ID: 907777439

View in Genome Browser
Species Human (GRCh38)
Location 1:57531717-57531739
Sequence AAATTTTACCAGCACACCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 9, 3: 74, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907777439 Original CRISPR AAATTTTACCAGCACACCAT TGG (reversed) Intronic
902195410 1:14794480-14794502 AACACTTACCAGCACACCACTGG - Intronic
902405125 1:16178559-16178581 AACATTTACCAGCTCACCACTGG + Intergenic
902755257 1:18545278-18545300 ACATTTTACCATCACATCACTGG + Intergenic
902832249 1:19023470-19023492 AAATTACAACAGCATACCATTGG + Intergenic
904137335 1:28323587-28323609 AAATTTGCCCAGCACTACATAGG + Intergenic
904830407 1:33302838-33302860 GACTTATACCAGCACACCACCGG + Intergenic
905187251 1:36205337-36205359 AACATTCACCAGCACACCACTGG - Intergenic
907134159 1:52123277-52123299 AACATTTACCAGCACGCCACTGG - Intergenic
907543250 1:55235752-55235774 AACATTCACCAGCACACCACTGG + Intergenic
907777439 1:57531717-57531739 AAATTTTACCAGCACACCATTGG - Intronic
907825594 1:58013931-58013953 AGAATTCACCAGCACACCACTGG + Intronic
908585698 1:65565032-65565054 AAATTTTACCAGTAGACCTTTGG - Intronic
909555694 1:76951314-76951336 AATATTTACCAGCACAACACTGG - Intronic
911524786 1:98971639-98971661 ATATTTTAGCAGCCCACAATAGG - Intronic
911720333 1:101183862-101183884 AAATATTTCCAGCACCCCAAAGG + Intergenic
912529686 1:110311301-110311323 AGATTTGAGCAGCTCACCATAGG + Intergenic
912963229 1:114214413-114214435 ACAGTTTACCAGCACCCCACTGG - Intergenic
913190917 1:116412351-116412373 AACATTAACCAGCACACCACTGG + Intergenic
914689876 1:150016358-150016380 AATATTTACTAGCACACCACTGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
916341970 1:163746128-163746150 AATATTTACCAGCACACCACTGG - Intergenic
917153592 1:171970917-171970939 AAATTTGACAAGCACACCACTGG - Intronic
917288048 1:173442064-173442086 AAACATTACCAGCACAACATTGG - Intergenic
917301564 1:173580018-173580040 AACATTTACCAGCACATCACTGG - Intronic
917439594 1:175055335-175055357 AAATGTTACCAACACACCACTGG - Intergenic
917960128 1:180135822-180135844 AACATTTTCCAGCACACCATTGG + Intergenic
918108596 1:181435191-181435213 AATGTTTACCAGCACACCACTGG + Intronic
919088922 1:192954962-192954984 AATTTTTACCAGCCCAACATAGG - Intergenic
920081819 1:203380200-203380222 AACCTTTACCAGCACATCACTGG - Intergenic
920091613 1:203457017-203457039 AACCTTTGCCAGCACACCACTGG - Intergenic
920700260 1:208212692-208212714 AATATTTACCAGCACACCACTGG + Intronic
920764005 1:208813550-208813572 AAATTTTACTAAAACACCAGGGG + Intergenic
921081727 1:211744759-211744781 AACATTTACCAGCACACCACTGG + Exonic
921245036 1:213229364-213229386 AACATTTACCAGCCCACCACTGG - Intronic
922058182 1:222062123-222062145 AATATTTACCAGCACACCACTGG - Intergenic
924547395 1:245042571-245042593 AAACGATACCAGCACATCATAGG + Intronic
924633518 1:245763902-245763924 AACATTTACCAGCACACACTGGG + Intronic
1063992280 10:11579022-11579044 AACATTTACCAGCACAACACTGG + Intronic
1064104456 10:12489522-12489544 AACATTTACCAGCACACCACTGG - Intronic
1064119962 10:12610010-12610032 AACGTTTACCAGCACACTACTGG - Intronic
1065763770 10:29007877-29007899 AACATTTACCAGCACCCCACTGG - Intergenic
