTGAAAATGCTTATGAAGCTAGG - Intronic
1182346562 22:29670418-29670440 TTGTAAGTCAATGAAAAGCTTGG - Intronic
952090768 3:29882595-29882617 TTTTAAATTATTATGAAGATTGG - Intronic
952124596 3:30285764-30285786 AAGTAAATAAATATGAAACTAGG - Intergenic
952480774 3:33759722-33759744 TTAAAAATAAAAATGAAGCTTGG + Intergenic
953687838 3:45092088-45092110 ATTTAAATTAATATGAGGCTGGG - Intronic
954505988 3:51073966-51073988 TTGTAAATGAATCTGAATTTTGG + Intronic
955715360 3:61823829-61823851 TTATAAATGATGATGAAGCTGGG + Intronic
956925875 3:73987826-73987848 TTGGAAATCATTATGAAGAGTGG + Intergenic
957187636 3:76963043-76963065 ATGTAAGTCAAAATGAAGGTGGG + Intronic
957550370 3:81696790-81696812 TTAAAAAGCAATATGAGGCTAGG + Intronic
959053129 3:101543221-101543243 TTGTAAAACAACAGGAAGATTGG - Intergenic
960025671 3:113006462-113006484 TTATAAAACAATATGAAGACAGG + Intronic
961766313 3:129213901-129213923 TTAAAATACAATATGAAGCTGGG + Intergenic
962969322 3:140384315-140384337 TAGAAAATGAAAATGAAGCTGGG + Intronic
963558796 3:146833607-146833629 TTGAAAATGAAAATGAAGCCTGG - Intergenic
963620911 3:147605079-147605101 TTGTAAAACAATATGTAGCCAGG - Intergenic
965204385 3:165703008-165703030 TTATAAATCCATTTGCAGCTAGG + Intergenic
965990532 3:174811794-174811816 TTATAATTCAACATGAAGTTTGG - Intronic
966197799 3:177330553-177330575 TTGAAAATCAAAATACAGCTGGG - Intergenic
970982697 4:22120146-22120168 ATGTAATTCAATATGAATGTTGG - Intergenic
971157543 4:24099560-24099582 TTGTAAATCAATTTGTGCCTAGG - Intergenic
972088528 4:35251435-35251457 TTGTAGATCCATAAGAAGGTAGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975468905 4:74741779-74741801 CTGTAAATCATTATTTAGCTTGG + Intergenic
976488070 4:85632727-85632749 TTGCAAAGCAAAATGGAGCTTGG - Intronic
977134495 4:93286384-93286406 TTGTAAATAAGTACTAAGCTTGG - Intronic
977701300 4:100026028-100026050 ATTTAAATCAATCTGGAGCTGGG - Intergenic
978057754 4:104293527-104293549 CTGCAGATCACTATGAAGCTAGG - Intergenic
979295464 4:119027629-119027651 GTTTAAATCTATATGAAGTTCGG - Intronic
980951767 4:139386317-139386339 TTTTAAATCATTATGAATCTGGG + Intronic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
983260763 4:165453678-165453700 TTGTAAAGAAAATTGAAGCTGGG - Intronic
983456572 4:167972353-167972375 TTATAAACCCATATGAACCTTGG + Intergenic
984765365 4:183396741-183396763 TTGTAAATAACTAAGAAGGTGGG - Intergenic
985250984 4:188024180-188024202 TTGTGAATCAAAAAGAAGCAAGG + Intergenic
986582469 5:9279579-9279601 TTATAATTCAACATGAAGTTTGG - Intronic
987495956 5:18645057-18645079 TAAGAAATCATTATGAAGCTAGG + Intergenic
989016293 5:36938703-36938725 ATGTAAATCCATAGGAAGTTGGG + Intronic
990568755 5:57056435-57056457 TTAAAAATCAAGATGCAGCTGGG - Intergenic
990658543 5:57985835-57985857 TTGTAAATCAAAGAGAAGATTGG + Intergenic
990734860 5:58849043-58849065 TTGTATACCAATATGATGATAGG + Intronic
