ID: 907789173

View in Genome Browser
Species Human (GRCh38)
Location 1:57645072-57645094
Sequence CTGTGGATCCAGATGAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907789173_907789176 7 Left 907789173 1:57645072-57645094 CCAAGGTTCATCTGGATCCACAG 0: 1
1: 0
2: 4
3: 25
4: 312
Right 907789176 1:57645102-57645124 ACAGCATGTGAGTTACAGGATGG 0: 1
1: 0
2: 1
3: 20
4: 182
907789173_907789175 3 Left 907789173 1:57645072-57645094 CCAAGGTTCATCTGGATCCACAG 0: 1
1: 0
2: 4
3: 25
4: 312
Right 907789175 1:57645098-57645120 AGCAACAGCATGTGAGTTACAGG 0: 1
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907789173 Original CRISPR CTGTGGATCCAGATGAACCT TGG (reversed) Intronic
901447621 1:9317969-9317991 CTGTGGAACCAGAGGAAGCTGGG + Intronic
901758008 1:11453146-11453168 CTCTGGAGTCAGATGAACCAGGG - Intergenic
903476349 1:23621562-23621584 CTTTGGATCCAGAGAGACCTGGG - Intronic
904943033 1:34177931-34177953 TGGTGGATCCAGATGTATCTGGG - Exonic
905118200 1:35660588-35660610 CTGTAAGTCCAGATGGACCTTGG - Intergenic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905338745 1:37264002-37264024 CTTTGGAGTCAGATGAACTTTGG - Intergenic
905360868 1:37419451-37419473 CTGTGATGCCAGATCAACCTAGG - Intergenic
905403652 1:37719477-37719499 CTGTGGATCTGGGAGAACCTGGG + Exonic
906461091 1:46035472-46035494 CTGTGGCTCCAGACTGACCTAGG - Exonic
907265803 1:53260107-53260129 CTGTGGAACCAGATAGACCTGGG + Intronic
907304771 1:53507387-53507409 CTCTGAAGCCAGATGGACCTGGG - Intronic
907565986 1:55434209-55434231 CTGTGAATCCATCTGGACCTGGG - Intergenic
907789173 1:57645072-57645094 CTGTGGATCCAGATGAACCTTGG - Intronic
908654334 1:66371986-66372008 CTTTGGAATCAGATGAAGCTGGG + Intronic
909492863 1:76245044-76245066 CTGTGGATCCATCTGGTCCTGGG + Intronic
910374830 1:86556796-86556818 CTGTGAATCCATAAGATCCTGGG + Intronic
911585443 1:99684892-99684914 CTGTGGAATCAGGTGGACCTGGG - Intronic
911600457 1:99842682-99842704 CAGTGGATCCAGATGAAAACTGG + Intergenic
912544827 1:110443130-110443152 CTGGGGATACAGAGGATCCTTGG + Intergenic
912967059 1:114245335-114245357 CTGTGAATCCATCTGATCCTGGG - Intergenic
913262462 1:117011889-117011911 TTCAGGATCCAGATGAAACTTGG + Exonic
913485082 1:119326892-119326914 CTGTGGAATCCGATGGACCTTGG - Intergenic
914196741 1:145451686-145451708 GTGTGGAGGCAGAGGAACCTGGG + Intergenic
914399991 1:147309955-147309977 CTGTGAATCCATCTGGACCTGGG - Intergenic
915196816 1:154195595-154195617 CTGTGGGTTCAGATGAACAGAGG + Intergenic
916440380 1:164819192-164819214 CAGTGGAACCAGTGGAACCTGGG + Intronic
916938856 1:169659775-169659797 CTGTGAATCCATCTGATCCTGGG - Intergenic
917768264 1:178247177-178247199 CTGTGGATCCATCTGGTCCTGGG + Intronic
919381307 1:196864898-196864920 CTGTGAATCCATCTGGACCTGGG - Intronic
919921974 1:202171477-202171499 CTCTGGATGCAGATGCCCCTGGG - Intergenic
920871818 1:209801322-209801344 CTGTGTAGCCAGATGAGCCCAGG + Exonic
921630121 1:217423305-217423327 CTGTGGCTCCAAATGATACTAGG - Intergenic
922007673 1:221548743-221548765 TTTTGGATTCAGATGGACCTGGG - Intergenic
