ID: 907783710

View in Genome Browser
Species Human (GRCh38)
Location 1:57591337-57591359
Sequence TTTCACATGGGCCAGTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907783710_907783714 28 Left 907783710 1:57591337-57591359 CCTGGTGACTGGCCCATGTGAAA 0: 1
1: 0
2: 1
3: 16
4: 140
Right 907783714 1:57591388-57591410 TGATATCACCACAAATGTTCAGG 0: 1
1: 0
2: 1
3: 5
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907783710 Original CRISPR TTTCACATGGGCCAGTCACC AGG (reversed) Intronic
900546979 1:3234682-3234704 GTTCACCTGGGCCAGGCCCCTGG - Intronic
901246716 1:7737364-7737386 TTTCACATGACCCCGTGACCTGG - Exonic
902148540 1:14423751-14423773 TTCCACATGGACCAGTGACCCGG + Intergenic
907783710 1:57591337-57591359 TTTCACATGGGCCAGTCACCAGG - Intronic
907889062 1:58620611-58620633 TTAGACATGGGCAAGACACCTGG + Intergenic
910767878 1:90800819-90800841 CTGCACCTGGGCCAGTCATCTGG - Intergenic
911230138 1:95352428-95352450 TTTCAAATAGGCCATTCACATGG + Intergenic
913656304 1:120963533-120963555 TTCCACATGGCCTAGACACCTGG + Intergenic
914007447 1:143744763-143744785 TTCCACATGGCCTAGACACCTGG + Intergenic
914520856 1:148414762-148414784 TTCCACATGGCCTAGACACCTGG + Intergenic
914646263 1:149655246-149655268 TTCCACATGGCCTAGACACCTGG + Intergenic
916022594 1:160807419-160807441 TGTCAAGTGGGCCAGTCATCAGG + Intronic
917512281 1:175678441-175678463 AGTCACATGGGCCAGTCTGCAGG + Intronic
923347216 1:233066297-233066319 TTTCCCATGGTCCAGTGAACAGG - Intronic
923589400 1:235305668-235305690 TTTTAAATGGGCCAGGCACGGGG + Intronic
1063879588 10:10517509-10517531 TTTGACATGTGCCTGTCTCCTGG + Intergenic
1063912750 10:10848922-10848944 TCTCACATGGTCCAGGTACCTGG + Intergenic
1067920942 10:50456683-50456705 TTTCACATGGGCCAAACCCTGGG - Intronic
1071917688 10:90314003-90314025 CTTCAAATGGGCCACTTACCAGG + Intergenic
1074430626 10:113391101-113391123 TTTCACAAAGGCCAGCCACTTGG + Intergenic
1077121051 11:908693-908715 TTACTCCTGGGCCAGTCCCCTGG - Intronic
1077413367 11:2413667-2413689 GCTCACGTGGGCCAGGCACCTGG - Intronic
1079955926 11:26864520-26864542 TTTCACATAGGCAAGTCTCCAGG + Intergenic
1081581612 11:44356146-44356168 TTTCAAATGGGCCTGTCTCTAGG + Intergenic
1086056252 11:82650790-82650812 TTTCACATTGATCAGTCACTGGG - Intergenic
1087553074 11:99676467-99676489 TTTCTCATAGGCCCCTCACCAGG + Intronic
1089614355 11:119686898-119686920 TTTCCCATGTGCCAGGCACTGGG - Intronic
1089640058 11:119842091-119842113 TCTCACATGGACCAGTCTTCTGG + Intergenic
1089938089 11:122386372-122386394 TTTATGATGGGCCAGGCACCAGG - Intergenic
1090955845 11:131512431-131512453 GATCACATGGGCCTGTCTCCAGG - Intronic
1103162379 12:118740213-118740235 ATTCACAAGGGCCTGCCACCTGG - Intergenic
1104248569 12:127067102-127067124 TTTGACATTCGCCAGTCACTGGG - Intergenic
1104419173 12:128621112-128621134 GTTCACATGGGCCAGCCCCCAGG - Intronic
1104639246 12:130456970-130456992 TCTCACATTGGCCAGTAGCCAGG - Intronic