1066250423 10:33627535-33627557 AAAATTCACCATCACAGCATAGG - Intergenic
1066998436 10:42584403-42584425 CAATTTGACCACCACACCCTGGG - Intronic
1068101981 10:52566705-52566727 AACATTTACCAGCACTCCACTGG + Intergenic
1068570609 10:58624099-58624121 AAAGATCACCAGCAAACCATGGG - Intronic
1069295271 10:66836027-66836049 AACATTCACCAGCACACCAGTGG - Intronic
1070051080 10:72890591-72890613 AAATATCACAAGCGCACCATGGG - Intergenic
1070766587 10:79060137-79060159 AACATTTACCAGCACACCACTGG + Intergenic
1071102015 10:82049721-82049743 AAATTTGACCAGCATCCAATTGG - Intronic
1071348886 10:84719516-84719538 AAAATGAACCACCACACCATGGG + Intergenic
1072572268 10:96669144-96669166 AAATTTAACCACCACACAAATGG + Intronic
1073644132 10:105282246-105282268 AAGATTTACCAGCACATCACGGG - Intergenic
1074613968 10:115047909-115047931 AAAATTTACCAACACACCACTGG + Intergenic
1074935522 10:118175984-118176006 TCAGTTTACCAGCACACCATTGG - Intergenic
1075327002 10:121541215-121541237 AAATATTAACAGCACTGCATGGG - Intronic
1075532147 10:123238723-123238745 GCAGTTTACCAGCACACCAGTGG + Intergenic
1076276743 10:129205934-129205956 CTATTTTACAAGCAAACCATTGG - Intergenic
1076506871 10:130984162-130984184 CAAGCTCACCAGCACACCATGGG - Intergenic
1078120617 11:8505103-8505125 AATATTTACCAACACACCACTGG + Intronic
1079533212 11:21480122-21480144 AAATTTAACTAGGACATCATAGG + Intronic
1079939106 11:26655686-26655708 TAATTTTTCCAGCAAATCATAGG + Intronic
1082796019 11:57378344-57378366 AACATTTACCAGCATACCACTGG - Intronic
1083752967 11:64772022-64772044 AAGTCTTACCAGCACCCAATTGG + Intronic
1084917962 11:72445075-72445097 AAATATTACCAAAACACCAGGGG + Intergenic
1085206431 11:74735635-74735657 AACATTTACCAGCACACCACTGG - Intergenic
1085410871 11:76289595-76289617 TACATTTACCAGCACACCACTGG - Intergenic
1085667098 11:78423670-78423692 AATATTTGCCAGCACATCATTGG - Intergenic
1087058396 11:93955496-93955518 AAATTTTATCACCTCATCATTGG - Intergenic
1087180388 11:95136058-95136080 AACATTTACCAGCATACCACTGG - Intergenic
1087311720 11:96551504-96551526 AATGTTTACCAGCACACCACTGG + Intergenic
1088902281 11:114127323-114127345 AATTTTCACACGCACACCATGGG - Intronic
1091472538 12:741741-741763 AAATTATACCAGGAAACAATAGG - Intergenic
1092027204 12:5251631-5251653 AATATTTACCAGCCCACCACTGG + Intergenic
1092321878 12:7484833-7484855 AAATCTTTCAAGCAGACCATGGG + Intronic
1093051069 12:14505444-14505466 AAAATTTACCTGCTCACCACTGG - Intronic
1094498848 12:31005963-31005985 ACATTTTCCCACCACACCAGTGG - Intergenic
1095417876 12:41995621-41995643 AACTATCACCAGCACACCCTAGG + Intergenic
1095493702 12:42762549-42762571 TCATTTTACCAGCACACCACTGG + Intergenic
1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG + Intergenic
1098080930 12:66785072-66785094 ATATTTTACTAGGTCACCATAGG + Intronic
1098802824 12:74984173-74984195 AACATTAACCAGCACACCATTGG + Intergenic
1098826434 12:75303556-75303578 AAATTTTAGGTGCACAACATAGG - Intronic
1100163468 12:91889478-91889500 GAATATTAACAGCACACCAAGGG + Intergenic
1100649951 12:96574472-96574494 AAATATTACTAGCACAAAATAGG - Intronic
1101093545 12:101312860-101312882 AAATTTAACCAGCACACCAGTGG + Intronic