922287235 1:224181088-224181110 CTGCCAATCCAGATGAAACTTGG + Intronic
922289491 1:224198655-224198677 CTGCCAATCCAGATGAAACTTGG - Intergenic
922999768 1:229997253-229997275 CTGTTCATCCAGATAATCCTGGG + Intergenic
924868197 1:248009553-248009575 CTGTGAATCCATCTGATCCTGGG - Intronic
1062952679 10:1516368-1516390 CTCTGAATCCAGCTGCACCTCGG - Intronic
1063328437 10:5129798-5129820 CTGTGAATCCATCTGATCCTTGG - Intronic
1065199886 10:23302345-23302367 CTTTAGATTCAGGTGAACCTTGG + Intronic
1067764834 10:49076937-49076959 CTGTGGCATCAGATGAGCCTAGG - Intronic
1067818064 10:49498415-49498437 CTCTGGAACCAGATGAACTTGGG - Intronic
1069603590 10:69725543-69725565 CTGTGTTTCCAGGGGAACCTAGG - Intergenic
1069796585 10:71056730-71056752 CTCTGGACCCAGACAAACCTTGG - Intergenic
1071401462 10:85277002-85277024 CTGTGAATCCAGCTGGTCCTGGG + Intergenic
1071783234 10:88870676-88870698 CTCTGGAACCAGATAGACCTGGG - Intergenic
1074795168 10:116935776-116935798 CTGTGAATCCATCTGATCCTGGG + Intronic
1075713038 10:124540847-124540869 AGTTGGATCCAGAGGAACCTGGG + Intronic
1076433202 10:130422056-130422078 CTGTGGCTTCAAAAGAACCTTGG - Intergenic
1076977809 11:188682-188704 CTATGGACCCAGATGGTCCTGGG - Intronic
1080893092 11:36426583-36426605 CTTTGGATTCAGACCAACCTTGG + Intronic
1082620022 11:55408831-55408853 CTGTGAATCCATCTGGACCTGGG + Intergenic
1083073168 11:60008234-60008256 CTGTGAATCCATTTGATCCTGGG + Intergenic
1083608102 11:63991096-63991118 CTGTGGAGCCTGATGGGCCTGGG + Intronic
1084431528 11:69114082-69114104 CGGTGGAGCCAGATGGACCTGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085184008 11:74559954-74559976 CTGAGGATCCAGAAGGACTTAGG + Intronic
1085660412 11:78360101-78360123 CGGTGGCTCCAGATGTTCCTTGG - Intronic
1086086905 11:82964840-82964862 CTGTGAATCCATCTGATCCTGGG + Intronic
1086240976 11:84690814-84690836 CTTTGGAATCAGATAAACCTAGG - Intronic
1086684058 11:89709996-89710018 CTGTGGCTACAGATGAGCCCAGG + Intergenic
1087052380 11:93899047-93899069 CTGTGAATCCATCTGATCCTGGG - Intergenic
1087569518 11:99906755-99906777 CTGTGAATCCATCTGATCCTGGG + Intronic
1087868583 11:103264235-103264257 CTGTGAATCCATCTGACCCTGGG - Intronic
1088054114 11:105554577-105554599 CAGTGGATCATGATGAGCCTAGG + Intergenic
1089267480 11:117275770-117275792 CTGTGAATCCATCTGGACCTGGG - Intronic
1092026292 12:5243500-5243522 CTAGGGCTACAGATGAACCTGGG + Intergenic
1092706143 12:11287118-11287140 CTGTGAATCCAGCTGGTCCTGGG - Intergenic
1095881448 12:47141538-47141560 CTGTGGATCCTGAAGCAGCTTGG + Intronic
1097423670 12:59414250-59414272 CTGTCTATCCAGATGATCCCTGG + Intergenic
1097794536 12:63847228-63847250 CTGTGGTTCCACTTGAACCCAGG + Intronic
1097898520 12:64850885-64850907 CTGTGAATCCATCTGATCCTGGG + Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1099231755 12:80034875-80034897 CTCTGGAGCCACAAGAACCTAGG - Intergenic
1100073601 12:90752088-90752110 CTGTGAATCCATCTGATCCTGGG + Intergenic
1101837272 12:108304297-108304319 CCCTGGATCCATATGAACTTGGG - Intronic