991368431 5:65893260-65893282 TTGTTAATGATTATAAAGCTGGG - Intergenic
992386071 5:76285782-76285804 TTGGAAAACATGATGAAGCTTGG + Exonic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995871277 5:116746003-116746025 TTGGAAATAAATATGGATCTTGG - Intergenic
996256336 5:121408789-121408811 TTGAAAATAAATATGAAAATAGG + Intergenic
998215128 5:140232271-140232293 TTGTATATAAACCTGAAGCTTGG + Intronic
998501336 5:142635600-142635622 TTGTAACACAAGATGCAGCTTGG - Intronic
999893047 5:155999979-156000001 TTTCAAATCATTATGAAGATAGG - Intronic
1000033503 5:157423529-157423551 TTTTAAATCCATATGTGGCTGGG - Intronic
1000614534 5:163412763-163412785 ATGTAAATTCATATGAAACTAGG - Intergenic
1004236127 6:13875664-13875686 TTGTAAATCAATAAGGACATGGG + Intergenic
1004469066 6:15912337-15912359 TGGTAGATCACTTTGAAGCTTGG + Intergenic
1005308890 6:24540109-24540131 TTGTAAAACAGTATGTGGCTGGG - Intergenic
1006626305 6:35400502-35400524 TTGTAAAGAAATAGGTAGCTGGG + Intronic
1007140648 6:39570015-39570037 TTGCATTTCAATATAAAGCTTGG + Intronic
1007963061 6:45978659-45978681 TTGAAAATAATTATGAGGCTGGG + Intronic
1011793784 6:90930071-90930093 GTGTAAACTAACATGAAGCTAGG + Intergenic
1012593342 6:101010692-101010714 TTGTAATTCAACATGCAGTTTGG - Intergenic
1012673415 6:102085698-102085720 TTGTAAATATATATGAGGCAAGG + Intergenic
1012913218 6:105139845-105139867 TTGAAAGTTAATATGAAGCAAGG + Intergenic
1013263156 6:108467053-108467075 TCCTAAATCAATTTCAAGCTGGG - Intronic
1014101805 6:117519294-117519316 TTATAAATCAAAATGAATTTTGG + Intronic
1014420028 6:121232327-121232349 TTGTAAAATAATGTGAAGTTGGG + Intronic
1014860781 6:126465441-126465463 TTGTAAATCAATAGGCAGACTGG - Intergenic
1016071039 6:139739382-139739404 TTGAAAAGCAATATAAAGGTTGG - Intergenic
1021723221 7:23524983-23525005 TTGAAAGTTAAAATGAAGCTGGG - Intronic
1022946352 7:35288992-35289014 TAGTATATCAATATTAAACTAGG - Intergenic
1027562797 7:79753221-79753243 TTGTTGTTCTATATGAAGCTTGG + Intergenic
1027598205 7:80202858-80202880 CTGTAAATCAGTATGGAGATGGG - Intronic
1027614579 7:80405650-80405672 TGGTAAATCAATATGTACTTGGG + Intronic
1029092224 7:98057247-98057269 TGGTAGATGAAAATGAAGCTTGG + Intergenic
1029092250 7:98057405-98057427 TGGTAGATGAAAATGAAGCTTGG + Intergenic
1029613786 7:101643748-101643770 TTTCAAATCAAGATGAACCTGGG - Intergenic
1029893898 7:103960914-103960936 TTGGAAATCACTAACAAGCTCGG + Intronic
1030984873 7:116229796-116229818 TTATAATTCAATCTGAAACTAGG + Intronic
1034150472 7:148911150-148911172 TTGTTAATCAATATGAACAGAGG + Intergenic
1034302760 7:150030959-150030981 TTGTAAAAAAATCTGAGGCTGGG + Intergenic
1034803300 7:154066353-154066375 TTGTAAAAAAATCTGAGGCTGGG - Intronic
1035303529 7:157915384-157915406 TTGTACATCCCTGTGAAGCTTGG + Intronic
1035965715 8:4189302-4189324 GAGTAAATCAAGATGAAGCCTGG + Intronic