1101473434 12:105020978-105021000 ATATTTTACCAGCACACCCCTGG + Exonic
1101510425 12:105388042-105388064 AACATTTACCTGCACACCACCGG + Intronic
1101603457 12:106230410-106230432 CAACTTTTCCAGCACACCAGGGG - Intergenic
1103236255 12:119375226-119375248 AACATTTACCAGCACATCAATGG - Intronic
1103243288 12:119433170-119433192 AACATTCACCAGCACACCACGGG + Intronic
1103594810 12:122018182-122018204 AACATTTACCAGCATACCATTGG - Intergenic
1104126119 12:125847766-125847788 AAATGTTACCAACACACCAGGGG - Intergenic
1104325829 12:127797238-127797260 AAATGTAACCAGCATGCCATTGG + Intergenic
1104564874 12:129871758-129871780 AACATGTACCAGCACACCATGGG + Intronic
1105680841 13:22725763-22725785 AGATTTTACCTGCAGATCATTGG + Intergenic
1107042129 13:35960108-35960130 AAATGTTACCAGCTCAGCAGAGG + Intronic
1107331718 13:39308502-39308524 AACATTTACCAGCACTCCACTGG + Intergenic
1107603403 13:42036271-42036293 AAATTTTACCCACAGACCTTTGG + Intergenic
1107958027 13:45535713-45535735 ACATTTTACCAGCAAACCTAAGG + Exonic
1109367443 13:61373947-61373969 AACATTTACCAGCACACCATTGG + Intergenic
1109592768 13:64508551-64508573 AAATTTCACCAGAATAACATTGG + Intergenic
1110413382 13:75227053-75227075 AAAATTTATGAACACACCATTGG - Intergenic
1111197061 13:84888724-84888746 AAATGTTACCAAAACACCAGGGG + Intergenic
1111880097 13:93945100-93945122 AACATTTACCAGCACACCACTGG - Intronic
1112588554 13:100742547-100742569 AACATTTACTAGCACACCACTGG + Intergenic
1112639135 13:101252919-101252941 AAAATTTATCAGCACAGCACAGG - Intronic
1113454944 13:110441730-110441752 TAATTTTACCAGCACATGGTAGG - Intronic
1114963022 14:27918903-27918925 AACTTCTACCAGCAAACTATAGG + Intergenic
1116478430 14:45368165-45368187 ATGTTTTACCAGCATAGCATGGG + Intergenic
1116923022 14:50601413-50601435 ACATTTTGCCAGCACACCACTGG - Intronic
1117494318 14:56286810-56286832 AAATTTTACCAGCACTCTAGAGG + Intronic
1117772923 14:59152454-59152476 AAACTTAACCAGGACAGCATGGG - Intergenic
1118732724 14:68679885-68679907 AACATTTACCAGCACACTACTGG - Intronic
1121724787 14:96139362-96139384 AACATTTACCAGCACATAATGGG - Intergenic
1124794573 15:32764503-32764525 AAAAAATACCAGCACACCATAGG - Intergenic
1125749285 15:42017982-42018004 ACATTTTGCCAGCACAGAATTGG + Intronic
1125877053 15:43158307-43158329 AATATTTACCAGCACATCAGTGG - Intronic
1126747097 15:51837225-51837247 AAGTTTTACCACCACACCCAGGG - Intronic
1129569949 15:76671178-76671200 AAATATTAGCAGGACATCATGGG + Intronic
1130038225 15:80380817-80380839 AAAATTTACCAGCACACCACTGG + Intronic
1133457675 16:5957113-5957135 AATGTTTACCAGCACACTGTTGG + Intergenic
1133724409 16:8524007-8524029 AACATTCACCAGCACACCACTGG + Intergenic
1133941497 16:10312876-10312898 AACATTTACTAGCACACCACAGG + Intergenic
1135529501 16:23240494-23240516 AAATTCTAAGAGCACAGCATAGG + Intergenic
1138027146 16:53531014-53531036 ACATTTTAACAGCACTCCACTGG + Intergenic
1138242498 16:55438905-55438927 AAATTGTATCAGCACTACATGGG - Intronic
1138408302 16:56816899-56816921 AACATTTACCAGCACACTATTGG + Intronic
1139320358 16:66109467-66109489 GAATTTTGCCAGGACACCTTAGG + Intergenic
1140433180 16:74922235-74922257 AAATTTTTCCCAAACACCATAGG + Intronic