1102715010 12:114962994-114963016 CTTTGGAGTCAGATGGACCTGGG - Intergenic
1106433000 13:29699456-29699478 CTGTGAATCCATCTGAAACTGGG - Intergenic
1106442228 13:29786138-29786160 CTGTGGGCTCAGATGCACCTGGG - Intronic
1109745602 13:66619673-66619695 CTATGGAGTCAGATTAACCTAGG - Intronic
1111622003 13:90736355-90736377 CTGTGCATCCAGCTGATCCTGGG - Intergenic
1112102529 13:96205357-96205379 CTGTGAATCTGGATGATCCTGGG - Intronic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1114980541 14:28158294-28158316 CTGTGGATGCGGATGCCCCTTGG - Intergenic
1114998384 14:28389037-28389059 CTGTGAATCCATTTGGACCTGGG + Intergenic
1115385800 14:32795164-32795186 CTGTGAATCCAAATGGTCCTGGG - Intronic
1115829170 14:37315815-37315837 CTGTGGGACTAGATGAAACTGGG + Intronic
1117826278 14:59707111-59707133 CTTTGGAGCTAGATGGACCTTGG - Intronic
1117873427 14:60224407-60224429 CTTTGGAGCCAGACAAACCTGGG + Intergenic
1119180873 14:72604629-72604651 CTGTGGACACAGATGACCCAGGG + Intergenic
1119524704 14:75313303-75313325 CTTTGGAGTCAGATGAACTTGGG - Intergenic
1120906569 14:89625821-89625843 CAGTTGATCCAGATGACCTTTGG + Intergenic
1121258938 14:92552503-92552525 CTGTGGCTCCAGATGCTCATGGG + Intronic
1121567676 14:94923002-94923024 CTATGGATCCAGAGGGAGCTGGG - Intergenic
1122862295 14:104588036-104588058 CTGTGTGTCCAGATGACCCCAGG - Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1128783921 15:70380763-70380785 CTCTGGATGCAGATGAAGCTGGG - Intergenic
1128799456 15:70488353-70488375 CTGTGGTTCCAGAGTCACCTGGG - Intergenic
1128815977 15:70608566-70608588 CTTTGGATTCAGATAAATCTGGG + Intergenic
1129323314 15:74786777-74786799 CTGTAGCCCCAGATGACCCTAGG + Intronic
1129928384 15:79385946-79385968 CTGTGGATTCTGGTGGACCTGGG - Intronic
1130857402 15:87852928-87852950 CTTCGGAGTCAGATGAACCTAGG + Intergenic
1131002524 15:88950134-88950156 CAGCGGTTCCAGATGAGCCTAGG + Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133384842 16:5361168-5361190 CACTGGACCCAGATAAACCTGGG - Intergenic
1134089050 16:11380865-11380887 CTGTGGCTCCACAGGAACCTCGG - Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135341839 16:21654961-21654983 CCTTGGATCCAGACAAACCTGGG + Intronic
1137828422 16:51520304-51520326 CTGTGAATCCATCTGATCCTGGG - Intergenic
1137973948 16:53014535-53014557 CTGTGAATCCAGATGCCTCTAGG - Intergenic
1141213995 16:82007554-82007576 CTGTAGAGTCAGATGCACCTGGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141628719 16:85275459-85275481 CTTTGCATCCAGAAGTACCTCGG + Intergenic
1141892896 16:86938993-86939015 TTCTGGAGCCAGATGAACCTGGG + Intergenic
1142442523 16:90108647-90108669 CTATGGACCCAGATGGTCCTGGG + Intergenic
1142465230 17:133147-133169 CTATGGACCCAGATGGTCCTGGG - Intergenic
1142911902 17:3101052-3101074 CTGTGAATCCATGTGAACCTGGG - Intergenic
1143680032 17:8469541-8469563 CTGTGGGTCCAGAAGAGCCTGGG + Intronic
1144051227 17:11498737-11498759 CTGTGGAGCCAGAAAGACCTGGG + Intronic
1144276681 17:13676162-13676184 CTGTGAATCCATCTGATCCTGGG - Intergenic
1144279036 17:13706025-13706047 CTGGGGTTCAAGATTAACCTGGG - Intergenic