1105005704 12:132719317-132719339 TGTCACCTGGGCCTGTCACCAGG + Intronic
1105233399 13:18522519-18522541 TTCCACAGTGGCTAGTCACCAGG - Intergenic
1105952589 13:25244217-25244239 TGTAAAATGGGCCAGTCAGCAGG - Intergenic
1106794253 13:33188069-33188091 TTTCCCATGGCCCAGCAACCAGG - Intronic
1107900351 13:45006419-45006441 TTTGAAATGGGTCATTCACCAGG + Intronic
1109473971 13:62853323-62853345 TTTCAGTTGTTCCAGTCACCTGG - Intergenic
1110072426 13:71193903-71193925 CTTCACATGGGCCACTGACATGG - Intergenic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1115131761 14:30061956-30061978 TTTCACATGGAACATTCTCCTGG - Intronic
1115132801 14:30073508-30073530 TTTCACATGGAACATTCTCCTGG - Intronic
1115201627 14:30860189-30860211 TAGCACAAGGGTCAGTCACCTGG - Intergenic
1118058073 14:62103592-62103614 TTTTAAATGGACCATTCACCAGG + Exonic
1129361607 15:75028064-75028086 CCACACATGGGCCAGTCACAAGG - Intronic
1130074535 15:80677336-80677358 CTACACTTGCGCCAGTCACCTGG + Intergenic
1131357677 15:91759775-91759797 TTGCAAAAGGGCCTGTCACCTGG + Intergenic
1131469862 15:92687420-92687442 TTTCCAGTGAGCCAGTCACCTGG - Intronic
1131719461 15:95151681-95151703 TTGAACCTGGGCCAGTCACTTGG - Intergenic
1134060916 16:11199011-11199033 ATTCACAGGTGCCAGTGACCGGG + Intergenic
1136364525 16:29803543-29803565 TTTCACATCGCACAGTCACAGGG + Exonic
1144391939 17:14801821-14801843 TTTACCTTGGCCCAGTCACCGGG - Intergenic
1144876092 17:18398192-18398214 TGTCACCTGGGCCTGTCACCTGG + Intergenic
1145156136 17:20546228-20546250 TGTCACCTGGGCCTGTCACCTGG - Intergenic
1147862179 17:43530103-43530125 TTACCCATGGCCCCGTCACCTGG + Exonic
1148001305 17:44389110-44389132 CTTCACCTGAGCCAGTCCCCTGG + Intronic
1152748840 17:82053250-82053272 TGCAACATGGGCCAGGCACCTGG - Intronic
1153119025 18:1698566-1698588 GTTCACATGGAGCACTCACCAGG - Intergenic
1153978664 18:10291079-10291101 GATCACGTGGGCCAGTCAGCTGG - Intergenic
1154519621 18:15212938-15212960 TTCCACAGCGGCTAGTCACCAGG + Intergenic
1156973347 18:43184882-43184904 TCTAACACTGGCCAGTCACCAGG + Intergenic
1158691248 18:59663077-59663099 TTTCCCATGTGCTAGGCACCAGG + Intronic
1158825155 18:61210025-61210047 AATCACATGGGCAATTCACCCGG + Intergenic
1159514101 18:69435242-69435264 TTGCACATTGGCCAGTCACTAGG + Intronic
1162726249 19:12691193-12691215 TGTCATAGGTGCCAGTCACCAGG + Exonic
1164845824 19:31431951-31431973 CCTCACATGAGCCAGTCACTTGG - Intergenic
926317478 2:11721700-11721722 TTGCCCATGGGCCAGACATCAGG - Intronic
927175917 2:20407524-20407546 TTTCAGAAGGCCCAATCACCAGG + Intergenic
928678211 2:33671333-33671355 CTTCAGACTGGCCAGTCACCTGG + Intergenic
932580224 2:72988551-72988573 TTTCTCATGGGCCAGTTACCTGG - Intronic
933899557 2:86839878-86839900 TTTCAGGTGGGCCCCTCACCCGG - Intronic
935781001 2:106509348-106509370 TTTCAGGTGGGCCCCTCACCCGG + Intergenic
937095467 2:119232555-119232577 TTCTACATGGGGCAGTCACAGGG + Intronic