1140835011 16:78785423-78785445 ATCATTTACCAGCACACCACTGG - Intronic
1143470808 17:7174045-7174067 AAATTTGTCCAGCACCACATAGG - Exonic
1143761772 17:9109802-9109824 AAATTTAAACCACACACCATCGG - Intronic
1143850796 17:9810385-9810407 AACATTTGCCAGCACACCACTGG + Intronic
1144165549 17:12606794-12606816 AAATATTTCAAGCCCACCATTGG - Intergenic
1144801179 17:17928714-17928736 GAATTTTACCAGCACACAGTAGG + Intronic
1145788006 17:27606567-27606589 CACATTTACCAGCACACCACTGG - Intronic
1145894111 17:28442258-28442280 AATGTTTATCAGCACACCATTGG + Intergenic
1147401877 17:40185180-40185202 AATATTTACCAGTACACCACTGG - Intronic
1148141282 17:45330679-45330701 AACATGTACCATCACACCATCGG - Intergenic
1148442393 17:47718166-47718188 AACATTTGCCAGCACACCACTGG - Intergenic
1149596903 17:57869575-57869597 AACATTCACCAGCACACCAGGGG + Intronic
1150190619 17:63233715-63233737 AACTTGTACCAGCACACCACTGG + Intronic
1152429145 17:80237792-80237814 AACACTCACCAGCACACCATGGG - Intronic
1153095388 18:1395565-1395587 AAATTTTATCATCTCACCAGTGG + Intergenic
1155141093 18:23045020-23045042 AGCATTTACCAGCACACCAGTGG - Intergenic
1155324191 18:24649680-24649702 AATGTTTACCAGCACGTCATTGG + Intergenic
1155576156 18:27249242-27249264 AAATTGTACAAGCATACTATGGG - Intergenic
1158448528 18:57542506-57542528 AACGTTTATCAGCACACCACTGG + Intergenic
1159583086 18:70254992-70255014 AAAATGTAGCAGCACTCCATTGG - Intergenic
1161841923 19:6687118-6687140 AACTTTTACCAGCACACCACGGG - Intronic
1165242229 19:34478050-34478072 GACATTTACCAGCACACCACTGG + Intergenic
1165644454 19:37422696-37422718 AAATTTTACCAGCAGAACCAAGG + Intronic
925546211 2:5019664-5019686 AACATTTACCAGCAAACCAGTGG - Intergenic
926086161 2:10021623-10021645 AACATTTACCTGCACACCACAGG - Intergenic
928430048 2:31209911-31209933 GAATATTACCAGCACAGCACTGG + Intronic
928954026 2:36842913-36842935 AAATATTCCCAGAACACCTTGGG - Intergenic
929299685 2:40288732-40288754 CTAGTTTACCAGCACACCAGTGG + Intronic
929394181 2:41503205-41503227 AACATTTACCAACACACCACTGG + Intergenic
929422536 2:41807746-41807768 AACATTTACCAGCACATGATTGG + Intergenic
930854571 2:55999432-55999454 AATTTTTTCCATCACATCATGGG + Intergenic
932355324 2:71063716-71063738 AACACTTACCAGCACACCACTGG - Intergenic
932797158 2:74706330-74706352 AAATTTTTCCATGACACCACAGG + Intergenic
932842637 2:75097861-75097883 AAGTGTTACCAGCATACCACTGG - Intronic
936049054 2:109209330-109209352 AACGTTTGCCAGCACACCACTGG - Intronic
936776329 2:115978059-115978081 AAATTTTACATGTACAGCATTGG + Intergenic
938504832 2:131868397-131868419 AAATGTTACCCACACACAATGGG - Intergenic
940742759 2:157529273-157529295 TAATTTTATCAGCACCCCAGTGG + Exonic
941179694 2:162244100-162244122 ATAATTTACCAGCAGACCTTTGG + Intronic
941432977 2:165434208-165434230 TAGTTTTAGCAGCACAGCATTGG + Intergenic
941442161 2:165552044-165552066 AAACTTTATCATCACAACATGGG + Intronic
941494619 2:166184294-166184316 TACATTTACCAGTACACCATTGG + Intergenic
941714322 2:168748157-168748179 AAATTTATCCTACACACCATTGG - Intronic
942398732 2:175579032-175579054 ACATTTTACTATCACACAATTGG - Intergenic
943040279 2:182796362-182796384 AAACTTTTCCAGCTCACCACTGG + Intergenic