1147555295 17:41475333-41475355 ATGTGGAGTCAGATGGACCTGGG - Intergenic
1147616675 17:41833035-41833057 CTGTGGATCCAGGTGCTCCCTGG - Intronic
1149096328 17:52845272-52845294 CTGTGTAACCAGATGATCCTGGG + Intergenic
1149536295 17:57436150-57436172 CTTTGGAATGAGATGAACCTGGG + Intronic
1149987105 17:61355523-61355545 CTTTGGAGCCAAATGAACCTAGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150546156 17:66159230-66159252 CTGTGAATCCATCTGGACCTGGG - Intronic
1151658615 17:75507321-75507343 CTGTGGATCATGATGACCCCAGG + Intronic
1152681031 17:81668030-81668052 CTGTGGTTCCAGACGAGGCTTGG + Intronic
1153524198 18:5979318-5979340 CTGTGTGTCCACATGAGCCTGGG - Intronic
1153576139 18:6523787-6523809 CTAAGAACCCAGATGAACCTGGG - Intronic
1155333937 18:24746012-24746034 CTGTGGCACCAGAATAACCTTGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155643912 18:28054177-28054199 CCTTGGATCCAGATGATCCCAGG - Intronic
1155872627 18:31046364-31046386 CTCTAGATCCAAATGACCCTTGG + Intergenic
1156143644 18:34147827-34147849 CTGTGAATCCATCTGATCCTGGG + Intronic
1156441681 18:37195791-37195813 CTGTGGTTCCATATGAATTTTGG + Intronic
1157003619 18:43556215-43556237 CTGTGAATCCATATGATCCTGGG + Intergenic
1157272188 18:46284357-46284379 CTTTGGACCCAGATAAACCCAGG + Intergenic
1158774000 18:60555196-60555218 CTGTGGAGCCAGAAGGAGCTGGG + Intergenic
1158803801 18:60945593-60945615 CTGTGGTTGCAGATGAAACATGG + Intergenic
1159331162 18:66995634-66995656 CTGTGAATCCATCTGGACCTGGG - Intergenic
1164453631 19:28388421-28388443 GTGATGATGCAGATGAACCTAGG - Intergenic
1164705551 19:30316921-30316943 CTGTGGACCCTGAGGAGCCTAGG + Intronic
1166711570 19:44941025-44941047 CTCTGGCTTCAGATGGACCTGGG - Intergenic
1167133297 19:47601483-47601505 CTGAGTCACCAGATGAACCTAGG - Intergenic
925447195 2:3937525-3937547 CTGTGAATCCATATGGTCCTAGG + Intergenic
925790599 2:7482437-7482459 CTGTGAATCCACCTGGACCTGGG - Intergenic
926999993 2:18784536-18784558 CTGAGAATCCAGCTGACCCTGGG + Intergenic
927147925 2:20179108-20179130 ATTTGGGTGCAGATGAACCTGGG + Intergenic
927546488 2:23958681-23958703 CTTTGGAGTCAGATAAACCTAGG + Intronic
928637506 2:33262792-33262814 CTGTGGATGCAGATGAATAGTGG - Exonic
928668810 2:33579427-33579449 CTCTGGAGCCAGATGGCCCTAGG + Intergenic
929064418 2:37959263-37959285 CTGTGAATCCATCTGGACCTGGG + Intronic
930719565 2:54626154-54626176 CAGCGGCTCGAGATGAACCTGGG + Exonic
931069331 2:58626759-58626781 CTCAGGCTCCAGATGAGCCTAGG - Intergenic
931191073 2:60000855-60000877 CTGTGGATCCAGAACTGCCTAGG + Intergenic
931709178 2:64973043-64973065 CCAGGGATCCAGATGAAGCTGGG + Intergenic
932243091 2:70173062-70173084 CTGAGGCACGAGATGAACCTGGG + Intronic
937377938 2:121350517-121350539 CTGTGGCTCCAGAAGACGCTCGG + Intronic
937643685 2:124242238-124242260 CAGTGGCTCCAGATGGACCTGGG + Exonic
937758313 2:125567967-125567989 CCTTGGTTTCAGATGAACCTGGG - Intergenic
937875721 2:126823960-126823982 CTGTGGCTACAGATGAGCCTTGG + Intergenic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