937797539 2:126041635-126041657 TTTCACAGGGGCCTGACAGCTGG - Intergenic
938519603 2:132053566-132053588 TTCCACAACGGCTAGTCACCAGG + Intergenic
939085787 2:137716576-137716598 TGTAAAATGGGCCAGTCAGCAGG + Intergenic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
947102857 2:226639901-226639923 CTTCCCATGGCCCTGTCACCTGG - Intergenic
947338222 2:229109454-229109476 TCCCACATGGGCCAGTCCACAGG + Intronic
1169953897 20:11080165-11080187 ATTCACATAGTCCAGTCCCCAGG - Intergenic
1170513034 20:17098575-17098597 TTGCACATGGAGCATTCACCAGG + Intergenic
1172022984 20:31927733-31927755 TTTCCCATGTGCAAGTCATCTGG - Intronic
1175226715 20:57448860-57448882 TTTCACCTGGCTCAGCCACCAGG + Intergenic
1175803458 20:61814065-61814087 CTGCACATGGGCCCGGCACCTGG - Intronic
1176011691 20:62900260-62900282 TTTCATCTGGGCCAGTGGCCTGG - Intronic
1176777383 21:13150798-13150820 TTCCACAGTGGCTAGTCACCAGG - Intergenic
1179995512 21:44972255-44972277 GTTCACATGGGACAGCGACCTGG - Intronic
1180524997 22:16250263-16250285 TTCCACAGCGGCTAGTCACCAGG - Intergenic
1180882422 22:19215433-19215455 TTCCGCATGGGCCAGCCACCTGG - Intronic
1182760705 22:32720435-32720457 TCTCACATGGGCAAGTCACTTGG - Intronic
1184331952 22:43833071-43833093 TTTCCCATGGGCCAGGCCACAGG + Intronic
951230616 3:20174325-20174347 ATTCAGATAGACCAGTCACCAGG - Exonic
952578621 3:34804627-34804649 TTTCAGAAGGCCCAGTCTCCAGG - Intergenic
954439631 3:50514771-50514793 TTTGGCATGTGCCAGACACCGGG - Intergenic
954955988 3:54518506-54518528 TGTGACCTGGGCCAGTCATCTGG + Intronic
955408437 3:58640680-58640702 TTTCCCAGGGTCCAGTAACCTGG + Intronic
956047586 3:65212734-65212756 TTACACATGGAACAGTCTCCAGG + Intergenic
957167653 3:76695775-76695797 TATAACTTGGGCAAGTCACCTGG + Intronic
957363559 3:79191676-79191698 CTTCACATGGGCCCATCTCCAGG + Intronic
961960082 3:130845621-130845643 CTTCACATGGGCCTCTCATCAGG - Intergenic
962207282 3:133445308-133445330 TTTCACATGGCCCTGCCCCCAGG - Intronic
968310303 3:197677231-197677253 TCTCACATGGGCCACTCTGCAGG - Intronic
968797260 4:2715585-2715607 CTTAACATGGGCCTGTCCCCTGG + Intronic
973003576 4:44982613-44982635 TTTCACATGAGACACTCACATGG + Intergenic
973987772 4:56372217-56372239 TTTCACCTGGGACAGTCTCATGG + Intronic
975515951 4:75248541-75248563 TTTCTTATGGGCAAGTCACATGG - Intergenic
977089919 4:92658627-92658649 TTTCCAATGGCCCAGTGACCTGG - Intronic
977358723 4:95978706-95978728 TTTACCATGTGCCAGGCACCTGG + Intergenic
978422430 4:108546900-108546922 GATGCCATGGGCCAGTCACCAGG - Intergenic
980383370 4:132056538-132056560 ATTAACATGGGCCAGTCTTCTGG + Intergenic
982310978 4:153984692-153984714 TGCAACAGGGGCCAGTCACCTGG + Intergenic
983069844 4:163254684-163254706 CTTCACAGGGGCCAGTCCACAGG + Intergenic
983779656 4:171651622-171651644 TGCCACATGGGCCAGTCCTCGGG - Intergenic
983946428 4:173590872-173590894 TTTCAAATGGGCGAGTGACAAGG - Intergenic