944394705 2:199253472-199253494 AACATTTACCAGTACAGCATTGG - Intergenic
945705107 2:213220907-213220929 AAATGTTTCCAGCACACTATTGG + Intergenic
946135477 2:217643319-217643341 AAATATTTCCAGCACACTACTGG + Intronic
947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG + Intergenic
1169051139 20:2578892-2578914 AAATTTTATCAGCACAGTAAGGG + Intronic
1169276808 20:4238782-4238804 AACATTTACCAGGACATCATAGG + Intronic
1170592990 20:17785329-17785351 AATATTTACCAGCATACCACTGG + Intergenic
1170729198 20:18957639-18957661 AATATTTGCCAGCACACCACTGG - Intergenic
1171052737 20:21875136-21875158 AACTTTTCCCCTCACACCATAGG - Intergenic
1173048378 20:39534955-39534977 AATGTTTACCAGAACACCACTGG + Intergenic
1173511939 20:43636604-43636626 AACATTTACCCGCATACCATTGG + Intronic
1174725197 20:52854267-52854289 TAAATGTACCAGCACACCACTGG + Intergenic
1174758809 20:53186299-53186321 AAGATTTACCAGCTCACCAGTGG + Intronic
1174770354 20:53293664-53293686 AAAATTTACCAGCACAGCACTGG - Intronic
1177359735 21:20052651-20052673 GAATTTAACCAGCCCACAATTGG + Intergenic
1178495807 21:33085483-33085505 CCATTTTGCCAGCACACCGTTGG - Intergenic
1179470687 21:41608117-41608139 AATTTATACCAGCACATCACAGG + Intergenic
1181444113 22:22955800-22955822 AACTTTTCCCAGCACACCAGTGG - Intergenic
1183233100 22:36595478-36595500 AACATGTACCAGCACACCACTGG + Intronic
1185204493 22:49529645-49529667 AGATTTCACCAGGACACCACAGG + Intronic
950189485 3:10966764-10966786 AAATTCTACCTGGACAACATGGG - Intergenic
952974927 3:38685708-38685730 AACACTTACCAGCACACCACTGG + Intergenic
955134330 3:56200912-56200934 AACGTTTACCAGCACATCATGGG + Intronic
955488366 3:59457727-59457749 AAAGTTAACCATCACAACATGGG - Intergenic
955532068 3:59884401-59884423 AATATTTACCAGCACACCACTGG + Intronic
956446246 3:69329085-69329107 AACATTTACCAGCATACCAGTGG + Intronic
956691297 3:71880210-71880232 AACATTTACCAGCACACTATTGG + Intergenic
957468242 3:80623147-80623169 AAATTTAACCATCACAACACTGG + Intergenic
959645371 3:108693579-108693601 AACCTTTACCAGCATACCACTGG + Exonic
959867440 3:111287091-111287113 AACATTTACCAGCACAACACTGG + Intergenic
960722950 3:120642485-120642507 AATATTTACCAGCACACCACTGG - Intronic
961411027 3:126720446-126720468 GAAATTTACCAGCACACGACTGG - Intronic
962101302 3:132345590-132345612 ATATTTTAACAGCACATAATTGG - Intronic
962102781 3:132359911-132359933 AAATCCTACCACCACACCACTGG + Intronic
962146477 3:132845027-132845049 AATATTTACCGGCACACCACTGG + Intergenic
962178701 3:133182617-133182639 CAGTTTTTCCAGCACACAATGGG - Intronic
962457828 3:135581457-135581479 AACATTCACCAGCACACCACTGG + Intergenic
963273379 3:143307281-143307303 AACACTTACCAGCACACCACTGG + Intronic
963655056 3:148037258-148037280 AAATTTTGCCAGCAGACTGTGGG - Intergenic
963900583 3:150729020-150729042 AACATTTACCAGCACACCTCTGG - Intergenic
964036949 3:152210626-152210648 AAAATTAACCATTACACCATGGG - Intergenic
964225663 3:154398130-154398152 AACATTTATCAACACACCATTGG + Intronic
964941640 3:162164569-162164591 AACATTTACCAGCAGACCATTGG - Intergenic
965748362 3:171949700-171949722 AACATTTACCAGCACACCACTGG - Intergenic
965840805 3:172903491-172903513 AAGTTTTACCATCACAGCACAGG - Intronic