939637691 2:144602386-144602408 CTGAGGATCATGATGAACATTGG + Intergenic
941608792 2:167634732-167634754 CTGTGAATCCATCTGGACCTGGG - Intergenic
943334740 2:186600066-186600088 CAGTGGCTTCAAATGAACCTTGG + Intronic
943568463 2:189544082-189544104 ATGTGGCTCCATATGATCCTGGG + Intergenic
944747651 2:202674674-202674696 CTGTGGATGGAGAAGAAACTGGG - Intronic
946837943 2:223791057-223791079 CTGTGAATCCATCTGATCCTGGG - Intronic
947086342 2:226457246-226457268 CTGTGAATCCATCTGATCCTGGG - Intergenic
947322225 2:228933075-228933097 CTGTGGATCCATCTGGTCCTTGG + Intronic
947945102 2:234094324-234094346 CAGTGGCTCCAGATGTTCCTTGG - Intergenic
948873658 2:240816575-240816597 CTGGGGATTCAGATGACCTTTGG - Intronic
1169938634 20:10912804-10912826 CTTTGAATTGAGATGAACCTGGG - Intergenic
1170982317 20:21226313-21226335 TTGTGGATCCAGATGCCTCTAGG - Intronic
1171318159 20:24214158-24214180 CTGTGTACTCAGATGCACCTTGG - Intergenic
1171456604 20:25276057-25276079 CTCTGGATGCAGGGGAACCTGGG + Intronic
1173868335 20:46327147-46327169 TTCTGGATCAAGATAAACCTGGG + Intergenic
1174635118 20:51992778-51992800 CTCTGGATTCAGATGAGCCTGGG + Intergenic
1174696455 20:52564584-52564606 CTTTGGAACCAAATGGACCTGGG - Intergenic
1175420905 20:58832851-58832873 GTGGGGATTGAGATGAACCTTGG - Intergenic
1177617590 21:23543540-23543562 CAGTTGATCCAGAAGGACCTTGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182297498 22:29318411-29318433 CTCTGGGTCCAGATGAAGCCAGG - Intronic
1184462783 22:44648760-44648782 CTGGGGACCCCCATGAACCTTGG - Intergenic
1185046699 22:48532027-48532049 CTGTGCATCCAGAGGAAGGTGGG + Intronic
1185253498 22:49818366-49818388 CTTTGCATTCTGATGAACCTAGG + Intronic
951734618 3:25850567-25850589 ATGTGTTTCCAAATGAACCTGGG + Intergenic
953083449 3:39643438-39643460 CTGTGGATTCAGACAAACTTAGG - Intergenic
954510185 3:51117575-51117597 CTGTGAATCCATCTGATCCTCGG + Intronic
955083295 3:55677654-55677676 CTCTGGATTCAGATAGACCTAGG - Intronic
955635329 3:61022374-61022396 CTGTGGATCCATCTGGTCCTGGG - Intronic
955937594 3:64116726-64116748 CTGTGAATCCATCTGATCCTGGG - Intronic
956741164 3:72277275-72277297 CTGGGGTTCCAGATGAATCTTGG - Intergenic
956963783 3:74434566-74434588 CTGTGGAGTCAGACAAACCTAGG + Intronic
958638004 3:96770278-96770300 CTCTGAATTCAGATGAACCCAGG + Intergenic
959622697 3:108415391-108415413 CTTTGGAGTCAGATGAACTTGGG + Intronic
959828675 3:110833462-110833484 CTGTGAATCCACCTGGACCTGGG + Intergenic
959875990 3:111382752-111382774 CTGTGAATCCATCTGGACCTGGG - Intronic
961542990 3:127612815-127612837 CTTTGGATTCAGATGCATCTGGG + Intronic
961575790 3:127835076-127835098 CTGTGGGTCAAGATAAAGCTTGG + Intergenic
961829823 3:129617743-129617765 CTGTGGAGCCAGAAGGATCTGGG + Intergenic
962335320 3:134524992-134525014 CTGTGAATCCATCTGACCCTGGG + Intronic
964091687 3:152884834-152884856 CAGGAGTTCCAGATGAACCTGGG + Intergenic
964581540 3:158244736-158244758 CTGTGAATCCATCTGATCCTGGG + Intronic
967205912 3:187121206-187121228 CAGTGGATTCAGATGAAACCTGG - Exonic
968362796 3:198159607-198159629 CTATGGACCCAGATGGTCCTGGG + Intergenic