987729256 5:21747185-21747207 TTTCACATGGACGAGTCAAGAGG - Intergenic
988627361 5:32891892-32891914 ATACACATGGGCCAGTCACACGG + Intergenic
990023749 5:51160041-51160063 CTGCTCATGGGCCAGTCAGCAGG + Intergenic
990272315 5:54156878-54156900 TTTCCCAGAGGCCAGACACCTGG - Intronic
997477069 5:134149450-134149472 TTTCACATGGGACAGCCACTGGG + Exonic
998415689 5:141944695-141944717 ATTTACATGAGCCAGGCACCAGG - Exonic
998910301 5:146952520-146952542 TTTCAGATGGGACAGTCAATTGG + Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999433649 5:151545071-151545093 TTTCATATGGTCCAGTCAGCAGG - Exonic
1000031227 5:157402713-157402735 TGTCACATGGACCAGTCCTCAGG - Intronic
1002090658 5:176803584-176803606 TTTCACATAGGCCCCTCAGCAGG + Intergenic
1006147812 6:31969708-31969730 TTTTACATGGGGCATTCACTGGG - Exonic
1008429971 6:51404669-51404691 TTTCAAAGGGGCCACACACCAGG + Intergenic
1010481648 6:76361868-76361890 TTTCACACAGGCCACTCACTAGG - Intergenic
1010764623 6:79765065-79765087 CTTCCCATGGACCAGTCAGCAGG + Intergenic
1012923469 6:105244337-105244359 TTTCCCATGGCCCAGGCACTGGG - Intergenic
1016172799 6:141040738-141040760 TGTAAAATGGGCCAGTCAGCAGG - Intergenic
1018654295 6:166019204-166019226 TTTCACATGGCACTGTTACCTGG + Intergenic
1022497073 7:30859976-30859998 TGTCACCTGGGCATGTCACCAGG + Intronic
1023029341 7:36079129-36079151 TTTCACATGGTACAGGCCCCAGG + Exonic
1023619914 7:42060141-42060163 TTTACCATGTGACAGTCACCAGG - Intronic
1029465846 7:100724049-100724071 ATTAACAAGGGCCAGTGACCAGG - Intergenic
1031468356 7:122141491-122141513 TTTCCCATGTGCCAGTCATTGGG - Intronic
1032854985 7:135826507-135826529 TTTCTCTTTGGTCAGTCACCCGG - Intergenic
1037539611 8:19858245-19858267 TGTCACATGGGGCAGCCATCTGG + Intergenic
1039812848 8:41065108-41065130 TATCACATTGGCCTGACACCAGG + Intergenic
1045297035 8:100881026-100881048 TTTAACCTGGGCCAGTTCCCAGG - Intergenic
1047619946 8:126596205-126596227 TCTCACATGGCCCACTCACATGG + Intergenic
1049627790 8:143633814-143633836 GTCCACATGGGCCAGGCACTGGG + Intergenic
1050524374 9:6532785-6532807 TTCCACATGTGCCAGTTGCCTGG - Exonic
1058459441 9:105169438-105169460 TTTCATATGTGCCAGGCACTGGG + Intergenic
1058727093 9:107814661-107814683 TGTGACATGGGCAAGTCACATGG - Intergenic
1062276978 9:135735892-135735914 TGTCACCTGGGCGAGTCACCTGG + Intronic
1192336139 X:70221449-70221471 TTTCACCTCAGCCAGTTACCAGG - Intergenic
1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG + Intergenic
1199540538 X:148953403-148953425 TTCAACTTGGGCCAGTCACTGGG + Intronic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic
1201919846 Y:19222423-19222445 TTTAAAATGGGCCAGTCATCAGG + Intergenic
1202192977 Y:22262863-22262885 TGTCAAATGGACCAGTCAGCAGG - Intergenic
1202245374 Y:22814794-22814816 TTGAACATGGACAAGTCACCAGG + Intergenic
1202398364 Y:24448542-24448564 TTGAACATGGACAAGTCACCAGG + Intergenic
1202472417 Y:25221544-25221566 TTGAACATGGACAAGTCACCAGG - Intergenic