966253898 3:177896727-177896749 AAAAGTTAACAGCACACCGTTGG + Intergenic
966274389 3:178147268-178147290 AATGTTTACCAGCACATCATTGG + Intergenic
966515669 3:180818340-180818362 AATATTTACCAGCACACAACTGG + Intronic
967281453 3:187827772-187827794 AACATTTTCCAGCACACCAGTGG - Intergenic
969549637 4:7856129-7856151 AAGTTTTCCTAGCACACAATAGG - Intronic
969929513 4:10616864-10616886 AAAATTTGCCAGAACACCACTGG + Intronic
973119840 4:46508591-46508613 AACATTTACCAGTACACCACTGG + Intergenic
975358492 4:73437562-73437584 AAATCTTAGCAGCAAACCATAGG + Intronic
975782876 4:77858226-77858248 AACTTTTACCAACACACCACTGG + Intergenic
975897605 4:79112699-79112721 AAATTATACCTACATACCATTGG - Intergenic
976533574 4:86184961-86184983 AACATTTACCAGCACACCATTGG - Intronic
976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG + Intronic
977607601 4:98997865-98997887 AAATTTTAAAAGCTGACCATAGG - Intronic
977958411 4:103056569-103056591 AGCATTTACCAGCACACCATTGG - Intronic
978498178 4:109382380-109382402 AACATTTACCAGCACACCAGTGG + Intergenic
978798505 4:112732133-112732155 AACATCTACCAGCACACCACTGG + Intergenic
978819712 4:112951658-112951680 AATGTTTACTAGCACACCACTGG - Intronic
978933620 4:114348551-114348573 ATATTTTATCAGCTCACCCTTGG - Intergenic
979358768 4:119736634-119736656 AACGTTTACCAGCACACCACTGG - Intergenic
979928593 4:126600360-126600382 AAATTTTAATGGCACAACATTGG - Intergenic
981887742 4:149697566-149697588 CAAATTTACCAGCACACCATTGG + Intergenic
982220483 4:153120969-153120991 AACATTTACCAGCACACCACTGG + Intergenic
982405185 4:155011699-155011721 AAACTTTACCAGCTCACCCCTGG + Intergenic
982596433 4:157391093-157391115 CCAATTTACCAGCACACCATTGG - Intergenic
984641269 4:182166562-182166584 AAATATTACCTGCATACTATGGG - Intronic
988213850 5:28245889-28245911 AAATTCTGCCAGCATACCAGTGG + Intergenic
989452314 5:41601043-41601065 AGCATTTACCAGCACACCACTGG + Intergenic
990494826 5:56337043-56337065 AATATTTACCAGCACACCACTGG + Intergenic
990494849 5:56337198-56337220 AACATTTACCAGCACACCAATGG + Intergenic
990810665 5:59719166-59719188 AATATTTACCAGCATACCAATGG - Intronic
992555824 5:77902217-77902239 AAATTTTACCAACCCAACAATGG - Intergenic
996205591 5:120731577-120731599 AAAATTTACCAGCACATCATTGG + Intergenic
997062016 5:130517762-130517784 AAATTGTACAAGCACACTCTTGG - Intergenic
997595752 5:135106377-135106399 AACATTTACCAGCACGCCACTGG + Intronic
997890148 5:137668903-137668925 AACATTTACCAGCACACCACTGG + Intronic
997911159 5:137874930-137874952 GACATTTACCAGCACACCACTGG - Intronic
998414323 5:141934896-141934918 AACATTTACCAGCACACTACTGG + Intronic
1001758127 5:174186318-174186340 AAATTTAACCAGGAAACCAGAGG - Intronic
1002380764 5:178827827-178827849 AGCATTTACCAGCACACCACTGG + Intergenic
1004828927 6:19456047-19456069 AAAATTTACCAGCAAACCAAGGG + Intergenic
1005718584 6:28577976-28577998 AAACTTTACTTGCAAACCATTGG + Intronic
1007483432 6:42164811-42164833 AACATTTACCAGCACACCACAGG + Intronic
1009349391 6:62654855-62654877 AAGATTTATGAGCACACCATTGG - Intergenic
1009421086 6:63465725-63465747 AACTTTCACCAGCACACCACAGG + Intergenic