969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG + Intergenic
970551319 4:17184662-17184684 CTGTGGTTCCAGGTGTTCCTTGG - Intergenic
970818067 4:20181297-20181319 CTGAGGATCCAGATGACCACAGG + Intergenic
971387293 4:26152683-26152705 CTATGGATTCAGAACAACCTGGG - Intergenic
971712642 4:30136152-30136174 CTGTGAGGCCAGATGAATCTTGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974466970 4:62270473-62270495 CTGTGGTTCTAGATGAGACTTGG - Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978278005 4:106975353-106975375 CTGTGAATCCATCTGATCCTGGG + Intronic
978694382 4:111559198-111559220 CTGTGAATCCATCTGATCCTGGG + Intergenic
983634286 4:169882072-169882094 CTGTGGATCAAGATGCACCTGGG - Intergenic
985864339 5:2502336-2502358 TTGTGGAACCAGAGGACCCTGGG + Intergenic
988590614 5:32545648-32545670 CTGTGGCTCCAGATAAGCGTGGG + Intronic
988708946 5:33754380-33754402 CTGGGCATTCAGAAGAACCTGGG + Intronic
989484788 5:41977011-41977033 CTGTGGCTCAAGCTGTACCTGGG + Intergenic
989495454 5:42107012-42107034 CTTTCCAGCCAGATGAACCTGGG + Intergenic
992325031 5:75652004-75652026 CTTTGAATCCAGATGAACCCTGG - Intronic
994642270 5:102424651-102424673 CTGTCGATCCATCTGATCCTGGG - Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995894286 5:116994521-116994543 CTGGGGACCCAGATAGACCTGGG - Intergenic
996130274 5:119773059-119773081 CTGTGAATCCATCTGATCCTGGG - Intergenic
996169735 5:120274600-120274622 CTGTGAATCCATCTGATCCTGGG - Intergenic
997472855 5:134126316-134126338 GTGTGGGGACAGATGAACCTGGG + Intronic
997802389 5:136878198-136878220 CTGTGAATCCATCTGATCCTGGG - Intergenic
998217645 5:140249507-140249529 CTGTGAGTGCAGAAGAACCTTGG + Intronic
999575197 5:152968665-152968687 CTGTGAATCCATCTGACCCTGGG - Intergenic
999691627 5:154151081-154151103 CTCTGGATCCAGATGACTTTTGG + Intronic
1000386422 5:160678729-160678751 CATTGGATCCACATGACCCTGGG + Intronic
1000398901 5:160804562-160804584 CTTTGGATCTATATGAACCTGGG - Intronic
1001155839 5:169271910-169271932 CTATGGACCCAGATGTCCCTTGG - Intronic
1001277350 5:170360306-170360328 CTCTGGACCCAGAGGGACCTGGG + Intronic
1003902340 6:10666465-10666487 CTGTGAATCCATTTGATCCTGGG + Intergenic
1005997013 6:30937580-30937602 CTGTGGAGCCACATTCACCTGGG + Intergenic
1006057144 6:31393767-31393789 CTGTTGATCAAGATGTTCCTGGG + Intergenic
1008823518 6:55662793-55662815 CTGTGAATCCATCTGACCCTGGG + Intergenic
1010575238 6:77521958-77521980 CTGTGAATCCAGCTGGTCCTGGG - Intergenic
1010956724 6:82098627-82098649 CTGTGGATCCACCTGGTCCTTGG - Intergenic
1011073032 6:83406440-83406462 CTGTGAATCCATCTGATCCTGGG + Intronic
1011138170 6:84122097-84122119 CTGTGAATCCATCTGATCCTGGG - Intergenic
1012079686 6:94740286-94740308 CTGTGAATCCATCTGGACCTGGG - Intergenic
1012187350 6:96235648-96235670 CTTTGGAGTCAGATGAATCTGGG - Intergenic
1012350710 6:98246689-98246711 CTCTAGATTCAGATGAAACTTGG + Intergenic
1012613088 6:101240307-101240329 CAATGCATCCAAATGAACCTAGG + Intergenic
1013461880 6:110382317-110382339 CTGTGAATCCATCTGATCCTGGG - Intergenic