1037154875 8:15687326-15687348 ATGTAACTCAATAAGAAGCGAGG - Intronic
1037994604 8:23343182-23343204 TTGTGGATCCATGTGAAGCTGGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1039297851 8:36176554-36176576 TTGTATATAAATATTATGCTTGG + Intergenic
1040880380 8:52198740-52198762 TTGTAATTCAATAGGACACTTGG - Intronic
1041964684 8:63662284-63662306 TTGTATCTCAATATGAATTTGGG + Intergenic
1042471875 8:69199416-69199438 TTATAATTCAAAATGAAACTTGG - Intergenic
1043791409 8:84471914-84471936 TTGTAATTCAATATAATGTTAGG - Intronic
1044136994 8:88598637-88598659 TTGTAATGGAATATTAAGCTGGG + Intergenic
1044630694 8:94275766-94275788 TCGTAAATGAATTGGAAGCTGGG - Intergenic
1045837480 8:106539509-106539531 ATGAAAATCAAAATTAAGCTCGG + Intronic
1046460694 8:114530904-114530926 TTTTAAATCAAAGTGAATCTAGG + Intergenic
1046694799 8:117327824-117327846 TTGTAAAATAATATGAATCATGG - Intergenic
1046964189 8:120145047-120145069 TTGTAGATCAATAAGAAAATGGG + Intronic
1048727552 8:137403835-137403857 TTGTAAATCCATCTGATCCTGGG - Intergenic
1049891062 9:71832-71854 TAGTAGATAAATATGAAGCATGG + Intergenic
1051521252 9:17991642-17991664 TTGTATAACAATGTGAACCTGGG + Intergenic
1051602235 9:18886781-18886803 TTAGAATTCAATATGAATCTAGG + Intronic
1052525668 9:29615826-29615848 TTGTAAATCCTTTTGAAGGTTGG - Intergenic
1052707173 9:32008145-32008167 CTGTGAATCCATATGAACCTGGG + Intergenic
1053732503 9:41072887-41072909 TAGTAGATAAATATGAAGCATGG + Intergenic
1054695928 9:68358688-68358710 TAGTAGATAAATATGAAGCATGG - Intronic
1055855544 9:80682503-80682525 TTTTAAAGCTATATAAAGCTTGG + Intergenic
1060284023 9:122233049-122233071 AAGTAAATAAATGTGAAGCTGGG - Intergenic
1060609800 9:124953322-124953344 TTGGAAATTAAAATGAGGCTGGG + Intronic
1185687647 X:1942452-1942474 TTGTAAACCAAAATGATGTTTGG - Intergenic
1185823213 X:3224788-3224810 TTGTAATTCATTATGATGATGGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186695139 X:12022507-12022529 TGTTAAATCAGCATGAAGCTGGG + Intergenic
1187679804 X:21756197-21756219 TTGTACATCAATTTGAAACAGGG + Intronic
1188537845 X:31217247-31217269 TTGGAAATGAAAATGAAACTTGG - Intronic
1188889449 X:35591967-35591989 TTAATAATCAATATAAAGCTTGG + Intergenic
1190479276 X:50859861-50859883 TTATAATTCAACATGAGGCTTGG - Intergenic
1190491525 X:50987743-50987765 TATTAAATAAATATGAATCTAGG - Intergenic
1196386320 X:115156827-115156849 TTTTATAACAAAATGAAGCTCGG + Intronic
1196837669 X:119828374-119828396 TTGAAAATCCATATGAGGCTGGG + Intergenic
1197161168 X:123323845-123323867 TTGTTAATTAGTATCAAGCTTGG - Intronic
1198981177 X:142398488-142398510 TTGTAACAGAATATGAAGCATGG + Intergenic
1199266014 X:145826620-145826642 TTGTAAATCCTTATGCAACTGGG + Intergenic
1199355550 X:146859347-146859369 TTGTAAATCAATATTTAGTAAGG + Intergenic
1201569219 Y:15396705-15396727 TTTTAAATAAACATGAATCTTGG + Intergenic