1009948556 6:70368142-70368164 AACATTTGCCAGCACACCACTGG - Intergenic
1010072252 6:71757166-71757188 ATTATTTACCAGCACACCACTGG - Intergenic
1010840054 6:80638444-80638466 AACATTTACCAACACACCACTGG + Intergenic
1011026103 6:82871347-82871369 AACATTTACCAGCACACTACTGG - Intergenic
1011258356 6:85447027-85447049 AACATTTACCAGCACACCACTGG - Intergenic
1012338707 6:98091757-98091779 ACATTTTCCCAGGTCACCATTGG + Intergenic
1014319063 6:119903741-119903763 AAATTTTACCTGTATATCATAGG - Intergenic
1014547752 6:122752687-122752709 TAATTATGCCAGGACACCATGGG + Intergenic
1014732312 6:125047473-125047495 AAATGTTATCAGAATACCATGGG - Intronic
1014873469 6:126626420-126626442 AACTTCTAGCAGCACACCATTGG - Intergenic
1016626468 6:146175318-146175340 AAATTTTTCAATGACACCATTGG + Intronic
1017042207 6:150316624-150316646 AAATGTTGCCAGCACATCACAGG - Intergenic
1017285025 6:152664374-152664396 AAAGTTTATCATCACATCATGGG - Intergenic
1017330709 6:153195139-153195161 AACATTTACCAGCACACCACTGG - Intergenic
1017938304 6:159026618-159026640 ATATTTTAGCAGCAAACCACTGG + Intergenic
1018809004 6:167284181-167284203 AGATTTTACCAGAACCCCATGGG + Intronic
1019587190 7:1812001-1812023 AAATGTCACCAGGACACCATGGG - Intergenic
1020688784 7:11328834-11328856 AAATTTTACCCACACACCTACGG - Intergenic
1020957924 7:14765844-14765866 AACATTTACCAGCACACTATTGG - Intronic
1028095345 7:86753787-86753809 AATATTTACCAGCACACCACTGG - Intronic
1029093012 7:98063230-98063252 AACATTTACCAGCACACCACTGG + Intergenic
1029588499 7:101491341-101491363 AACACTTACCAGCACACCATTGG + Intronic
1029859153 7:103550853-103550875 AGATTTGAACAGGACACCATGGG - Intronic
1030212899 7:107013980-107014002 AAATTTTTCCAGAACATAATTGG - Intergenic
1030313934 7:108095007-108095029 AACATTTACCAGCTCACCACTGG - Intronic
1031028706 7:116711859-116711881 AACATTTACCAGCACATCACTGG - Intronic
1032065027 7:128761721-128761743 AACTTATTCTAGCACACCATTGG + Intronic
1036098773 8:5754884-5754906 AAATTTAGTTAGCACACCATGGG + Intergenic
1036685435 8:10906274-10906296 AACATTTACCAGCACACCACCGG + Intronic
1037018642 8:13940663-13940685 AAATTTTACCTTCTCACCACCGG - Intergenic
1037042070 8:14248144-14248166 AAAATCTACCAGCTCACCACTGG - Intronic
1038662960 8:29512960-29512982 AACATTTACCAGCATACCACTGG + Intergenic
1038987157 8:32824286-32824308 AAATTTTGCAATCACAACATAGG + Intergenic
1039045964 8:33449645-33449667 AGATTTTTCCATCACATCATAGG - Intronic
1040413160 8:47175606-47175628 CACATTTACCAGCACACCACTGG + Intergenic
1040580171 8:48691367-48691389 TACATTTACCAGCACACCACTGG - Intergenic
1042986231 8:74586091-74586113 AACCTTTACCAGCATGCCATTGG + Intergenic
1043885761 8:85598095-85598117 AACATTTACCAGCACACCACTGG - Intergenic
1044400386 8:91763995-91764017 CAGGTTTACCAGCACAACATTGG + Intergenic
1044970791 8:97617377-97617399 AACATTTACCAGCACACCGCTGG - Intergenic
1045352321 8:101353058-101353080 AACATTTACCAGCACACAACTGG + Intergenic
1047123538 8:121933191-121933213 AATATTTACCAGCACACCACTGG + Intergenic
1047166628 8:122446496-122446518 AACTTTTACCTGCACACCACAGG + Intergenic
1047778725 8:128094620-128094642 ACATTTTACCCACACACGATGGG - Intergenic
1048372873 8:133794960-133794982 AACATTTACCATCACACCACTGG - Intergenic
1048938751 8:139378401-139378423 AAAGGTTGCCAACACACCATGGG - Intergenic
1050266984 9:3901493-3901515 ATACATTACCAGCACACCACTGG + Intronic
1054817074 9:69485786-69485808 AAGTTTTACCACCACAGCTTTGG + Intronic
1055381990 9:75717429-75717451 CAATTTGTCAAGCACACCATAGG + Intergenic
1055492971 9:76825170-76825192 AACATTTACCAGCAGACCACTGG - Intronic
1055646867 9:78369477-78369499 AAATTTTAACAGCAGATTATGGG + Intergenic
1056294769 9:85181675-85181697 AAAGATTGCCAGCAAACCATCGG + Intergenic
1056721691 9:89077479-89077501 AACATTTACCAGCACACCACTGG + Intronic
1058754830 9:108074603-108074625 AATATTTACCAACAAACCATTGG + Intergenic
1059509274 9:114828933-114828955 AACATTTACCAGCCAACCATGGG + Intergenic
1059579205 9:115525409-115525431 AACATTTACCAGCATACCACTGG - Intergenic
1059725109 9:117000758-117000780 AACATTTACCAGCACAACACTGG - Intronic
1059734176 9:117085301-117085323 AACAATTACCAGCACACCACTGG - Intronic
1060398385 9:123332534-123332556 GCAGTTTACCAGCACACCACTGG - Intergenic
1061906342 9:133701285-133701307 AGCTGTTACCAGCACACCACAGG + Intronic
1186777742 X:12882664-12882686 AACATTTACCATCACACCACTGG + Intronic
1187118892 X:16384232-16384254 AAATTATCCCAGGACACCAATGG + Intergenic
1187199505 X:17121294-17121316 AAGGTTTACCAACACACCACTGG - Intronic
1187233509 X:17444697-17444719 GAATTTACCCAGCACACCACAGG + Intronic
1187649497 X:21386481-21386503 CCATTTTACAAGCACTCCATTGG - Intronic
1187773925 X:22733400-22733422 AATATTTACCAGCACACCACTGG + Intergenic
1187833742 X:23409559-23409581 AAAGTTTATCAGCACACAATTGG - Intergenic
1188439347 X:30199474-30199496 AAATTTTAACAGCCCTCTATCGG + Intergenic
1188912068 X:35861685-35861707 GAATGTTACTAGCACACCAAGGG - Intergenic
1189889545 X:45585044-45585066 AACATTTACCAGCATACCACTGG + Intergenic
1189969212 X:46400754-46400776 AACATTTACCAGCACACCACTGG - Intergenic
1190105560 X:47558611-47558633 AACATTTACCAGCACACCATTGG + Intergenic
1190479645 X:50863243-50863265 AATATTTACCAGCATACCATTGG - Intergenic
1191636051 X:63378278-63378300 CAGGTTTACCAGCACACCACTGG - Intergenic
1193946694 X:87745585-87745607 AAATATTTACCGCACACCATTGG - Intergenic
1194937969 X:99973921-99973943 AACATTTATCAGCACATCATTGG + Intergenic
1195252257 X:103060657-103060679 TTATTTTACCTGCACTCCATAGG + Intergenic
1195402338 X:104474721-104474743 AAATTTTACCAGCTCAACAATGG - Intergenic
1195510497 X:105710818-105710840 TATTTTTACCAGTACAACATTGG + Intronic
1196114870 X:111988091-111988113 AACATTTACCAGAACACCACTGG + Intronic
1196493271 X:116292916-116292938 AAATTATAAAAGCTCACCATAGG + Intergenic
1196947072 X:120837951-120837973 TAATTCTACCATGACACCATGGG - Intergenic
1197061485 X:122186410-122186432 CAATTTTACCAGGACATCCTAGG - Intergenic
1197651613 X:129071618-129071640 CCAATTTACCAGCACACCACAGG + Intergenic
1198119891 X:133581450-133581472 AATATTTACCAGCTCACCACTGG - Intronic
1199319056 X:146416956-146416978 GCCTTTTTCCAGCACACCATTGG - Intergenic
1199544778 X:148996294-148996316 ACATTTTACCAGCACACCACTGG - Exonic
1200043541 X:153387653-153387675 AACCTTAACCAGCACACCACAGG - Intergenic
1201887966 Y:18907322-18907344 AAATGTTACCAAAACACCACGGG + Intergenic