1013727436 6:113116594-113116616 CTGTGAATCCATCTGATCCTGGG - Intergenic
1013901583 6:115163252-115163274 CTGTGAATCCATCTGGACCTGGG + Intergenic
1014243955 6:119047757-119047779 CCGTGAATCCATATGATCCTGGG - Intronic
1014893371 6:126870034-126870056 CTGTGAATGCAGATGATACTGGG - Intergenic
1015777141 6:136825232-136825254 TATTGGATCCAGATGAAGCTGGG + Exonic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017615026 6:156237364-156237386 CTGTGAATCCAACTGATCCTGGG + Intergenic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1018696454 6:166395289-166395311 CTGTGGATCCAGCTGGGCGTGGG - Intergenic
1019252887 7:29104-29126 CTATGGACCCAGATGGTCCTGGG - Intergenic
1021870251 7:24998865-24998887 CTGTGAATCCATATGGTCCTGGG + Intergenic
1022310581 7:29193348-29193370 CTGGGGATCCACATCAACCAAGG - Intronic
1023115616 7:36859122-36859144 CTGTAGATTCAGAGAAACCTAGG + Intronic
1023340389 7:39213313-39213335 CTGTGGATGCTGAAGTACCTGGG + Intronic
1024241827 7:47441622-47441644 CTGTGGATCCTCATGACCGTAGG - Intronic
1024560003 7:50635918-50635940 CTGTGGATCCATCTGGTCCTGGG - Intronic
1024893917 7:54234548-54234570 CTGTGAATCCATCTGATCCTGGG - Intergenic
1025144257 7:56491277-56491299 CAGTGGGTCCAGATGAAGCATGG - Intergenic
1025259871 7:57411758-57411780 CAGTGGGTCCAGATGACCCATGG - Intergenic
1027050296 7:75017541-75017563 CTGAGGTTCCAGATGACCCAAGG - Intronic
1027785738 7:82576884-82576906 TTTTGAAGCCAGATGAACCTGGG + Intergenic
1027949578 7:84797345-84797367 CTGTGGATCCATCTGATCCAGGG + Intergenic
1028754175 7:94416464-94416486 CTGGGGGTCCAGAAGGACCTCGG - Exonic
1028900079 7:96088637-96088659 CTGTGAATCGAGATTAACCCGGG + Intronic
1028949418 7:96618134-96618156 CTGTGAATCCATCTGAACTTGGG + Intronic
1029510848 7:100994055-100994077 CTGTGGTTTCAGTTGAGCCTCGG - Exonic
1029511341 7:100997304-100997326 CTGTGGTTTCAGTTGAGCCTGGG - Exonic
1029511567 7:100998726-100998748 CTGTGGTTTCAGTTGAGCCTGGG - Exonic
1029512065 7:101001975-101001997 CTGTGGTTTCAGTTGAGCCTGGG - Exonic
1029512527 7:101005131-101005153 CTGTGGTTTCAGTTGAGCCTGGG - Exonic
1030376581 7:108759531-108759553 CTGTGAATCCATCTGATCCTGGG - Intergenic
1030696633 7:112592040-112592062 CTGTGCATCCATCTGGACCTGGG - Intergenic
1031985952 7:128164871-128164893 CTGTGGGCCCAGATGAGACTGGG + Intergenic
1034156317 7:148958894-148958916 CTGAGGCTCCAGGTGAACCAAGG - Intergenic
1034837673 7:154367287-154367309 CTGTGGCTCCAGGTTAACCAAGG - Intronic
1035696186 8:1598475-1598497 CTGTGAATCCATCTGATCCTGGG + Intronic
1037994604 8:23343182-23343204 TTGTGGATCCATGTGAAGCTGGG - Intronic
1038745327 8:30249700-30249722 CAGTGGATCCTGATGAACCTGGG - Intergenic
1038878471 8:31579303-31579325 CTGTGAATCCATCTGATCCTGGG - Intergenic
1039304809 8:36249874-36249896 GTGTGGAGCCAGCTGATCCTTGG - Intergenic
1040958718 8:53007766-53007788 CAGAAGTTCCAGATGAACCTGGG - Intergenic
1042005329 8:64173242-64173264 ATTTGGATCCAGACAAACCTTGG + Intergenic
1042130815 8:65585323-65585345 CTGTAGATCCAGTGGACCCTGGG + Intergenic
1044350100 8:91154252-91154274 CTGTGAATCCATCTGATCCTGGG - Intronic
1045940410 8:107732095-107732117 CTGTGGTTACAGCTCAACCTGGG - Intergenic
1046014938 8:108593587-108593609 CTGTGAATCCATCTGATCCTGGG - Intergenic
1046683680 8:117200357-117200379 CTGTGAAGTGAGATGAACCTGGG + Intergenic
1047243127 8:123112062-123112084 CAGGAGATCCAGATGAGCCTGGG - Intronic
1047691242 8:127356896-127356918 GTGTGGATCAAGATTAAGCTTGG + Intergenic
1049538325 8:143193429-143193451 CTGTGGAGGCAGAAGGACCTGGG + Intergenic
1051161748 9:14216445-14216467 CTGTGGATACAGATGCACCTTGG - Intronic
1052263345 9:26543315-26543337 CTGTGAATCCATATGATTCTGGG - Intergenic
1052432284 9:28381994-28382016 CTTTGGATACAGATGGACCTAGG + Intronic
1052707173 9:32008145-32008167 CTGTGAATCCATATGAACCTGGG + Intergenic
1053354841 9:37436842-37436864 CTGTGGATCCAAATCAAGCCTGG - Exonic
1054719442 9:68589797-68589819 CTGTGAATCCAGCTGGTCCTGGG + Intergenic
1055658447 9:78475741-78475763 CTTTGGAGTCAGATGCACCTGGG - Intergenic
1055884461 9:81044177-81044199 CTGTGGATCCAGCTGCACTGTGG - Intergenic
1056703826 9:88934562-88934584 CTGTGGTTCCAGGTGTCCCTGGG - Intergenic
1059443867 9:114326176-114326198 CTGTGGAACCAGCTCAACCAGGG - Intronic
1059445073 9:114332953-114332975 CTGTGGAACCAGCTCAACCAGGG - Intronic
1059736113 9:117101504-117101526 CTGTGGTACCAGAAGAACCAAGG - Intronic
1060469377 9:123934786-123934808 CTCTGGAGCCAGATGGACCCAGG + Intergenic
1061414327 9:130438224-130438246 CTCTGGAGTCAGATGGACCTGGG - Intergenic
1062331229 9:136045826-136045848 CTGTGGATCCAGATGTGCCAAGG + Intronic
1062697991 9:137885148-137885170 GTGTGGAGGCAGAGGAACCTGGG - Intronic
1062747483 9:138223270-138223292 CTATGGACCCAGATGGTCCTGGG + Intergenic
1185724119 X:2405595-2405617 CAGTAGTTCAAGATGAACCTGGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187263135 X:17705652-17705674 CTGTGGATTCATAAGAACCTTGG - Intronic
1191099336 X:56708364-56708386 CTGTGAATCCATATGGTCCTGGG + Intergenic
1192693531 X:73390832-73390854 CAGTGGATCATGGTGAACCTTGG - Intergenic
1192726515 X:73758975-73758997 CTGTGAATCCATCTGACCCTAGG + Intergenic
1193949651 X:87781934-87781956 CTGTGAATCCATCTGATCCTGGG - Intergenic
1193978847 X:88157208-88157230 GGGTGGATCCTGATGAAGCTGGG + Intergenic
1194587498 X:95753997-95754019 CTGTGAATCCATCTGATCCTGGG + Intergenic
1194608528 X:96011532-96011554 CTGTGAATCCATATGGTCCTGGG - Intergenic
1194911179 X:99646521-99646543 CTGTGAATCCATCTGACCCTGGG + Intergenic
1195613818 X:106897011-106897033 CTTTGGAAGCAGATGAACATGGG - Intronic
1195619118 X:106935548-106935570 CTCTGGAGTCAGATGAATCTGGG + Intronic
1195710022 X:107766311-107766333 CTGTGAATTCAGGTCAACCTGGG + Intronic
1196618508 X:117795251-117795273 CTTTGGAGTCAGATGGACCTAGG - Intergenic
1197848375 X:130829444-130829466 TTTTGGAACCAGACGAACCTTGG - Intronic
1198226561 X:134650899-134650921 CTTTGGCTCCAGAAGAGCCTGGG - Intronic
1200023147 X:153228780-153228802 CTGTACATGCAGTTGAACCTGGG - Intergenic
1201384989 Y:13430322-13430344 CTGTGAATCCATATGATCCTAGG + Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic