ID: 907791774

View in Genome Browser
Species Human (GRCh38)
Location 1:57673180-57673202
Sequence CTCACATGACAGAAGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1774
Summary {0: 2, 1: 45, 2: 150, 3: 430, 4: 1147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907791768_907791774 14 Left 907791768 1:57673143-57673165 CCTGGTTCATAGATGGCCATCTT 0: 16
1: 71
2: 140
3: 283
4: 677
Right 907791774 1:57673180-57673202 CTCACATGACAGAAGGGGCATGG 0: 2
1: 45
2: 150
3: 430
4: 1147
907791767_907791774 20 Left 907791767 1:57673137-57673159 CCACTTCCTGGTTCATAGATGGC 0: 40
1: 117
2: 298
3: 598
4: 909
Right 907791774 1:57673180-57673202 CTCACATGACAGAAGGGGCATGG 0: 2
1: 45
2: 150
3: 430
4: 1147
907791769_907791774 -2 Left 907791769 1:57673159-57673181 CCATCTTCTTCTCGCTGTGTCCT 0: 1
1: 0
2: 5
3: 47
4: 504
Right 907791774 1:57673180-57673202 CTCACATGACAGAAGGGGCATGG 0: 2
1: 45
2: 150
3: 430
4: 1147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907791774 Original CRISPR CTCACATGACAGAAGGGGCA TGG Intronic
900010647 1:104012-104034 CACTCATGGCAGAAGGGGAAGGG - Intergenic
900026751 1:280578-280600 CACTCATGACAGAAGGGGAAGGG - Intergenic
900036546 1:414481-414503 CACTCATGGCAGAAGGGGAAGGG - Intergenic
900058175 1:650235-650257 CACTCATGGCAGAAGGGGAAGGG - Intergenic
900840212 1:5042628-5042650 CCCACAGGAAAGAATGGGCAAGG - Intergenic
900874176 1:5329803-5329825 CTCACATGGTGGAAGGGGAAGGG + Intergenic
901125820 1:6928002-6928024 CTCTCAGGACAGGAGGGGCCAGG + Intronic
901218929 1:7571247-7571269 CTCACAGGGTGGAAGGGGCAAGG + Intronic
901418610 1:9135148-9135170 ATCACATGCCATATGGGGCAGGG - Intergenic
901453735 1:9351856-9351878 CTCAGATGGCAGAAGTGGCCGGG + Intronic
902111050 1:14078646-14078668 CTCACAGGATGGAAGGGGCAAGG + Intergenic
902976238 1:20090570-20090592 TTCACATGGCAGAAGGGCCCGGG - Exonic
903558877 1:24212840-24212862 CCCACCTGATGGAAGGGGCAAGG - Intergenic
903673229 1:25048526-25048548 CTCACCTGCTAGGAGGGGCAGGG - Intergenic
903733137 1:25512764-25512786 TTCACATGGTGGAAGGGGCAAGG - Intergenic
903820855 1:26101452-26101474 CTCACAAGGCAGAAGTGGAAGGG - Intergenic
904228815 1:29049096-29049118 CACACATAACAGAAGAGGAAGGG - Intronic
904923649 1:34028842-34028864 CTGAGATGACAGAAGGTGCTTGG - Intronic
905237436 1:36559890-36559912 CTCCCATCACAGAAGAGGCTGGG - Intergenic
905861455 1:41354760-41354782 CTCACATGACAGAAGGGGCAGGG + Intergenic
905950417 1:41946198-41946220 TTCCCTTGACATAAGGGGCATGG - Intronic
906068707 1:43001804-43001826 CTTACATGGTAGAAGGGGCAAGG + Intergenic
906194855 1:43923580-43923602 CTCATATGATGGAAGAGGCAAGG + Intronic
906259336 1:44374669-44374691 CTCAGATGGTAGAAGAGGCAAGG - Intergenic
906273713 1:44500937-44500959 CTGACAGGACAGAAGAGCCAAGG - Intronic
906357016 1:45115525-45115547 CTCACATCCCAGACGGGGCGCGG + Intronic
906436172 1:45798532-45798554 TTCACATGACAGCAGTGGTAGGG - Intronic
906441036 1:45844934-45844956 CTCACGTGGCAGAAGGTGGAAGG + Intronic
906507222 1:46389101-46389123 TTCCCTTGACATAAGGGGCATGG + Intergenic
906583458 1:46955559-46955581 TTCCCTTGACATAAGGGGCATGG - Intergenic
907037412 1:51228816-51228838 TTCCCTTGACATAAGGGGCATGG - Intergenic
907100236 1:51825997-51826019 CTCATACAGCAGAAGGGGCAAGG - Intronic
907269602 1:53283198-53283220 CTCACGTGGTGGAAGGGGCAAGG - Intronic
907505568 1:54915552-54915574 TTCCCTTGACATAAGGGGCATGG + Intergenic
907602500 1:55785078-55785100 TTCCCTTGACATAAGGGGCATGG + Intergenic
907715022 1:56918543-56918565 CTTACATGGCAGAAGGGGCTAGG + Intergenic
907791774 1:57673180-57673202 CTCACATGACAGAAGGGGCATGG + Intronic
907877259 1:58503653-58503675 CTCACATGGTAGAAGGGGCAAGG - Intronic
907928346 1:58975577-58975599 CTCACATGATGGAAGGGATAAGG + Intergenic
908089594 1:60671812-60671834 TTCACATGGTGGAAGGGGCAAGG - Intergenic
908112466 1:60910847-60910869 CTTACATGGCAGAAGGCGAAGGG - Intronic
908158936 1:61386954-61386976 CTCACATGGCAGAAGGGGTGGGG + Intronic
908181724 1:61612406-61612428 CTCACATGGCAGAAGAGGCGAGG - Intergenic
908345314 1:63226485-63226507 ATCACATGGCAGAAGGGGTGAGG - Intergenic
908429323 1:64040683-64040705 CTCACATGGTAGGAGAGGCAGGG + Intronic
908499472 1:64728903-64728925 CTCACATGGCAGAAGGTGGAAGG - Intergenic
908554636 1:65245559-65245581 CTCACATGGTGGAAGGGGAAAGG + Intergenic
908612724 1:65880590-65880612 CTCATATAGCAGAAGGGGCGAGG - Intronic
908727149 1:67188756-67188778 CTCACATAGTAGAAGGGGCCAGG + Intronic
908809604 1:67966546-67966568 CTCACAGGGTGGAAGGGGCAAGG - Intergenic
908905857 1:69007939-69007961 CTCACATGGTGGAAGGGGAAAGG + Intergenic
909020442 1:70425449-70425471 CTCACATGGTAGAAGAGACAAGG + Intronic
909052416 1:70782630-70782652 CTCACATGGTGGAAGGGACAAGG - Intergenic
909107694 1:71433115-71433137 CTCACATGGCAGAAGGCAGAAGG - Intronic
909198324 1:72655769-72655791 CTCACATGGTGGAAGGGGCAAGG - Intergenic
909239392 1:73192847-73192869 CTCACATGGAAGAAGGGTTAAGG + Intergenic
909251116 1:73357658-73357680 CTCATATGGCAGAAGGGGTGAGG + Intergenic
909301703 1:74020885-74020907 TTCACATGGCAGAAGGGGTGAGG + Intergenic
909364896 1:74808124-74808146 CACTCATGGCAGAAGGGGAAAGG + Intergenic
909454680 1:75837167-75837189 TTCACATGGTAGAAGGGGCAAGG - Intronic
909658312 1:78055175-78055197 CTCATGTAACAGAAGGGGAAAGG + Intronic
909707474 1:78604666-78604688 CTCACATGGTGGAAGGGGCCAGG - Intergenic
909878834 1:80847472-80847494 CTCACATGGCAGAAGGCAGAAGG + Intergenic
910143388 1:84051868-84051890 CTCACATGATGAAAGGGGGAAGG + Intergenic
910191084 1:84596520-84596542 CTCACATGGCAGAAGGCTGAAGG + Intergenic
910483042 1:87679321-87679343 CTCATGTGGTAGAAGGGGCAAGG - Intergenic
910544645 1:88400117-88400139 CTCACATGGTAGAAGGGGCAAGG + Intergenic
910591062 1:88928552-88928574 TTCCCTTGACATAAGGGGCATGG - Intergenic
911111651 1:94194593-94194615 CTCACATGATAGAAGGGGAAGGG + Intronic
911156135 1:94638604-94638626 CTCACATGATGGAAGGGGTAAGG - Intergenic
911216860 1:95204074-95204096 CTCACAGGGCAGAGGGGTCAGGG - Intronic
911386143 1:97177945-97177967 TTCACATGGTGGAAGGGGCAAGG + Intronic
911408233 1:97468439-97468461 CTCACATGATGGAAAGGACAAGG - Intronic
911547183 1:99232316-99232338 CTCACATGACGGGAAGGGCAAGG + Intergenic
911999735 1:104817629-104817651 CTCACATGGTGGAAGAGGCAAGG - Intergenic
912164895 1:107031275-107031297 CTCGCATGGCAGAAGGGGCAAGG - Intergenic
912186511 1:107282947-107282969 CTCACTTGACAGAGGGGGTGAGG + Intronic
912269712 1:108196728-108196750 CTCACATGGTGGAAGGGGCAAGG + Intronic
912367328 1:109145179-109145201 CTCACATGGCAGAAGGTAGAAGG - Intronic
912397612 1:109359208-109359230 CGTACATGACAGAAGGGGCAAGG + Intronic
912667611 1:111596743-111596765 CTCACATGGTAGAAGGGGTGAGG + Intronic
912908722 1:113734826-113734848 CTCACATGGTGGAAGGGGCAAGG - Intronic
913050288 1:115111657-115111679 CTCACATGGTAGAAGGGGAAGGG - Intergenic
913066002 1:115255577-115255599 CTCACATGGCAGAAGGGGTGAGG - Intergenic
913090229 1:115471751-115471773 CCCACATGACTGAAGAGGCCAGG - Intergenic
913144083 1:115972275-115972297 CTCACATGGCAGAAGGTGGAAGG + Intergenic
913229059 1:116725944-116725966 GTCACACCACAGAAGCGGCATGG - Intergenic
913346322 1:117814443-117814465 CTCACATGGTGGAAGGGGCAAGG - Intergenic
913470435 1:119180648-119180670 GTCCCTTGACATAAGGGGCACGG + Intergenic
913649201 1:120894434-120894456 CTCACATGGTGGAAGGGGCTAGG - Intergenic
914077496 1:144369073-144369095 CTCACATGGAGGAAGGGGCAAGG + Intergenic
914101683 1:144597432-144597454 CTCACATGGAGGAAGGGGCAAGG - Intergenic
914172403 1:145237613-145237635 CTCACATGGTGGAAGGGGCAAGG + Intergenic
914297281 1:146340079-146340101 CTCACATGGTGGAAGGGGCTAGG + Intergenic
914395309 1:147261334-147261356 CTCACATGACAGAAGGTGGACGG + Intronic
914527048 1:148478616-148478638 CTCACATGGTGGAAGGGGCTAGG + Intergenic
914639350 1:149588519-149588541 CTCACATGGTGGAAGGGGCTAGG - Intergenic
915841915 1:159220201-159220223 CTCATGTGGCAGAAGGGACAAGG + Intergenic
915863384 1:159471771-159471793 CTCAGTTGGCAGAAGGGGCAAGG - Intergenic
916086136 1:161270909-161270931 CTCACATGGTAGAAGGGGAGAGG - Intronic
916165222 1:161960838-161960860 TTCACATTACAGAATGGGAAGGG - Exonic
916167822 1:161979052-161979074 CTCACATGGCCAAAGGGGCAAGG + Intergenic
916264487 1:162876968-162876990 CTCACATGACAGAAGGGAGGAGG - Intergenic
916816978 1:168363676-168363698 CTCACATGGCAGAAGGTGGGAGG - Intergenic
916882595 1:169034361-169034383 CTCACATGGGAGAAGGGGAAAGG + Intergenic
917005032 1:170405620-170405642 CTCACATGACAGAAGGGGTAAGG - Intergenic
917050620 1:170918236-170918258 CTCACATGGCAGAAGGTAGAAGG - Intergenic
917246990 1:173014162-173014184 CTCACATGGCAGAAGGCAGAAGG - Intergenic
917442684 1:175080935-175080957 CTCTCCTGCCTGAAGGGGCAAGG + Intronic
918025494 1:180740893-180740915 CTCACATGGTAAAAGGGGCATGG + Intronic
918119647 1:181527262-181527284 CTCACATGGTAGAAGGGGTGAGG + Intronic
918256355 1:182752194-182752216 CTGACATGACAGCAGAGGCTGGG + Intergenic
918740619 1:188126706-188126728 CTCACATGGCAGAAGGTAGAGGG + Intergenic
918931998 1:190865702-190865724 GTTACATGGCAGAAGGGGAAAGG + Intergenic
918961138 1:191279689-191279711 CTCACATGGCAGAAGGTGGAAGG + Intergenic
919111811 1:193229464-193229486 CTCCTATCACAGAAGGAGCAAGG - Intronic
919410604 1:197237401-197237423 CTCACATGGTGAAAGGGGCAAGG + Intergenic
919418167 1:197337176-197337198 CTCACATGGTAGAAGGGGTGAGG - Intronic
919588490 1:199469469-199469491 CTCACATGACAGAGGGCAAATGG + Intergenic
919980476 1:202639882-202639904 CTCAAATTACAGGAGGAGCAGGG - Intronic
920425184 1:205869293-205869315 TTCCCTTGACATAAGGGGCATGG + Intergenic
921022858 1:211252369-211252391 CTCACAAGGCAGAAGAGGCAAGG - Intergenic
921092675 1:211858342-211858364 TTCCCTTGACATAAGGGGCATGG - Intergenic
921249745 1:213285843-213285865 CTCACATGGTGGAAGGGGCTAGG - Intergenic
921686464 1:218094749-218094771 CTCACATGGTAGAAGGGGCAAGG - Intergenic
921701287 1:218271642-218271664 CTCACATAACACAAGGGGTGAGG - Intergenic
921718983 1:218449785-218449807 CTCACATGGTAGCAGGGCCAAGG + Intergenic
921821601 1:219623131-219623153 CTCACATGGTGGAAGGGACAAGG - Intergenic
922259087 1:223920019-223920041 CACTCATGGCAGAAGGGGAAGGG - Intergenic
922332598 1:224590564-224590586 ATCACATGGCAGAAGGTGGAAGG + Intronic
922514184 1:226194695-226194717 CTCACATGGTAGAAGGGACAAGG + Intergenic
922684660 1:227629763-227629785 TTCCCTTGACATAAGGGGCATGG + Intronic
922727537 1:227929840-227929862 CTCACATGGCAGAAGAGGCAAGG - Intronic
923114209 1:230919353-230919375 CTCACATGACGGAAGCTGGAAGG + Intronic
923127335 1:231043430-231043452 CTCACATTGCAGAAGGGGCCAGG + Intergenic
923315908 1:232779872-232779894 CTCACATGGTAGAAAGGGCAAGG + Intergenic
923394968 1:233552783-233552805 CTCACATGGTGGAAGGGGCGAGG - Intergenic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
923492016 1:234492488-234492510 CTCACACAACAGAAGGGGCAAGG + Intergenic
923497821 1:234540462-234540484 CACAGATGCAAGAAGGGGCAAGG - Intergenic
923517324 1:234708723-234708745 GTCACATGATAGAAGGGGTGAGG - Intergenic
923676857 1:236087876-236087898 CTCACATGGCAGAAGGTGGAAGG + Intergenic
923899721 1:238312401-238312423 CTCACATGGTGGAAGGGGCAAGG + Intergenic
924072655 1:240297919-240297941 CTCACATGGTAGAAGGGACAAGG + Intronic
924183582 1:241463984-241464006 CTCACATGTCTTAAGGAGCAAGG - Intergenic
924187591 1:241511220-241511242 CTCACATGGTAGAAGGGACAAGG - Intronic
924192382 1:241567372-241567394 TTCACATGCTGGAAGGGGCATGG + Intronic
924272681 1:242350079-242350101 CCCACATGATAGAAGGGGCAAGG - Intronic
924340277 1:243022769-243022791 CACTCATGGCAGAAGGGGAAGGG - Intergenic
924494870 1:244577602-244577624 CTCACATGGCAGAAGGGGCAAGG + Intronic
924798938 1:247313084-247313106 CTCACATGGTGGAAGGGGCAAGG + Intronic
1063089058 10:2845419-2845441 CTCACATGGCGGAAGGGGTGAGG + Intergenic
1063276834 10:4578447-4578469 CTCACATGGCAGAAGGGGTGAGG + Intergenic
1063388684 10:5634226-5634248 CTCATCTGCCTGAAGGGGCAAGG + Intergenic
1064279288 10:13936556-13936578 CTCACATGGCAGAAGGGGTGAGG - Intronic
1064573977 10:16725617-16725639 CTCCCATGACAGAAGGCAGAAGG - Intronic
1064847140 10:19667979-19668001 TTCACATGATGGAAGGTGCAAGG + Intronic
1064874520 10:19977726-19977748 CTCACATGGCAGAGGGGGTGGGG + Intronic
1064934083 10:20660687-20660709 CTCACATGGTGGAAGGGGCTGGG - Intergenic
1064990383 10:21251726-21251748 CTCATATGGCAAAAGGGGTAAGG - Intergenic
1065074837 10:22066919-22066941 CTCACATGCCAGAAGCTGGAAGG + Intergenic
1065199583 10:23300195-23300217 TTCCCTTGACATAAGGGGCATGG + Intronic
1065327462 10:24561474-24561496 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1065460344 10:25956077-25956099 CTCACATGGCAGAAGGCAGAAGG + Intronic
1065650189 10:27880658-27880680 CTCACATGGCAGAATGGGGAAGG - Intronic
1065690123 10:28324212-28324234 CTCACGTGGCAGAGGGGCCAGGG - Intronic
1065731397 10:28712813-28712835 CTCACAGGGCAGAAGAGGAAAGG - Intergenic
1065792291 10:29271928-29271950 CTCACATAATGAAAGGGGCAAGG - Intergenic
1065871376 10:29959132-29959154 TTCACATGGCAGAAGGGGCCAGG - Intergenic
1065972432 10:30816194-30816216 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1066054576 10:31668500-31668522 CTCACATGGAAGAAGGGACAGGG + Intergenic
1066136296 10:32449853-32449875 CTCACATGATGGAAGGAGCAAGG - Intronic
1066444342 10:35468193-35468215 CTCACATGGCAAAAGGGGCAAGG + Intronic
1066458275 10:35590741-35590763 CTCACATGGCAGAAGAGGCAGGG + Intergenic
1066630026 10:37450145-37450167 CTCACATGGCAGAAGGCTGAAGG + Intergenic
1066645990 10:37609676-37609698 CTCACATGGTGGAAGAGGCAAGG - Intergenic
1066650449 10:37650331-37650353 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1066680105 10:37929944-37929966 CTCACATGATAGAAGGGGCAAGG + Intergenic
1066694044 10:38062121-38062143 CTCACATGTCAGAAAGGGGAGGG - Intronic
1066712030 10:38246548-38246570 CCCACATGATAGAAGGGGCAAGG + Intergenic
1066736222 10:38482837-38482859 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1066998775 10:42587030-42587052 CTCACATGTCAGAAAGGAGAGGG + Intronic
1067050203 10:43011582-43011604 CTCACATGGTGGAAGGGACAGGG - Intergenic
1067546584 10:47196495-47196517 CTCCCAGGACAGCAGAGGCAGGG - Intergenic
1067977529 10:51042882-51042904 TTCACGTGGCAGAAGGGACAAGG - Intronic
1068293367 10:55033958-55033980 CTCACATGATAGAAGGTGAAGGG - Intronic
1068524778 10:58116087-58116109 CTCACATGGTAAAAGGGGCAAGG + Intergenic
1068564566 10:58558839-58558861 CTCACATAATGGAAAGGGCAAGG + Intronic
1068697197 10:59980200-59980222 CTCACATAACAGAAGATGGAAGG - Intergenic
1068766645 10:60771806-60771828 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1068791791 10:61037470-61037492 TTCCCTTGACATAAGGGGCATGG + Intergenic
1068804082 10:61174972-61174994 CTCAGATGACAGAAGGCAGAAGG + Intergenic
1068902673 10:62287494-62287516 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1069036990 10:63656025-63656047 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1069279369 10:66635479-66635501 CTCACATGGCAGAAAGAGAAGGG + Intronic
1069381338 10:67845702-67845724 CTGACGTGACAAAAAGGGCAAGG + Intergenic
1069580389 10:69562028-69562050 CACACATCTAAGAAGGGGCAAGG + Intergenic
1069596130 10:69672040-69672062 TTCACAAGGTAGAAGGGGCAGGG + Intergenic
1069783284 10:70970257-70970279 CACTCATGACAGAAGGCGAAGGG - Intergenic
1069887986 10:71635914-71635936 CCCACATGGCTGGAGGGGCAAGG + Intronic
1070311891 10:75279853-75279875 CTCACATGGCAGAAGGCACAAGG + Intergenic
1070338305 10:75474428-75474450 TTAGCATGGCAGAAGGGGCAAGG + Intronic
1070367404 10:75750465-75750487 CTCACATCCCAGACGGGGCGGGG + Intronic
1070367474 10:75750703-75750725 CTCACATCCCAGACGGGGCGGGG + Intronic
1070450470 10:76552681-76552703 GTCACATGACTGTTGGGGCAGGG + Intronic
1070487108 10:76941907-76941929 CTCACATGACAGAAGGGACGAGG + Intronic
1070532472 10:77349243-77349265 CTCACATGGTGGAAGGGGCAAGG - Intronic
1070557734 10:77542095-77542117 CTCACATGATGGAAGGGACCAGG - Intronic
1071177238 10:82940723-82940745 CTCACATGGTAGAAGGGGCAGGG + Intronic
1071185407 10:83038138-83038160 CTCAAATGAGAAAAGGGGAAAGG - Intergenic
1071326991 10:84527457-84527479 TTCCCTTGACATAAGGGGCATGG + Intergenic
1071471984 10:85989948-85989970 TTCACAGGGCTGAAGGGGCAAGG - Intronic
1071707115 10:88011288-88011310 CTCACAGAGCAGAAAGGGCAAGG + Intergenic
1072313611 10:94180809-94180831 CTCACATGGCAGAAGGTGAAAGG - Intronic
1072362414 10:94672890-94672912 CACACATAACAAAAGGGACAAGG - Intergenic
1072378074 10:94837884-94837906 TTCCCTTGACATAAGGGGCATGG + Intronic
1072471895 10:95720734-95720756 TTCCCTTGACATAAGGGGCATGG + Intronic
1072494666 10:95945026-95945048 CTCACATGGCAGATGGTGGAAGG - Intergenic
1072597890 10:96892525-96892547 CTCACATGACAAAAGGATGAGGG + Intronic
1072619554 10:97070653-97070675 CTCACACGGAGGAAGGGGCAAGG - Intronic
1072642370 10:97221605-97221627 CTCACATGGTGGAAGGGACAAGG - Intronic
1073040476 10:100600994-100601016 CTCACATGGCAGAAGGGACAGGG + Intergenic
1073470649 10:103720186-103720208 CTCACATGATGGAAGGGGCAAGG + Intronic
1073703726 10:105958954-105958976 CTCACATGTTGGAAGGAGCAAGG - Intergenic
1073940419 10:108691619-108691641 CTCACATAGCAGAAGGTGGAAGG + Intergenic
1074079707 10:110157797-110157819 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1074244982 10:111680710-111680732 CTCACATGGCAGAAGGGACGGGG - Intergenic
1074252264 10:111762839-111762861 CTCACATGACAGAAGACAGAAGG - Intergenic
1074270592 10:111949888-111949910 CTCACATGGTACAAGGGGTACGG - Intergenic
1074489561 10:113927027-113927049 CTCACATGGCAGAAGGGGCTAGG - Intergenic
1074836470 10:117300782-117300804 CTCACATGGCAGAAGGGATAAGG - Intronic
1075003534 10:118814846-118814868 CTCACATGGCAGAAGGGGTGAGG + Intergenic
1075098260 10:119487917-119487939 CTCACATGGTAGAAGGGGTGAGG - Intergenic
1075222337 10:120596074-120596096 CTCACATGGTGGCAGGGGCAAGG + Intergenic
1075237490 10:120744169-120744191 CTAACAGGACAGGTGGGGCAAGG - Intergenic
1075350960 10:121724988-121725010 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1075395931 10:122127021-122127043 TTCACGTGGCAGAAGAGGCAAGG - Intronic
1075989040 10:126817292-126817314 CTCACATGGTAGAAGGTGGAAGG - Intergenic
1076814424 10:132907827-132907849 CTCACATGCGGGAAGGGGCAGGG - Intronic
1077336508 11:2007280-2007302 CCCAGAAGCCAGAAGGGGCAAGG - Intergenic
1077396859 11:2328529-2328551 CTCACATGGCAGAAAGGGAAAGG + Intergenic
1077956618 11:7027407-7027429 CTCACATGGCAGAAGGAACCAGG + Intronic
1078087120 11:8240632-8240654 CTCACGTGGCAGAAGGGGCAAGG + Intronic
1078145874 11:8721563-8721585 CACACAGGACAGAAAGGGCCAGG + Intronic
1078424115 11:11235440-11235462 TTCACATGACAGAAGGGGAAGGG - Intergenic
1078463356 11:11531871-11531893 CTCACCTATCAGAAGGGGCCTGG - Intronic
1079254928 11:18819546-18819568 TTCACTTGACATAAGGGGCATGG + Intergenic
1079332043 11:19541632-19541654 CCCACTTGAGAGAAGGGACAGGG + Intronic
1079601287 11:22315450-22315472 TTCCCTTGACATAAGGGGCATGG + Intergenic
1079651385 11:22934317-22934339 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1079738497 11:24028228-24028250 TTCACATGGTAGAAGGGACAAGG + Intergenic
1079969163 11:27015459-27015481 CTCATGTGGCAGAAGGGACAGGG + Intergenic
1080095763 11:28404472-28404494 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1080195483 11:29603624-29603646 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1080289018 11:30649918-30649940 CTCACATGATGGAAGGGGTGAGG - Intergenic
1080294093 11:30705281-30705303 CTCACATGGTGGAAGGGACAAGG + Intergenic
1080368468 11:31607460-31607482 CTCACATGGCAGAATGTGAAAGG + Intronic
1080392119 11:31857991-31858013 CTCACATGGTAGAAGAGGCATGG - Intronic
1080397288 11:31901949-31901971 CTCACATGGCAGAAGGGGCAAGG + Intronic
1080422689 11:32125757-32125779 CTCAGAGGGCAAAAGGGGCAAGG - Intergenic
1080597087 11:33782679-33782701 CTCACGTGGTAGAAGAGGCAAGG - Intergenic
1080695031 11:34596054-34596076 CTCACATGGCAGAAGGGACAAGG - Intergenic
1080739029 11:35046815-35046837 CTCACAGGATGGAAGGGGCAAGG + Intergenic
1080762843 11:35269140-35269162 CTCACATGGTAGAAGGGCCAAGG - Intronic
1080942376 11:36933973-36933995 CTCACATGGTTGAAGGGGCAAGG + Intergenic
1081059485 11:38455644-38455666 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1081285270 11:41261173-41261195 CTCACCTGGCAGAAGGGTAAGGG - Intronic
1081660979 11:44888224-44888246 CTCAGATGCCAGAAGGCACATGG - Intronic
1082217825 11:49596162-49596184 CTCACATGGCAGAAGATCCAAGG + Intergenic
1082874775 11:57977318-57977340 CTCACATGGTGGAAGGGACAAGG - Intergenic
1082990227 11:59201150-59201172 CCCACATGGTAGAAGGGGCAAGG + Intronic
1082998171 11:59268984-59269006 CTCACATGGCAGAAGAGGCAAGG + Intergenic
1083140884 11:60720554-60720576 CTCACATGGCAGAGGGGCCAAGG + Intergenic
1083915833 11:65743254-65743276 CTCGCATGGTGGAAGGGGCAAGG + Intergenic
1084081102 11:66825521-66825543 CTCACATGGCAGAAGGGGCAAGG - Intronic
1084355117 11:68633354-68633376 TTCACGGGGCAGAAGGGGCAGGG + Intergenic
1084627702 11:70321172-70321194 CTCACATGATGGAAGGGACCAGG - Intronic
1084721012 11:70905643-70905665 CTCACATGGCGGAAGGGGTGAGG - Intronic
1085068369 11:73518951-73518973 CACTCATGGCAGAAGGGGAAGGG - Intronic
1085080953 11:73633757-73633779 AGCACATGACAGACTGGGCAAGG + Intergenic
1085235903 11:75015223-75015245 CTCACATGACTGAAGGGCAAAGG - Intronic
1085846454 11:80071388-80071410 TTCACATGGCAGAAGGGGCAAGG - Intergenic
1085906502 11:80770513-80770535 CTCACATGGTGGAAAGGGCAAGG - Intergenic
1086125886 11:83348054-83348076 GTCAGATGGCAGAAGGGTCAAGG - Intergenic
1086192359 11:84094628-84094650 CTCACATAAAGGAAGGGGCAAGG + Intronic
1086214013 11:84355452-84355474 TTCACTTGGCAGAAGGGGAAAGG - Intronic
1086631745 11:89027987-89028009 CTCACATGGCAGAAGATCCAAGG - Intronic
1086673579 11:89576259-89576281 CTCACATGACATCAGGGACTTGG - Intergenic
1086737795 11:90328588-90328610 CTCACTTGACAGAAGAGTGAGGG - Intergenic
1087214716 11:95482466-95482488 CTCACATCCCAGACGGGGCGGGG - Intergenic
1087238200 11:95744689-95744711 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1087369466 11:97264093-97264115 CTCACATGGCAAAAGGTGGAAGG + Intergenic
1087401765 11:97675866-97675888 CTAACATGGCAGAAGGTGGAAGG + Intergenic
1087512458 11:99115002-99115024 CTCACATGGAAGAAGGGGGAAGG - Intronic
1087673662 11:101134248-101134270 CTCACATGGTAGAAGGGGCAGGG - Intergenic
1087678447 11:101189936-101189958 CTCACATGGTGGAAGAGGCAAGG - Intergenic
1087687717 11:101284245-101284267 CTCACATGGCAGAAAGGACAAGG - Intergenic
1087827196 11:102778992-102779014 CTCACACGATAGAAAGGGCCAGG - Intronic
1087920506 11:103861555-103861577 TTCACACATCAGAAGGGGCAAGG + Intergenic
1087947808 11:104185446-104185468 CTCACATAGTGGAAGGGGCAAGG - Intergenic
1088338552 11:108736703-108736725 CTCACATGGCAGAAGGCAGAGGG - Intronic
1088416450 11:109594600-109594622 CTCACATGACAGAAGGCAGAAGG + Intergenic
1088483270 11:110316486-110316508 CTCACATGACAGAAGATGGAAGG + Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1088840677 11:113625006-113625028 CTCACTTGGTGGAAGGGGCAAGG + Intergenic
1089188114 11:116634835-116634857 TTCACATGGTGGAAGGGGCAAGG + Intergenic
1089238748 11:117055847-117055869 CTCACATGGCAGAAGGCAGAAGG - Intronic
1089420536 11:118330094-118330116 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1089639541 11:119838715-119838737 CTCACATGCTGGAAGGGCCAAGG + Intergenic
1089755312 11:120681843-120681865 CCCCCTTGACAGCAGGGGCAGGG + Intronic
1089827027 11:121287324-121287346 CTCACATGGCAGCAGGGCAAGGG + Intergenic
1090374476 11:126279287-126279309 CTCACATGGCAGAAGGGGTAAGG + Intergenic
1090670180 11:128940507-128940529 CTCACATGGCTGAAGGTGGAAGG - Intronic
1090729323 11:129556015-129556037 CTCCCATGGCAGAAGGTGAAAGG - Intergenic
1091017243 11:132063142-132063164 CTCATGTGGTAGAAGGGGCAAGG + Intronic
1091195740 11:133729355-133729377 CTCACATGGCAGAAGGGACAAGG + Intergenic
1091276902 11:134358843-134358865 TTCCCATCACAGCAGGGGCAGGG - Intronic
1202819492 11_KI270721v1_random:62462-62484 CCCAGAAGCCAGAAGGGGCAAGG - Intergenic
1091521590 12:1249859-1249881 CTCACATGGTGGAAGGGGCAAGG + Intronic
1091628192 12:2138691-2138713 CACTCATGGCAGAAGGGGAAGGG - Intronic
1092294098 12:7184573-7184595 TTCCCTTGACATAAGGGGCATGG - Intergenic
1092696351 12:11175866-11175888 CTTACATGGCAAAAGGGGTAAGG - Intergenic
1093214125 12:16343259-16343281 CTCACATGACGGAGGGGGCAGGG - Intergenic
1093269491 12:17041769-17041791 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1093426495 12:19034247-19034269 CTTACATGGCAGCAGGGGGAAGG + Intergenic
1093480562 12:19600177-19600199 CTCAGGTGGCAGAAGGAGCAAGG - Intronic
1093480844 12:19602383-19602405 CTCATATGGCAGAGGGGGCATGG - Intronic
1093610858 12:21154344-21154366 CTCACATGTTAGAAGAGGCAAGG - Intronic
1094126951 12:27033307-27033329 CTCACATGGTAGAAGAAGCAAGG + Intronic
1095039465 12:37425390-37425412 CTCACATGGCAGAAGGTGAAAGG + Intergenic
1095139002 12:38639872-38639894 TTCCCTTGACATAAGGGGCATGG - Intergenic
1095283954 12:40387648-40387670 TTCCCTTGACATAAGGGGCATGG - Intergenic
1095354651 12:41257313-41257335 CTCACATGGTGGAAGAGGCAAGG + Intronic
1095431499 12:42139496-42139518 CTCACATGGTAGAAGAGGCGAGG - Intronic
1095568654 12:43656654-43656676 CTCACGTGGCAGGAGGGGCCAGG + Intergenic
1095695972 12:45144428-45144450 TTCACATGGTGGAAGGGGCAAGG + Intergenic
1095933794 12:47655229-47655251 CTCCCATGGGAGAAGGGACAAGG + Intergenic
1096350192 12:50891778-50891800 CTCACATGGCAAAAGGGGCCAGG + Intergenic
1096352047 12:50908551-50908573 TTCCCTTGACATAAGGGGCATGG + Intergenic
1096498029 12:52050029-52050051 CTTACATGGGAGAAGGGGAATGG + Intronic
1096605944 12:52766607-52766629 CTCATAAGACAGAAGCAGCAGGG - Intergenic
1096718094 12:53503009-53503031 CTGACCTGAGAGAGGGGGCATGG - Exonic
1096753757 12:53781594-53781616 CTGACATCACAGATGGTGCAGGG + Intergenic
1096768822 12:53918816-53918838 ATCACATGGCAGAAGGTGGAAGG + Intergenic
1097130130 12:56805400-56805422 CTAACAAATCAGAAGGGGCAGGG + Intergenic
1097325556 12:58272425-58272447 CTCACATGGCAGTAGGTGGAAGG + Intergenic
1097404592 12:59174943-59174965 CTCACATGACAGAAGAGGTGAGG + Intergenic
1097574136 12:61370154-61370176 CTCACATGGCAGAAGGTGGATGG - Intergenic
1097689732 12:62723575-62723597 TTCACATGGCAGAAGGTGGAAGG - Intronic
1097738924 12:63215506-63215528 CTCACATGATAGAGGAGGCAAGG - Intergenic
1098081232 12:66787626-66787648 CTTACATGACAGAAGGAACAAGG - Intronic
1098235521 12:68414540-68414562 CTCACATGGTGGAAGGGGAAAGG - Intergenic
1099303001 12:80921148-80921170 CTCACGTGGTAGAAGGGGCAAGG - Intronic
1099339466 12:81410065-81410087 CTCACATGGCAGAAGGTGGCTGG - Intronic
1099438489 12:82671104-82671126 CCCACATGATGGAAGGGGCAAGG - Intergenic
1099482310 12:83183253-83183275 CTCACATGGTAGAAAGGGCAAGG + Intergenic
1099504386 12:83454774-83454796 CCCATGTGGCAGAAGGGGCAAGG - Intergenic
1099568254 12:84279815-84279837 CACTCATGACAGAAGGTGAAGGG + Intergenic
1099605291 12:84795864-84795886 TTCCCTTGACATAAGGGGCATGG - Intergenic
1099621663 12:85009121-85009143 CTCCCATGGCAGAAGGTGAAAGG + Intergenic
1099919026 12:88934109-88934131 CTCAAAAGACAGAACGGGCCTGG + Intergenic
1100188805 12:92168023-92168045 CTCACATAATGGAAGGGGCAAGG + Intergenic
1100206054 12:92350950-92350972 TTCACATGGCAGGAGGGACAAGG - Intergenic
1100223739 12:92535257-92535279 CTCACATGGTGGAAGAGGCAAGG + Intergenic
1100270153 12:93016867-93016889 CTCACATGCTAGAAGAAGCAGGG - Intergenic
1100288081 12:93186816-93186838 CTCACATGGTGGAAGGGACAAGG - Intergenic
1100406563 12:94277196-94277218 CTCACATGGTGGAAAGGGCAGGG + Intronic
1100468554 12:94871164-94871186 CTCACATCATGGAAGGGACAAGG + Intergenic
1100528332 12:95440980-95441002 CTCACATGGCAGAAAAGGCAAGG - Intergenic
1100752192 12:97710590-97710612 CTCACATGGCAGAAGGTGAAAGG + Intergenic
1100806303 12:98287498-98287520 CCCACATGGCAGAAGGGGCAAGG - Intergenic
1101042752 12:100773177-100773199 CTCACATGGTAGATGGGACAAGG + Intronic
1101469265 12:104981375-104981397 CTCACATGGTAGAAGGGACAAGG - Intergenic
1101540491 12:105660550-105660572 CTCACATGGCAGAAGAGCAAGGG + Intergenic
1101646009 12:106631580-106631602 CACACATGGCAGAAGGGGTGAGG - Intronic
1101762803 12:107672905-107672927 CTTACATGGCAGAAGGGGTGAGG - Intergenic
1102734160 12:115143181-115143203 CTCACACAGCAGAAGGGGCTGGG - Intergenic
1102734838 12:115150245-115150267 CTCAAACAGCAGAAGGGGCAAGG + Intergenic
1102879494 12:116473512-116473534 CTCACATGGAAGAAGGTGAAAGG - Intergenic
1103076404 12:117986309-117986331 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1103272244 12:119683089-119683111 CTCACATGGCAGAAGGTGCCAGG - Intergenic
1104979237 12:132566209-132566231 CTCACATGGTGGAAGGGGCTAGG + Intronic
1105600787 13:21885189-21885211 CTCACCTGAAAGATGGGGCATGG + Intergenic
1105697931 13:22908919-22908941 CTCACATGGAAGAAGGTGGAAGG + Intergenic
1106096106 13:26645243-26645265 ATCACTAGGCAGAAGGGGCAAGG - Intronic
1106160903 13:27200527-27200549 CCTACATGACAGGTGGGGCAAGG - Intergenic
1106262528 13:28079873-28079895 CACTCATGACAGAAGGGGAAAGG + Intronic
1106401825 13:29438513-29438535 CTCACACGGAGGAAGGGGCAAGG + Intronic
1106409148 13:29498995-29499017 CTCACAAGGCAGAAGGGGCCAGG + Intronic
1106610001 13:31269783-31269805 CTCACATGGCAGAAAGGGCAAGG - Intronic
1106697404 13:32191729-32191751 CTCACTTGACATAAGAGACAAGG + Intronic
1106820382 13:33457714-33457736 CCAACAAGGCAGAAGGGGCAGGG + Intergenic
1107360564 13:39613261-39613283 CTCACATGGCAGAAGGAGCGAGG + Intergenic
1107371360 13:39753248-39753270 GTCACATGGTAGAAGGGACAGGG - Intronic
1107414044 13:40184628-40184650 CTCACATGGCAGAAGGGATGAGG + Intergenic
1107423324 13:40269722-40269744 ATGACATGACTGAAGGTGCAGGG + Intergenic
1107557666 13:41531898-41531920 CTCACATGGCAGAAGAGAAAAGG + Intergenic
1108033792 13:46265525-46265547 CTCACATGACAGAAGGGGTGAGG + Intronic
1108091832 13:46857428-46857450 CTCACAGGATGGAAGGGCCAAGG + Intronic
1108111555 13:47079381-47079403 CTCACATAATGGAAGGGGAAAGG - Intergenic
1108281457 13:48866287-48866309 CTCACATGGTTGAGGGGGCAAGG - Intergenic
1108825281 13:54406268-54406290 CTCACATGGTAGAAGCAGCAAGG + Intergenic
1108910315 13:55541984-55542006 CTCACATGACAGAAGGTGCCAGG + Intergenic
1109119289 13:58433742-58433764 CTCACATGGCAGAAGGAGGAAGG + Intergenic
1109120523 13:58450146-58450168 CTCACTTGGCACAAGGGACAAGG - Intergenic
1109178311 13:59182543-59182565 CTCACTTGAAAAAAGGGGCAGGG + Intergenic
1109330008 13:60917917-60917939 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1109330231 13:60919919-60919941 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1109413503 13:62005652-62005674 CTCACATGGCAGAAGGCAAAAGG - Intergenic
1109433493 13:62267825-62267847 CTCTCATGGTAGAAGGGTCAAGG - Intergenic
1109532034 13:63662569-63662591 TTCACATGGCAGAAGGGGAAAGG + Intergenic
1109551217 13:63902884-63902906 CAAACATGACAGAAGGTGAAGGG + Intergenic
1109922617 13:69088652-69088674 CTCACATGGCAGAAAGGCAAAGG - Intergenic
1109988391 13:70019998-70020020 CTCACGTGACAGAAGGCAGAAGG - Intronic
1110130472 13:72002676-72002698 CACTCATGACAGAAGGCGAAGGG + Intergenic
1110161936 13:72388910-72388932 TTCACATGGTAGAAGAGGCAAGG - Intergenic
1110285054 13:73740236-73740258 TTCACATGGTAGAAGGAGCAAGG - Intronic
1110330950 13:74271728-74271750 CTCACATGACAAAAGTGTGAAGG + Intergenic
1110538658 13:76682374-76682396 CTTACATGAGAGGAGGGGCAGGG - Intergenic
1110662320 13:78071748-78071770 CTGACATGACAGAAAGGACATGG - Intergenic
1110707541 13:78612275-78612297 CTCACATGGCGGAAGAAGCAAGG + Intergenic
1110950650 13:81485818-81485840 TTCACATGATAGAAGGGTCAAGG - Intergenic
1111197842 13:84896986-84897008 CTCAGATCAGAGAAGTGGCAGGG - Intergenic
1111311496 13:86493130-86493152 CTCACATGATGGAAGAGGCAAGG - Intergenic
1111381167 13:87454703-87454725 CTCATATGGAAGAAGGGACAAGG - Intergenic
1111641484 13:90976279-90976301 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1111806215 13:93042877-93042899 TTCCCTTGACATAAGGGGCATGG - Intergenic
1112028920 13:95439294-95439316 CTCACATGGTGGAAGGGGCAAGG + Intronic
1112162095 13:96878483-96878505 TTCACATGATAGAAAGGGCCAGG - Intergenic
1112251466 13:97784464-97784486 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1112263728 13:97902930-97902952 CTCATATGGCAGAAGGTGCAGGG - Intergenic
1112283439 13:98082827-98082849 CTCATATGGTAGAAGGGACAAGG - Intergenic
1112473628 13:99711372-99711394 CTCATATGACAGAAGGGGTGAGG + Intronic
1112523747 13:100122881-100122903 CTCACATGGTGGAAGGAGCAAGG + Intronic
1112698878 13:101981315-101981337 CTTACATGGCGGAAGGGGCAAGG - Intronic
1112784899 13:102940815-102940837 CTCACAGGACAGCAGTTGCAGGG - Intergenic
1113035844 13:106047763-106047785 CTCACATGATGGAAGGGGCAAGG - Intergenic
1113209826 13:107963847-107963869 CACACAAGAAAGAAGAGGCAAGG + Intergenic
1113334665 13:109366455-109366477 CTCACATGACAAAAGGCTGAGGG - Intergenic
1113501542 13:110779362-110779384 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1113847546 13:113401312-113401334 CTCCCAGGACTGCAGGGGCAGGG + Intergenic
1114084300 14:19228198-19228220 CTCACATGACAGAAGGGATGAGG - Intergenic
1114384343 14:22240373-22240395 TTCCCTTGACATAAGGGGCATGG - Intergenic
1114584532 14:23798272-23798294 CTCACATGGAAGAAGGTGGAAGG - Intergenic
1114646059 14:24256805-24256827 CTCACAAGACAGGTGGTGCAGGG + Intronic
1114690066 14:24573325-24573347 CACATATGGCAAAAGGGGCAAGG - Intergenic
1114731291 14:24995191-24995213 CTCACATGGTAGAAGGAACAAGG + Intronic
1114831334 14:26145701-26145723 CTCACACGATGGAAGGGGTAAGG - Intergenic
1114899017 14:27032997-27033019 CTCACATGTTGGAAAGGGCAAGG - Intergenic
1115300199 14:31876888-31876910 CCCACATGGCAGAAGGCGAAGGG + Intergenic
1116145977 14:41069550-41069572 CTCACAGGACAGAAGGTAGAAGG - Intergenic
1116334024 14:43634261-43634283 CTCACATAGCAGAAGGTGAAAGG + Intergenic
1116425492 14:44785096-44785118 CTTGCATGGCAGAAGGGGCAAGG - Intergenic
1116429436 14:44828903-44828925 CTCACATGACAGAAAGGGCAAGG - Intergenic
1116556700 14:46320174-46320196 CTCACATGGCCAAAGAGGCAAGG - Intergenic
1116667935 14:47801451-47801473 CTCACGTGGCCGAAGGGACAAGG - Intergenic
1116700084 14:48230046-48230068 CTTACATGGTAGAAGAGGCAAGG - Intergenic
1116790142 14:49330775-49330797 CTCACATGATACAAGAGGCAAGG + Intergenic
1117287814 14:54304263-54304285 CTCATATGGCAGAAGGGGCAAGG - Intergenic
1117679204 14:58185832-58185854 CTCACATGGTGGAAGGGGCAAGG - Intronic
1117733078 14:58743474-58743496 CTCACATGGCAGAAGGCTCAAGG - Intergenic
1118049943 14:62015689-62015711 CTCACATGGTAGAGGAGGCAAGG - Intronic
1118050891 14:62026429-62026451 CTCACATGGCAGAAGGTGGAAGG + Intronic
1118087423 14:62433722-62433744 ATCAGAAGACAGAAGAGGCACGG - Intergenic
1118148052 14:63162097-63162119 CTCACATTGGGGAAGGGGCAAGG - Intergenic
1118226653 14:63906922-63906944 CTCACATGGTAGAACGGGTAAGG + Intronic
1118620289 14:67608789-67608811 CTCACATGGTACAAGGGGCAAGG + Intergenic
1118767562 14:68920355-68920377 GTCACAGGACTGAAGGGGCCTGG + Intronic
1118890875 14:69907868-69907890 CTTACATGGCAGAAGGGGTGAGG + Intronic
1119134519 14:72204648-72204670 TTCACATGATGAAAGGGGCAAGG + Intronic
1119167308 14:72505376-72505398 TTCACATGACAGAAGGGAAAGGG + Intronic
1119432036 14:74574848-74574870 CTCAAATGGGAGAAGGGGGAAGG + Intronic
1119609134 14:76047009-76047031 CTCACATGGCAGAAGGCAGAAGG + Intronic
1119768523 14:77205807-77205829 CTCAGATGTCAAAAGGAGCAGGG + Intronic
1119911472 14:78353439-78353461 CTCACATGGTGGAAGGGGCAAGG + Intronic
1119927707 14:78512080-78512102 TTCATATGACAGAAGTTGCAAGG - Intronic
1120035935 14:79698247-79698269 TTCAAATAACAGAAAGGGCAAGG + Intronic
1120357067 14:83448180-83448202 CTCACATGGCAGAAGAAGCCAGG + Intergenic
1120413158 14:84184067-84184089 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1120500352 14:85289408-85289430 TTCACATGGCAGAAAGGGCCAGG + Intergenic
1120566721 14:86068762-86068784 CTCACATGGCAGAAGGAGTGAGG + Intergenic
1120592078 14:86388301-86388323 TTCACATGACAGAAGGCGGAAGG + Intergenic
1120671195 14:87364743-87364765 CTCACATAGTAAAAGGGGCAAGG + Intergenic
1120713673 14:87818161-87818183 CTCACATGATGGATGGGGCAAGG - Intergenic
1121220649 14:92282620-92282642 ATCACATGGCAGAAGGTGGAAGG - Intergenic
1121303546 14:92890513-92890535 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1121424241 14:93837107-93837129 CTCACATGGCAGCAGGAGCAAGG + Intergenic
1121659412 14:95623949-95623971 CTCACATGGCAGAAAGGGCAAGG + Intergenic
1121941792 14:98077735-98077757 CTCACATGGCACAAGGGGCAAGG + Intergenic
1121960885 14:98258351-98258373 CTCACTTGGCAGAAGGTGGAGGG + Intergenic
1121968057 14:98328853-98328875 CTCACATGGTAGAAGGGCCCAGG + Intergenic
1122068754 14:99191656-99191678 CTGAAATGGCAGAGGGGGCAGGG + Intronic
1122738582 14:103857728-103857750 CACACATGCCAGAAGGGGTGAGG - Intergenic
1123122638 14:105925088-105925110 CTCACTTGGGAGAAGGGGAAAGG + Intronic
1202895914 14_GL000194v1_random:10060-10082 CTCACATGACAGAAGGGATGAGG - Intergenic
1123405284 15:20016514-20016536 CTCACTTGGGAGAAGGGGAAAGG + Intergenic
1123514614 15:21023162-21023184 CTCACTTGGGAGAAGGGGAAAGG + Intergenic
1123540054 15:21280943-21280965 CTCACATGGCATAAGGTGGAAGG - Intergenic
1123711052 15:22987941-22987963 TTCACATGGCAGAAAGGACAAGG - Intronic
1123971485 15:25511849-25511871 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1124047396 15:26162867-26162889 CTCACATGGCCGAAGGGGCAAGG + Intergenic
1124353744 15:28979315-28979337 CTCACATGACAGGAGTGGACCGG - Intronic
1124385625 15:29206227-29206249 CTCACCTGGCAGAAGAGACAAGG + Intronic
1124395949 15:29301826-29301848 CTCACATGGTGGAAGGGGCTGGG - Intronic
1124572581 15:30878659-30878681 CACACATGGTGGAAGGGGCAAGG - Intergenic
1124583263 15:30981420-30981442 CTCACATGACACAAGGGCAAAGG + Intronic
1124628044 15:31320854-31320876 CTCACATGGTGGAAGGGGCCAGG + Intergenic
1124839542 15:33229021-33229043 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1124888962 15:33713810-33713832 CTCACATGGTGGAAGAGGCAAGG + Intronic
1125091924 15:35802885-35802907 CTCACATAGCAGAAGGTGGAAGG + Intergenic
1125191957 15:37003844-37003866 CTCATATGGCAGAAGGGGTGAGG - Intronic
1125502656 15:40249127-40249149 CTCACATGATGGAAAGGGCCAGG + Intronic
1125738566 15:41945368-41945390 CTGACATGACAGCAGAGGCCAGG + Intronic
1125776858 15:42223605-42223627 GTCACATGACAGAAGGTGGAAGG - Intronic
1126124146 15:45280074-45280096 CTCACATGGCAGAAGGGACAAGG - Intergenic
1126153422 15:45543364-45543386 CTCACATGGTATAAGGGGCTAGG + Intergenic
1126358738 15:47823584-47823606 CTCACATGGTGGAAGGGGTAAGG - Intergenic
1126764777 15:52001162-52001184 TTCACATGACAGAAAGTGGAAGG - Intronic
1126804519 15:52333008-52333030 CTTACATGGCAGAAGGTGGAAGG - Intronic
1127040135 15:54966158-54966180 TTCACATGATAGAAGGAGCAAGG + Intergenic
1127074264 15:55310469-55310491 TTCCCTTGACATAAGGGGCATGG + Intronic
1127174578 15:56339816-56339838 CTCACAAGTCAGAAGGGGTGAGG - Intronic
1127290973 15:57570770-57570792 CACTCATGACAGAAGGTGAAGGG - Intergenic
1127492084 15:59474407-59474429 CTTACATGGCAGAAGGTGGAAGG + Intronic
1127815211 15:62602680-62602702 CTTACATGGCAGAAAGGGAAAGG + Intronic
1127855603 15:62951022-62951044 GTCACCTGACAGAACGGGGAGGG + Intergenic
1127984656 15:64060536-64060558 TTCACATGATGGTAGGGGCAAGG + Intronic
1128320204 15:66688122-66688144 CTTACTTGACAGAAGGTGGAGGG + Intergenic
1128350586 15:66885759-66885781 CTCAAATGAAGGAAGGGGCAAGG + Intergenic
1128362600 15:66972830-66972852 TTCCCTTGACATAAGGGGCATGG + Intergenic
1128591788 15:68904493-68904515 CTCACATGGCAGAAGGCAGAAGG + Intronic
1128822807 15:70675863-70675885 CTCACCTGGCAGAAGGCGAAAGG - Intronic
1128843754 15:70871783-70871805 CTCACATCCCAGACGGGGCGGGG + Intronic
1128899248 15:71404700-71404722 CTCGCATATCAGAAGAGGCAAGG - Intronic
1129429229 15:75486393-75486415 CTCACATGGCAGAAGGGGAAGGG - Intronic
1129552224 15:76465288-76465310 CTCACCTGACAGAAGGGGCAAGG + Intronic
1129922006 15:79327219-79327241 CTCACGTGGCAGAAGGGGCTAGG - Intronic
1130031483 15:80318252-80318274 CTCAGGTGGTAGAAGGGGCATGG + Intergenic
1130043595 15:80426907-80426929 CTCACGTGGCAGAGGGAGCAGGG + Intronic
1130429610 15:83833356-83833378 CTCACATGGCAGAAGGGATGAGG + Intronic
1130687456 15:86051336-86051358 CTCACAAGGTAGAAAGGGCAGGG + Intergenic
1130706885 15:86241597-86241619 CTCACATAGCAGAAGGTGAAAGG + Intronic
1130804164 15:87301178-87301200 TTTACATGACAGAGAGGGCAGGG + Intergenic
1130949806 15:88576890-88576912 CTCATATGGTGGAAGGGGCAAGG - Intergenic
1131077922 15:89509890-89509912 CTTTCATGACAGAAGGGGAGAGG - Intergenic
1131560743 15:93437243-93437265 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1131975287 15:97939752-97939774 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1132020547 15:98358148-98358170 CTCACATGACAGAAGAAGCAAGG - Intergenic
1132024259 15:98391599-98391621 CTCATCTGCCAGATGGGGCAAGG + Intergenic
1202948365 15_KI270727v1_random:8101-8123 CTCACATGGCATAAGGTGGAAGG - Intergenic
1132967910 16:2669706-2669728 GATACAAGACAGAAGGGGCAGGG + Intergenic
1133106632 16:3514718-3514740 CTCACATGGCAGCAGGGGTGAGG + Intronic
1133179006 16:4038427-4038449 CTCACATGACAGAAGAGCAAAGG - Intronic
1133707627 16:8370198-8370220 CTCACATGGTGGAAAGGGCATGG + Intergenic
1133736499 16:8619949-8619971 CTCACATGACAGAAGAAGTGAGG + Intergenic
1134285672 16:12860155-12860177 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1134310226 16:13069841-13069863 CTCACAGGGCAGAAGGGCCAAGG - Intronic
1134710919 16:16326614-16326636 TTCACATGAGAGAAGGAGGAGGG - Intergenic
1134834749 16:17351716-17351738 CTCAAATGTCAGTAGTGGCAAGG - Intronic
1134948665 16:18341995-18342017 TTCACATGAGAGAAGGAGGAGGG + Intergenic
1135043120 16:19133139-19133161 CTCACGTGGCAGAAGGGGTGAGG - Intronic
1135050795 16:19191395-19191417 CCCACATGGAGGAAGGGGCAAGG - Intronic
1135086840 16:19481910-19481932 CCCACGTGGTAGAAGGGGCAAGG - Intronic
1135149402 16:19992340-19992362 CTCACATAGCAGAAGAGGCAAGG - Intergenic
1135178632 16:20253633-20253655 CTCACATGACAGAAGAGGCAAGG + Intergenic
1135224755 16:20646292-20646314 TTCCCTTGACATAAGGGGCATGG - Intronic
1135899461 16:26443528-26443550 TTCACATGGCAGAAGGTGGAGGG - Intergenic
1136283436 16:29227907-29227929 CTCACATGGCGGAAGGGGTAAGG + Intergenic
1136417527 16:30112985-30113007 CTCACATGGCAGCCTGGGCAGGG + Intronic
1136788153 16:32947554-32947576 CACACATGACACACGGGGCGTGG - Intergenic
1136881631 16:33906235-33906257 CACACATGACACACGGGGCGCGG + Intergenic
1137002623 16:35243094-35243116 TGCACATGGCAGAAGGGACAAGG - Intergenic
1137018888 16:35402905-35402927 CCTCCATGACAGAAGGGACAAGG - Intergenic
1137357524 16:47780903-47780925 TTCCCATGACAGAAGGGGCTAGG + Intergenic
1137565587 16:49530762-49530784 CTCAGCTGACAGAAGAGGAAGGG + Intronic
1137751382 16:50863485-50863507 TTCACATGACTGCCGGGGCAGGG + Intergenic
1137791158 16:51175955-51175977 CACTCATGGCAGAAGGGGAAGGG - Intergenic
1137805494 16:51301096-51301118 CTCACATGGTGAAAGGGGCAAGG + Intergenic
1137863850 16:51873442-51873464 TTCACATGGCACAAGGGACAAGG - Intergenic
1137865465 16:51891246-51891268 ATCGCATGACAGAAGGTGGAAGG + Intergenic
1138087219 16:54143996-54144018 CTCAGATGACAAAAGGTGAAGGG - Intergenic
1138317173 16:56080383-56080405 CTCATTTGGCAGAAGGGGCAAGG + Intergenic
1138397162 16:56713867-56713889 CTCACATGGCAGAAGGCAGAAGG + Intronic
1138622878 16:58225789-58225811 CTCCCATATCTGAAGGGGCAAGG + Intergenic
1138693216 16:58788181-58788203 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1138694353 16:58797867-58797889 CTCATATGGTGGAAGGGGCAGGG + Intergenic
1139022814 16:62772864-62772886 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1139032026 16:62895682-62895704 CACTCATGGCAGAAGGGGAAAGG - Intergenic
1139350508 16:66332112-66332134 CTCACATGGCAGAAGAGGTGAGG - Intergenic
1139401827 16:66688118-66688140 CTCACATGGCAGAATGAGCAAGG + Intronic
1139445439 16:66995453-66995475 TTCCCATGACAGATGGGCCAGGG + Intronic
1140066855 16:71618722-71618744 CTCACATGGTAAAAGGAGCAAGG - Intergenic
1140231090 16:73117826-73117848 CTCATATGGTAGAAGGGGCAAGG - Intergenic
1140521816 16:75588335-75588357 CTCACATGGCGGAAGAGGTAAGG + Intergenic
1140706871 16:77638965-77638987 CTCACATGGCAGAAGGGGCCAGG - Intergenic
1140808260 16:78553313-78553335 TTCACAGGAAAGAAGGGGCCAGG + Intronic
1140886559 16:79249456-79249478 CTCACATGGTGGAAGGGGCATGG - Intergenic
1141030037 16:80579627-80579649 CTCACATGATGGAAGGAGCAGGG - Intergenic
1141042422 16:80683774-80683796 CTCACATGATAGAAGGGGCAAGG - Intronic
1141373766 16:83510947-83510969 CTTACATGACAGAATAGGCATGG - Intronic
1142087861 16:88193857-88193879 CTCACATGGCGGAAGGGGCAAGG + Intergenic
1142453699 16:90202897-90202919 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1203090381 16_KI270728v1_random:1209211-1209233 CACACATGACACACGGGGCGCGG - Intergenic
1143339620 17:6200543-6200565 CTTACATGGTAGGAGGGGCAAGG + Intergenic
1143816920 17:9524414-9524436 CTCATATGTCCAAAGGGGCAAGG + Intronic
1144125927 17:12202829-12202851 CTCACATGGCAGAAGAGGCAAGG - Intergenic
1144226951 17:13158459-13158481 CTCACATGACAGAAGGCAAAAGG + Intergenic
1144417756 17:15068183-15068205 CTCACATAGCAGAAGGTGAACGG + Intergenic
1144498619 17:15766347-15766369 TTTACATGACAGAAGGGGTGAGG + Intergenic
1144671562 17:17135611-17135633 CTCACATGTTAGAAGGGGCAAGG + Intronic
1144724012 17:17492328-17492350 CTGAAATGCCAGAAGGGGGAAGG - Exonic
1144798616 17:17910290-17910312 CTCACATCCCAGAGGGGGAAGGG - Intronic
1145102541 17:20088904-20088926 CTCACATGGCAGAAGGGGCAAGG - Intronic
1145162002 17:20581385-20581407 TTTACATGACAGAAGGGGTGAGG + Intergenic
1145378408 17:22373047-22373069 CTCACATGGCAGAAGGCGGAAGG - Intergenic
1145837530 17:27965863-27965885 CTCACATGGTGGAAGGGGCAGGG + Intergenic
1146415027 17:32623832-32623854 CTCACATGGCAAAAGGGCGAGGG + Intronic
1147400013 17:40175115-40175137 CTCACATGACACAAATGGCCAGG - Intergenic
1148468814 17:47880829-47880851 ATCACCTGAAAGAAGGGGAAGGG - Intergenic
1148571055 17:48669464-48669486 CTCACATGGCAGATGGGTGAGGG - Intergenic
1148913594 17:50956501-50956523 CCCAAATGAAAGAAGGGGCCAGG - Intergenic
1148971933 17:51491254-51491276 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1149200615 17:54181912-54181934 CTCACATGATGGAAGGGGCAAGG - Intergenic
1149505021 17:57187064-57187086 CTCTGTTGAGAGAAGGGGCAAGG - Intergenic
1150477699 17:65487441-65487463 CTCACGTGGCGGAAGGGGCTGGG + Intergenic
1150661878 17:67088185-67088207 CTCAAATGACAGAATGGGATTGG + Intronic
1150714790 17:67562665-67562687 CTCACAAGGCAGAAGGGCGAAGG + Intronic
1150719033 17:67598562-67598584 CTCACATGGTAGAAGGGACAAGG - Intronic
1150835188 17:68557469-68557491 CTGACATGGCAGAAGGGGTGAGG - Intronic
1150907971 17:69358909-69358931 CTCACATGACAGAGGGGGGAAGG - Intergenic
1150959947 17:69902118-69902140 CTCACATGGCAGAAGAGGTGAGG + Intergenic
1150998551 17:70347522-70347544 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1151145453 17:72036337-72036359 CTCACATGGCATAAGGGAAAAGG + Intergenic
1151532793 17:74717860-74717882 CTCACATGGTAGAAGGGGCAAGG - Intronic
1152029546 17:77833474-77833496 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1152145486 17:78566035-78566057 CTTACATGGCAGAAGGGGCAAGG - Intronic
1152286806 17:79417320-79417342 CTCTCAGGAAAGAAGGGGCCTGG + Intronic
1152521924 17:80861642-80861664 CTCACATGACACAAAGCCCAGGG + Intronic
1152783557 17:82236896-82236918 CGCACGTGCCAGGAGGGGCAGGG + Intronic
1153097288 18:1421507-1421529 CTCACATGGCAGAAGAGAGAAGG + Intergenic
1153100911 18:1468592-1468614 CTCACATGGTGGAAGGGACAAGG - Intergenic
1153132861 18:1877382-1877404 CTCACATGACAGAAGGGGGAAGG - Intergenic
1153711052 18:7799212-7799234 CTCACATGGCAGAAGGAGGAAGG + Intronic
1153848616 18:9072157-9072179 CTAAAATGTCAGAAGGGGCTGGG - Intergenic
1153967643 18:10196191-10196213 CTCACGTGGCAGAAGGAGCAAGG + Intergenic
1154213423 18:12398424-12398446 CTCACGTGGCAGAAGGGGTTAGG - Intergenic
1155553118 18:26987804-26987826 CTCACATGGTGGAAAGGGCAAGG - Intronic
1155650922 18:28140540-28140562 CTCACATGGTAGAAGAGGCAAGG - Intronic
1155767983 18:29659730-29659752 CTTACCTGGCAGAAAGGGCAAGG + Intergenic
1156173474 18:34514741-34514763 CTCACATGGTGGAAAGGGCAAGG + Intronic
1156708300 18:39911020-39911042 CTCACATGATAGAAAGAGCAAGG - Intergenic
1156886246 18:42139676-42139698 CTCACATGGCAGAAGCAGAAGGG + Intergenic
1157007146 18:43596634-43596656 CTGACATGAAAGAAAGAGCAGGG - Intergenic
1157023327 18:43813327-43813349 TTCTCATTACAGAAGAGGCAAGG + Intergenic
1157142274 18:45121386-45121408 TTCACAGAACAGAAGAGGCAGGG - Intergenic
1157301748 18:46484431-46484453 CTCACATGGCAGAAGGCGGAGGG - Intronic
1157423320 18:47563975-47563997 TTCACATGGCAGAAGGGGTGAGG - Intergenic
1157630158 18:49087042-49087064 TCCACATGGCAGAAGGGGTAAGG - Intronic
1157924633 18:51749850-51749872 CTCCCATGGTAGAAGGGACAAGG + Intergenic
1157988724 18:52469967-52469989 CTCACATGGCAGAAGTGCCTAGG + Intronic
1158094511 18:53755531-53755553 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1158125464 18:54095548-54095570 TTCACATGGTAGAAAGGGCAAGG - Intergenic
1158334104 18:56395727-56395749 CTCACATGGCAGAAGATGGAAGG + Intergenic
1158546039 18:58397973-58397995 CTCACATGCCAGCCAGGGCAGGG - Intronic
1158551324 18:58438535-58438557 CTCACATCAGACAAGGGGCAAGG - Intergenic
1158638187 18:59179614-59179636 CTCACAGGGTAGAAGGGGCTGGG + Intergenic
1158727562 18:59987377-59987399 CTCACATGGCAGAAGGGCAAGGG - Intergenic
1158980523 18:62756292-62756314 CTCACTTGGCAGAAGTGGCATGG + Intronic
1158992803 18:62887567-62887589 CTCACGTGGCTGAAGGGGCAAGG + Intronic
1159248343 18:65839362-65839384 CTCTCATGGCAGAAGGGGTGAGG + Intronic
1159270377 18:66141556-66141578 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1159358212 18:67364435-67364457 CTCACATGGGAGAAGGGACAAGG + Intergenic
1159407787 18:68027769-68027791 CTCACATGGTGGAAAGGGCAAGG + Intergenic
1159442175 18:68495343-68495365 CTCACATGACAGAAGGTGTGAGG + Intergenic
1159477719 18:68944506-68944528 CTTGCATGTTAGAAGGGGCAAGG + Intronic
1159829314 18:73254693-73254715 CACTCATGACAGAAGGTGAATGG + Intronic
1159858657 18:73619217-73619239 CTCATATGATGGAAGGGGCAAGG + Intergenic
1160118008 18:76100111-76100133 CTCACATGATGGAAGAGGCAAGG - Intergenic
1160348483 18:78153886-78153908 CTCACATGGCAGGAGGGGCCCGG + Intergenic
1161618621 19:5286566-5286588 CTCACGTGGCAGAAAGGGCAAGG - Intronic
1161750110 19:6089599-6089621 CTCACGTGATGGAAGGGGCAGGG - Intronic
1162444574 19:10714446-10714468 CTCACATGGCGGGAGGGGCAAGG + Intergenic
1162729997 19:12712711-12712733 CATACAAGGCAGAAGGGGCAGGG - Intronic
1163113524 19:15175947-15175969 CGCAGAGGACAGAAGGGGCAGGG + Intronic
1163114623 19:15181435-15181457 CTCTGATGACTGATGGGGCAGGG - Intronic
1163373419 19:16915109-16915131 CTCACATGGCAGGACAGGCAGGG - Intronic
1163894794 19:20049282-20049304 CTCACATGGCAAAAGAGACAAGG + Intergenic
1164057376 19:21633210-21633232 TTCCCTTGACATAAGGGGCATGG - Intergenic
1164173582 19:22748744-22748766 TTCCCTTGACATAAGGGGCATGG - Intergenic
1164323115 19:24168231-24168253 TTCCCTTGACATAAGGGGCATGG + Intergenic
1165600083 19:37047342-37047364 CTCACATGGCAGAAGGAGGAAGG - Intronic
1165642007 19:37397695-37397717 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1165642252 19:37399681-37399703 CTCACATGGCAGAAGGCAAAAGG + Intergenic
1165987351 19:39781671-39781693 CACTCATGACAGAAGGCGAAGGG - Intronic
1168281737 19:55309571-55309593 TTCACATGGCAGAAGGGGCAAGG + Intronic
1168490747 19:56806811-56806833 CTCACATGGCAAAAGAGGCTAGG - Intronic
1168637241 19:58005889-58005911 CTCACCTGACAGAAGGTAAAGGG - Exonic
924974113 2:157292-157314 TTCCCCTGACATAAGGGGCATGG + Intergenic
925038477 2:710690-710712 CTCACACAGCAGAAGGGACAGGG - Intergenic
925121875 2:1425027-1425049 ATGACTTTACAGAAGGGGCACGG - Intronic
925121901 2:1425416-1425438 ATGACTTTACAGAAGGGGCACGG - Intronic
925400153 2:3566864-3566886 CACTCATGGCAGAAGGGGAAGGG - Intergenic
925483361 2:4301409-4301431 CTCACATGGTGGAAGGGACAAGG - Intergenic
925496089 2:4450900-4450922 CTCACATGGCAGAAGGCTGAAGG - Intergenic
925504412 2:4544718-4544740 CTCACATGGCAGAAGAGGCAAGG + Intergenic
925665565 2:6251755-6251777 CTCACATCACAGATGGGGACAGG + Intergenic
925880641 2:8349611-8349633 CTCACATGGCAGAAGGCAGAGGG + Intergenic
926041742 2:9679216-9679238 CTCACATGGTGGAAGGGGCAAGG - Intergenic
926041889 2:9680090-9680112 CTCACATGGTAGAAAGGGGAAGG + Intergenic
927084686 2:19662774-19662796 CTCACATGATGGAAGGGGCAAGG + Intergenic
927321926 2:21757162-21757184 CTCACATGACTGAAGGAGCGAGG + Intergenic
927572329 2:24170527-24170549 CTCAGATGCCAGAATGTGCAAGG - Intronic
927601910 2:24450451-24450473 CTCACATGGCAGAAGGGGTGGGG - Intergenic
927730259 2:25464894-25464916 CTCACAGAACAGAAGGAGCCAGG + Intronic
927746424 2:25625935-25625957 CTCACATGACAAAGGGGCAAAGG - Intronic
928002002 2:27531541-27531563 CACTCATGGCAGAAGGGGAAAGG - Intergenic
928361378 2:30664781-30664803 CTCACATGGCTGAAGGGGTGAGG - Intergenic
928411752 2:31059750-31059772 TTCACATGGCAGAAGGGGTGAGG - Intronic
928440016 2:31284536-31284558 CTCACATGGTGGAAGGGGCCAGG - Intergenic
928476478 2:31632402-31632424 TTCCCTTGACATAAGGGGCATGG - Intergenic
928677074 2:33660816-33660838 TTCCCTTGACATAAGGGGCATGG - Intergenic
928801204 2:35094971-35094993 TTCACATGGCAGAAGGGGCAAGG + Intergenic
929072014 2:38040444-38040466 CTTACATGATGGAAGGGACAAGG - Intronic
929129035 2:38547962-38547984 CTCACATGGCAGAAGGAGCAGGG - Intergenic
929228119 2:39531630-39531652 CTCACATGGTGGAAGGGGGATGG + Intergenic
929335271 2:40736047-40736069 GTCACATGGCAGAAGGAGTAAGG - Intergenic
929584524 2:43105420-43105442 CTCACATGGCAGAAGGGGTTAGG - Intergenic
929831125 2:45347351-45347373 CTCACATGGCAGAAGGAGCAAGG + Intergenic
929965561 2:46532656-46532678 CTCACATGGTAGAAGGGAAAAGG - Intronic
930011235 2:46940272-46940294 CTCAAAAGACAGCAGGGTCAGGG - Intronic
930100446 2:47599104-47599126 CTCACATGGTGGAAGAGGCAAGG - Intergenic
930157721 2:48122956-48122978 CTCACTTGCTGGAAGGGGCAAGG - Intergenic
930239650 2:48922876-48922898 CTCACATGGCAGAAGCTGGAAGG + Intergenic
930602684 2:53459961-53459983 GTTACATGGTAGAAGGGGCAAGG - Intergenic
930605945 2:53493172-53493194 CTCACATGGGAGAAGGGGCAAGG - Intergenic
930631575 2:53759750-53759772 TTCCCTTGACATAAGGGGCATGG - Intronic
931146628 2:59526669-59526691 CTCACATAGTGGAAGGGGCAAGG - Intergenic
932131681 2:69193236-69193258 TTCACATGACTGAAGAAGCACGG + Intronic
932186155 2:69698146-69698168 CTCACATGACTGAAGGAGCAAGG + Intronic
932359286 2:71091317-71091339 CTCATATGGTGGAAGGGGCAAGG - Intergenic
932365601 2:71151098-71151120 CTCACTTGGCAGAAGGTGGAAGG + Intergenic
932639768 2:73432601-73432623 CTCCCATGGTGGAAGGGGCAGGG + Intronic
932837675 2:75052250-75052272 CTCAGATGGTGGAAGGGGCAAGG - Intronic
932889322 2:75578514-75578536 CTCACATGACAGAAGGACCAAGG - Intergenic
932917701 2:75875724-75875746 TTCCCTTGACATAAGGGGCATGG - Intergenic
932943917 2:76204414-76204436 CTTGCATGGTAGAAGGGGCAAGG - Intergenic
932972295 2:76558901-76558923 CTCACATGGCAGAAGGGCTGAGG - Intergenic
933238368 2:79890892-79890914 ATCACATGGTGGAAGGGGCAGGG + Intronic
933881810 2:86677154-86677176 CTCACATGGCAGAAATAGCAAGG - Intronic
933996147 2:87671485-87671507 CTCACCTGAAGGAAGGGGCAAGG + Intergenic
934672039 2:96220270-96220292 TTCCCTTGACATAAGGGGCATGG + Intergenic
934891439 2:98073891-98073913 CTCAGATGGCAGAAGGAGAAAGG + Intergenic
934942164 2:98510557-98510579 CTCACATGACAAAAGGTGAAGGG + Intronic
935011224 2:99137952-99137974 CTCATATGTTAGAAGGGGCAAGG - Intronic
935272578 2:101447952-101447974 CTCACATGGCAGAAGGCAGAAGG + Intronic
935400544 2:102655864-102655886 CTCACATGGCAGAAGGCAGAGGG + Intronic
935524425 2:104148031-104148053 CTCACATGGTGGAAGGGGCTGGG - Intergenic
935586972 2:104809455-104809477 CTTACATGGTGGAAGGGGCAAGG - Intergenic
935635334 2:105245489-105245511 CTCGCATGGCAGAAAGGGAAGGG + Intergenic
935708332 2:105875618-105875640 CTCACATGGCAGAAGCAGCAAGG - Intronic
935718091 2:105956108-105956130 CTCACATGGCAGAAGTGGACGGG - Intergenic
935748714 2:106212010-106212032 TTCCCTTGACATAAGGGGCATGG - Intergenic
935809659 2:106785201-106785223 CTCACATTGTGGAAGGGGCAGGG + Intergenic
935851438 2:107224379-107224401 CTCACATGGTAGAAGGGGTGAGG + Intergenic
936053898 2:109246346-109246368 CTCCCATGGTAGAGGGGGCAAGG + Intronic
936143865 2:109965856-109965878 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936180547 2:110263818-110263840 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936200822 2:110405613-110405635 CTCACTTGACAGAAGGGGCAAGG + Intronic
936262976 2:110978252-110978274 CTCACATGGCAGAAGGCAGAAGG + Intronic
936297708 2:111279427-111279449 CTCACCTGAAGGAAGGGGCAAGG - Intergenic
936387278 2:112041461-112041483 TTCCCTTGACATAAGGGGCATGG + Intergenic
936543130 2:113368281-113368303 CTCACATGGCAGAAGGGGTGAGG + Intergenic
936596900 2:113856778-113856800 CTCACATGGCAGAAGGCAGAAGG - Intergenic
937013604 2:118583555-118583577 CTCACATGGCAGAAGGGGTGAGG + Intergenic
937055410 2:118930907-118930929 CTCACATGGCAGATGGTGGAAGG + Intergenic
937433880 2:121864147-121864169 CTCACATGGTGGAAGGGGAAAGG - Intergenic
937466479 2:122137394-122137416 CTCACATGGTGGAAAGGGCAAGG - Intergenic
937494177 2:122400498-122400520 TTCACATGGCGGAAGGGGCACGG - Intergenic
937691651 2:124762772-124762794 CTCACACCACAGAAGAGACAGGG - Intronic
937871276 2:126787983-126788005 CTCACATGATTGCAGGGGCCAGG + Intergenic
938079085 2:128359743-128359765 CACACATGACAGAAGGGGAAAGG - Intergenic
938146726 2:128840609-128840631 CTGAGTTGACAGAAGGGGCATGG + Intergenic
938492290 2:131767891-131767913 CTCACATGACAGAAGGGATGAGG + Intergenic
938495279 2:131794459-131794481 CTCACATGACAGAAGGGATGAGG - Intergenic
938556856 2:132432277-132432299 CTCACATGGTGGAAGGGGCAAGG + Intronic
938684281 2:133721864-133721886 CTCACATGGTGAAAGGGGCAAGG - Intergenic
938945876 2:136211639-136211661 TTCACATGGTAGAAGGAGCAAGG + Intergenic
938961487 2:136345511-136345533 CTCACATGGCAGAAGGAGCAAGG + Intergenic
939105194 2:137940601-137940623 CTCACATGGCAGAAGAGGCGAGG + Intergenic
939115005 2:138050423-138050445 CTCACATGATGAAAGGGGCAAGG + Intergenic
939119570 2:138100388-138100410 CTCACATGGTAGAAGGAGCCTGG + Intergenic
939269263 2:139916685-139916707 TTCACATGGTGGAAGGGGCAAGG - Intergenic
939493625 2:142903777-142903799 TTCCCTTGACATAAGGGGCATGG + Intronic
939499370 2:142963499-142963521 CTCACATGGCAGAAGGGCTAAGG + Intronic
939826099 2:147017229-147017251 CCCACATGGTGGAAGGGGCAAGG + Intergenic
940038868 2:149338549-149338571 CTCACATGGCAGAAGAAACAAGG - Intronic
940285560 2:152029780-152029802 CTCAAATGGTAGAAGGGGCAAGG - Intronic
940368403 2:152874513-152874535 CTTACATGATGGAAGGGGTAAGG + Intergenic
940372781 2:152921408-152921430 CTCACATGGTAGAAGGGGCAAGG + Intergenic
940385204 2:153063635-153063657 CTCACATGGTGGAAGAGGCAGGG - Intergenic
940418435 2:153449792-153449814 CTCACATGACAGAAGGTGGAAGG + Intergenic
940478723 2:154200629-154200651 CTCACATGGCAGAAGGTAGAAGG + Intronic
940570184 2:155422166-155422188 CTCACATGGTGGAAAGGGCAAGG + Intergenic
940580635 2:155575135-155575157 CTCACATGGTAGAAAAGGCAAGG - Intergenic
941348839 2:164406127-164406149 CTCACATGGCAGAAGGAGCAAGG - Intergenic
941478749 2:165979838-165979860 CGCACATGACAGAAGGAGTGAGG - Intergenic
941687814 2:168465351-168465373 CTCACATCACGGAAGGGGCGAGG + Intronic
941688999 2:168478748-168478770 CACCCAAGACAGAAGGGCCAGGG - Intronic
941708072 2:168680734-168680756 CTCACATGACAGAATGCTGAAGG - Intronic
941722926 2:168831234-168831256 CTCAGATGGCAGAAGGGGCTAGG + Intronic
941856279 2:170234367-170234389 CTCACATGGCAGAAGGCAGAAGG + Intronic
942580400 2:177410896-177410918 TTCCCTTGACATAAGGGGCATGG + Intronic
942650692 2:178164348-178164370 CTCAAATGGTTGAAGGGGCAAGG + Intergenic
942718239 2:178919075-178919097 CTCACATGGTGGAAGGGGCAAGG - Intronic
942830826 2:180236335-180236357 TTCCCTTGACATAAGGGGCATGG - Intergenic
942850748 2:180482495-180482517 CTCACATGATTGAAGGTGGAGGG + Intergenic
942955976 2:181773824-181773846 CTCACATGGACAAAGGGGCAAGG - Intergenic
943195623 2:184744478-184744500 CTCACATGGTGGAAGGGGCATGG - Intronic
943592711 2:189818397-189818419 CTCACATGGCAGAAGAAGGAAGG - Intronic
943625695 2:190197045-190197067 CTCACATGTCAGTAGGGGCAAGG + Intronic
943800943 2:192056829-192056851 TTCACATGGCAAAAAGGGCAAGG - Intronic
944036273 2:195298182-195298204 TTCACATGATGGAAAGGGCAGGG - Intergenic
944217742 2:197272700-197272722 CTCACATGATGGAAGGGGTGAGG - Intronic
944223576 2:197326641-197326663 CTCACATGGCAGAAGGCTGAAGG - Intergenic
944467609 2:200018793-200018815 CTCACATGGCAGAAGGGGTAAGG + Intergenic
944577778 2:201106241-201106263 CTCATATGGTAGAAGGGGCAAGG - Intergenic
944977996 2:205079453-205079475 CTTACATGACAGAAGGCAGAAGG + Intronic
944995823 2:205292283-205292305 CTCACATGGTGGAAGGGTCAAGG - Intronic
945007857 2:205428419-205428441 CTCACATGGCAGAAGAGGTGAGG - Intronic
945319503 2:208405839-208405861 CTCACATGGCAGAAGGGATGAGG - Intronic
945607991 2:211960704-211960726 TTCACACAGCAGAAGGGGCAAGG + Intronic
945650412 2:212551637-212551659 CTCCCATGATAGAAGGGGCAAGG + Intergenic
945664630 2:212725455-212725477 CTCGAATGTCAGAAGGGACAGGG + Intergenic
945930724 2:215852551-215852573 CTCACATGGCAGAAGGGTCAAGG + Intergenic
946151229 2:217772814-217772836 CTCACATGGTGAAAGGGGCAAGG + Intergenic
946443147 2:219713969-219713991 CTCATATGGCAGAAGGGGTAGGG - Intergenic
946447913 2:219755353-219755375 CTCATATGGTAGAAGGGACAAGG - Intergenic
946468929 2:219938537-219938559 CTCACCTGGCAGAAGGTGAAAGG - Intergenic
946528970 2:220550943-220550965 CTGACTTGGCAGAAGGGGCCAGG + Intergenic
946866736 2:224047650-224047672 CTCACATGGCAGGAGGAGTAAGG - Intergenic
946972352 2:225108565-225108587 CTCACATGGTGGAAGGGGCAAGG + Intergenic
947069821 2:226276189-226276211 CTCACATGGCAGAAGGAGCACGG + Intergenic
947288641 2:228546570-228546592 CTCACATGGTGGAAGGGGCTGGG + Intergenic
947361787 2:229352847-229352869 CTCACATGGTGGAAGGGACAGGG - Intergenic
947436432 2:230076766-230076788 CTCACATGATAGAAGGGGCAGGG + Intergenic
947665644 2:231903887-231903909 CTCACATGGCAGAAGCTGGAAGG + Intergenic
947800172 2:232924289-232924311 CTCACAGGACGGAAGGGGCCAGG - Intronic
947845136 2:233237708-233237730 CTCACATGGTAGGAGGAGCAAGG + Intronic
947994965 2:234519509-234519531 CTCACATGGTGGAAGGGGCAAGG + Intergenic
948222661 2:236285332-236285354 CTCACATAGCAGAAGGTGGAAGG - Intergenic
948556319 2:238813840-238813862 GGCACATGACGGAAGGAGCAGGG - Intergenic
948582955 2:239000333-239000355 CTCACATGGTGGAAGGGGCAAGG + Intergenic
948765997 2:240219354-240219376 CTCACATGGCAGAAGGGGTAAGG + Intergenic
949085145 2:242147560-242147582 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1168741373 20:194025-194047 TTCCCTTGACATAAGGGGCATGG + Intergenic
1169331401 20:4719309-4719331 CCCACATGGCAGAAGGGACAAGG + Intergenic
1169343994 20:4815825-4815847 CTCACAGGACAAAAGTGGCCAGG - Intronic
1169429131 20:5520926-5520948 CTCAGATGAAATAAGAGGCATGG + Intergenic
1169747137 20:8953912-8953934 CTTGCATGGCAGAAGGGACAAGG + Intronic
1169902475 20:10567403-10567425 CTCACACGGCAGAAGGAGGAAGG - Intronic
1170020091 20:11827791-11827813 TTCACATGGTAGAAGGGGCAAGG - Intergenic
1170064172 20:12292624-12292646 CTCACATGGTGGAAGGGACAGGG - Intergenic
1170075093 20:12410474-12410496 CTCACATGGTGAAAGGGGCAAGG - Intergenic
1170195530 20:13685280-13685302 CTCACATGGCAGAAGGCTGAAGG + Intergenic
1170407765 20:16056850-16056872 CTCACATGGCACCAGGGGCAAGG - Intergenic
1170425397 20:16230202-16230224 GTCAGATGACAGAAGGGTAAAGG - Intergenic
1170796938 20:19556052-19556074 CTCACATGGTGGAAGGGGCAAGG + Intronic
1170819775 20:19747037-19747059 ATCACATGGCAGAAGGTGGAAGG + Intergenic
1170957049 20:20991167-20991189 CTCACATGGCAGAAGGGGAGAGG + Intergenic
1171524869 20:25800943-25800965 CTCACATGGCAGAAGGTGGAAGG + Intronic
1171534057 20:25870610-25870632 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1171551958 20:26054940-26054962 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1171571231 20:26253484-26253506 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1171855383 20:30338166-30338188 CTCACATGGCAGAAGGCGGAAGG + Intergenic
1172279268 20:33699142-33699164 CTCACATCCCAGACGGGGCGGGG - Intergenic
1172835650 20:37871441-37871463 CTCACATTGCAGAAGGGGGAAGG + Intronic
1173234174 20:41228572-41228594 CTCACATGGCAGAAGGGACCAGG + Intronic
1173384034 20:42572125-42572147 CTCACAGGGCAGAAGAGGCCGGG + Intronic
1173433002 20:43008279-43008301 TTCACATGGTGGAAGGGGCAAGG - Intronic
1173574582 20:44103936-44103958 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1173674280 20:44820412-44820434 CCCACATGTCAGAAGGGGGATGG + Intergenic
1173881281 20:46414357-46414379 TTCACGTGGCAGAAGGGGAAAGG + Intronic
1174094047 20:48073840-48073862 CTCCCAGGACAGAAGGAGGATGG - Intergenic
1174112888 20:48208336-48208358 CGCACATGTCTGAAGGGGCGAGG - Intergenic
1174144550 20:48442283-48442305 CTCAAACGACAGAAGGGGCAAGG + Intergenic
1174517766 20:51106296-51106318 CTCACATGGCAGAAGGGGAAAGG - Intergenic
1175076899 20:56382915-56382937 CTGACATTACAGGAGGGGGAGGG + Intronic
1175916676 20:62429204-62429226 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1176268831 20:64224858-64224880 TTCACAGGACAGAAAGGACATGG - Intronic
1176709572 21:10137692-10137714 CTCACATGACAGAAGGGATGAGG + Intergenic
1176937276 21:14881987-14882009 CTCACATGGTGGAAGGGCCAAGG + Intergenic
1176965287 21:15205754-15205776 CTCACAGGGTAGAAAGGGCAAGG - Intergenic
1177006242 21:15675865-15675887 CTCACATGGCAGAAGGGGTGAGG - Intergenic
1177018222 21:15817636-15817658 CTAACATGGCAGAAGGTGAAGGG + Intronic
1177080693 21:16635203-16635225 ATCACATGGCAGAAGGAGCAAGG - Intergenic
1177197042 21:17914275-17914297 CTCACATGGCAGAAGAGTAATGG + Intronic
1177223785 21:18227097-18227119 CTCACATAGTGGAAGGGGCAAGG + Intronic
1177263478 21:18756511-18756533 TTCCTTTGACAGAAGGGGCATGG + Intergenic
1177338441 21:19763788-19763810 CCCACATGGTGGAAGGGGCAAGG - Intergenic
1177438367 21:21085355-21085377 GTTCCATGACAGAAAGGGCAGGG - Intronic
1177693607 21:24542077-24542099 TTCACATGGCAGAAGGTGGAAGG + Intergenic
1177802358 21:25840379-25840401 CTCACATGGTAGAAGGGCAAGGG + Intergenic
1178136882 21:29637591-29637613 CTCACATGGTGAAAGGGGCAAGG - Intronic
1178169373 21:30021555-30021577 CTCACATGGCAGAAGAGGCAAGG - Intergenic
1178551386 21:33542582-33542604 CTCACATGCCAGTGGGGGCGGGG + Exonic
1179161159 21:38900513-38900535 CTCACATGGCAAAAAGGGCAAGG - Intergenic
1179239312 21:39575024-39575046 CTCACATTATGGAAGGAGCAAGG + Intronic
1179259103 21:39742599-39742621 TTCCCTTGACATAAGGGGCATGG + Intergenic
1179284862 21:39968564-39968586 CTCACATGGTGGAAGGGGTAAGG + Intergenic
1179341897 21:40519488-40519510 CTCAGATGGCCAAAGGGGCAAGG - Intronic
1179390004 21:40979765-40979787 CTCACCTGGCAGAAGTGGAAGGG - Intergenic
1179835302 21:44027864-44027886 CTCACGTGGGGGAAGGGGCAAGG - Intronic
1180293671 22:10865005-10865027 CTCACATGACAGAAGGGATGAGG + Intergenic
1180496476 22:15894420-15894442 CTCACATGACAGAAGGGATGAGG + Intergenic
1180573408 22:16750504-16750526 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1181411992 22:22730619-22730641 CTCACATGACAGAAGGGATGAGG - Intergenic
1181419034 22:22784948-22784970 CTCACATGACAGAAGAGATGAGG - Intronic
1181591282 22:23886528-23886550 TAGACATGGCAGAAGGGGCAAGG + Intronic
1181601539 22:23955114-23955136 GTCACCTGGCAGCAGGGGCAGGG - Intergenic
1181975710 22:26727896-26727918 TTCACATGGCAGAAGGTGGAAGG + Intergenic
1182174016 22:28264427-28264449 CCCACATGATGGAAGAGGCATGG - Intronic
1182742591 22:32579419-32579441 CTCACACAGCGGAAGGGGCAAGG + Intronic
1182782100 22:32876198-32876220 CTTACATGGCAGAAGGGGCAAGG + Intronic
1182817638 22:33180007-33180029 CTCACATGGCAGAAGGCAGAAGG - Intronic
1182838033 22:33360438-33360460 CAATCATGGCAGAAGGGGCATGG + Intronic
1182899660 22:33887307-33887329 CTTACGTGAAAGAAGGGGCGAGG - Intronic
1182920540 22:34075215-34075237 CTCACATGGCAGAAGGGGGAAGG + Intergenic
1182931147 22:34175489-34175511 CTCACATGGTGGAAGGGCCAAGG + Intergenic
1183007558 22:34916181-34916203 CTCACAGGGTGGAAGGGGCAAGG - Intergenic
1183012394 22:34957590-34957612 CTCACATGGCAGAAGGAGTGAGG + Intergenic
1183283602 22:36948331-36948353 CTCATATGGCCGAAGGGGCGAGG + Intergenic
1183513481 22:38249574-38249596 CTCATGTGGTAGAAGGGGCATGG - Intronic
1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG + Intronic
1183870858 22:40741109-40741131 CTCACATGCTGGAAGGAGCAAGG - Intergenic
1184014849 22:41778170-41778192 CTCACATGACAGAAGGGGTGAGG + Intronic
1184494053 22:44827006-44827028 CTTACATGGCAAAAGGGGCTTGG + Intronic
1184559784 22:45255549-45255571 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1184740538 22:46426473-46426495 CTCACATGACAGAAGGGGTGAGG + Intronic
1185126621 22:49014740-49014762 CTCCCAGCACAGAAGGTGCAGGG + Intergenic
949316007 3:2756360-2756382 CTCACATGGCAGAAGGAGCAAGG - Intronic
949319619 3:2794856-2794878 CTCACGTGGTGGAAGGGGCAAGG + Intronic
949340197 3:3021411-3021433 CTCAGATGACATAAGGGGACTGG - Intronic
949602972 3:5621257-5621279 CTCACAGGATGGAAGGGGCAAGG + Intergenic
949624485 3:5851374-5851396 CACTCATGACAGAAGGTGAAGGG - Intergenic
949636258 3:5984648-5984670 ATCACATGGCAGAAGGTGAAAGG + Intergenic
949677201 3:6469301-6469323 CTCACATAGCAGAAGTGGGAGGG - Intergenic
949726918 3:7059772-7059794 CTCACATGGCAGAAGGGGTTAGG - Intronic
949765484 3:7521459-7521481 TTCACATGATGGAAGGGGCAAGG - Intronic
949931530 3:9082381-9082403 TTCACATGGTGGAAGGGGCAAGG - Intronic
950030252 3:9847312-9847334 GTCACATGGCGGAAGGGGCGAGG - Intronic
950155612 3:10719400-10719422 CTCACATGATGGGAGGGGTAAGG + Intergenic
950307493 3:11927780-11927802 CACTCATGGCAGAAGGGGAAGGG + Intergenic
950507299 3:13403350-13403372 GTCACATGGCAGAAGGGGCGAGG + Intronic
950567373 3:13778290-13778312 CTCACATGGCATAAGGGGCCAGG - Intergenic
950688875 3:14639803-14639825 GTCACATGGTAGAAGGGGTAAGG + Intergenic
950800700 3:15550045-15550067 ATCACATGCCTGAAGGGCCAAGG + Intergenic
951061692 3:18215828-18215850 CTCACATGACAGAAAGAGAAAGG - Intronic
951163359 3:19453702-19453724 CGCACATGGGAGAAAGGGCAAGG - Intronic
951462176 3:22963245-22963267 CTCACACAGCAGAAGGGGTAAGG - Intergenic
951522543 3:23622700-23622722 CTCCCATCACAGAAGGGGCAAGG + Intergenic
951843381 3:27059206-27059228 CTCACATAACTGAATGGGAAAGG - Intergenic
952058515 3:29478389-29478411 CTCACATGATGGAAGTGACAAGG + Intronic
952502385 3:33976163-33976185 CTTACACGACGAAAGGGGCAAGG + Intergenic
952505591 3:34004387-34004409 CTCACATTTGGGAAGGGGCAGGG + Intergenic
952510389 3:34047749-34047771 CTCACATGGCAGAAGAGCCAAGG - Intergenic
952521907 3:34169379-34169401 CTTACATAACAGAAGGTGGAAGG + Intergenic
952733462 3:36664625-36664647 CAAACATGACGGAAGGGGAAGGG - Intergenic
953257546 3:41305868-41305890 CTCACATCCCAGACGGGGCGGGG - Intronic
953408561 3:42673506-42673528 CTCACATGGCAGAAGGCCAAAGG + Intergenic
954525949 3:51271423-51271445 CTCACATAGCAGAAGGGGCAAGG + Intronic
954815078 3:53273846-53273868 CACTCATGGCAGAAGGGGAAGGG + Intergenic
954965027 3:54602891-54602913 CTCACATTGCAGAAAGGGCCTGG + Intronic
954974864 3:54683904-54683926 GCCACGTGAAAGAAGGGGCAAGG - Intronic
955071182 3:55573708-55573730 CTCACATTAAAGATGAGGCAGGG - Intronic
955148328 3:56342078-56342100 CTCACATGAAGGGAGAGGCAGGG - Intronic
955241648 3:57183241-57183263 CTCACATGGCAGAAGGGGAAAGG + Intergenic
955505203 3:59625788-59625810 CTTATATGCCAGAAGGGTCAAGG + Intergenic
955515653 3:59724033-59724055 CTCACATGGTGGAAGGGGCAAGG + Intergenic
955926312 3:64008698-64008720 CTCAAATGCCAGCAGGGGCCAGG + Intergenic
956041557 3:65150390-65150412 CTCACGTGGTGGAAGGGGCAAGG - Intergenic
956582137 3:70825959-70825981 CTTGCATGGCAGAAGGGGCAAGG - Intergenic
956758358 3:72412960-72412982 CTCACATGGCAGAAGGTGGAAGG - Intronic
956774854 3:72556478-72556500 CTCAGATGACAGAAGGAACCAGG + Intergenic
956887947 3:73579178-73579200 CTCACATGGTGAAAGGGGCAAGG - Intronic
956919187 3:73908267-73908289 CTCACATGGCAGAAGGCAGAAGG - Intergenic
956957343 3:74356124-74356146 CTCACATGGTAGAAGGGGCAAGG - Intronic
957000249 3:74876156-74876178 TTCCCTTGACATAAGGGGCATGG + Intergenic
957660542 3:83145955-83145977 ATGACATGAGAGAAGGGGAAGGG - Intergenic
957941302 3:87007810-87007832 CTTATATGGTAGAAGGGGCAAGG - Intergenic
958016225 3:87942557-87942579 CTCCCTTGACATAAGGGGCTTGG + Intergenic
958124282 3:89335287-89335309 CTCAGATGATAGAAGGGACAAGG + Intronic
958610769 3:96423332-96423354 ATCACGTAACAGAAGGGCCAAGG - Intergenic
958629771 3:96670601-96670623 TTCCCTTGACATAAGGGGCATGG + Intergenic
958658581 3:97036006-97036028 CTCACAAGGCAGATGGGACAAGG - Intronic
958686803 3:97408677-97408699 CTCACATGGCAGAAGGGTATGGG + Intronic
958891329 3:99786406-99786428 CTTACATGATAAAAGGGGCAAGG - Intronic
959224507 3:103562964-103562986 CTCACATGGTGGAAAGGGCAAGG - Intergenic
959508973 3:107188659-107188681 CTCACATGGTAGAAGGGGAGAGG + Intergenic
959518421 3:107297853-107297875 CTCACATGATGGAAGGGGCAAGG - Intergenic
959624895 3:108438646-108438668 CTCACATCACACAAGGAACAAGG - Intronic
959716500 3:109439254-109439276 CATACATGGCAGAAGGGGCAAGG - Intergenic
960241113 3:115343191-115343213 CTCACACGGCAGAAGGAACAAGG - Intergenic
960375197 3:116892323-116892345 TTCACATGGCAGAAGGAGCGAGG + Intronic
960461584 3:117942518-117942540 CTCACATGGTGGATGGGGCAAGG - Intergenic
960697746 3:120412415-120412437 CTCACATGGCAGAAGGCAGAAGG - Intronic
960823237 3:121756668-121756690 CTCACGTGGCAGAAGAGGCAAGG - Intergenic
961703513 3:128765639-128765661 CTCACATGGTGGAAGGGGCGAGG + Intronic
961826574 3:129602288-129602310 AGCACATGACACAAGGGCCAGGG - Intronic
962128491 3:132647914-132647936 CTCACATGGTGGAAGGGGCAAGG + Intronic
962325976 3:134432537-134432559 CTCAGGTAAGAGAAGGGGCATGG + Intergenic
962353088 3:134670003-134670025 CTCTCATTGCAGAAAGGGCAAGG - Intronic
962495477 3:135935560-135935582 TTCCCTTGACATAAGGGGCATGG - Intergenic
962567533 3:136677643-136677665 TTCACATGTTAGAAAGGGCAAGG - Intronic
962894165 3:139698945-139698967 CACTCATGTCAGAAGGGGAAGGG - Intergenic
963010787 3:140768378-140768400 CTCACATGGTGGAAGGAGCAAGG - Intergenic
963187983 3:142439922-142439944 TTCCCTTGACATAAGGGGCATGG - Intronic
963335223 3:143967489-143967511 TTCGCATGGCAGAAGGGACAAGG - Intergenic
963423085 3:145087225-145087247 CTCACATGACAGAAAGTGGAAGG + Intergenic
963462788 3:145638168-145638190 TTCACATGGTGGAAGGGGCAAGG - Intergenic
963463068 3:145641806-145641828 CTGACATGATAGCGGGGGCAGGG - Intergenic
963467935 3:145705563-145705585 TTCACATGGCAGAAAGGGGAAGG - Intergenic
963645463 3:147908350-147908372 CTCACATGGTGGAAGGGGCAAGG - Intergenic
963845465 3:150151429-150151451 CTCACATGACAGAAAGAGAGAGG - Intergenic
964092651 3:152894481-152894503 CTCGTATGACAGAAGGGGCAAGG - Intergenic
964165134 3:153695079-153695101 CTCACATGGCAGAAGGGAGAAGG - Intergenic
964309631 3:155378899-155378921 CTCACATGGCAGAAGGGGCGTGG + Intronic
964323802 3:155525352-155525374 CTCACGTGACAGAAGGGGCAAGG - Intronic
964432317 3:156620458-156620480 CTCACATGACATAACTTGCAGGG - Intergenic
964679345 3:159320292-159320314 CTCACATGGTGAAAGGGGCAAGG - Intronic
964728113 3:159836310-159836332 TTCACACAGCAGAAGGGGCAAGG + Intronic
964761808 3:160141614-160141636 CTTACATGATCAAAGGGGCAAGG + Intergenic
965797566 3:172457250-172457272 CTCACATGGCAGAAGGGGTGAGG + Intergenic
965825191 3:172722868-172722890 TTCCCTTGACATAAGGGGCATGG - Intergenic
966001047 3:174949007-174949029 CTCACATGGCAGAAGAGAAAGGG + Intronic
966288753 3:178329588-178329610 CTCACATGGCAGAAGGGCAGAGG + Intergenic
966792829 3:183689523-183689545 CGCACCTGGCAGAAGGGGTAAGG + Intergenic
966916064 3:184584622-184584644 CTCCCATGGCAGAACGGGTAGGG + Intronic
967137844 3:186527601-186527623 GTCAAAAAACAGAAGGGGCATGG - Intergenic
967623594 3:191662254-191662276 TTCTCTTGACATAAGGGGCATGG - Intergenic
967684071 3:192399306-192399328 TTCAAATGGCAGAAGGGGCAAGG - Intronic
967774916 3:193376337-193376359 CTCACATGGTAGAAGGGACAAGG + Intronic
967887720 3:194344774-194344796 CTCACATGTCCTAAGTGGCAGGG - Intronic
968497255 4:925706-925728 CTCACAGGGCAGAAGGGGTGAGG - Intronic
969081370 4:4621180-4621202 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969106359 4:4809812-4809834 CTCACATGGCAGAAAAGGGAAGG - Intergenic
969299003 4:6286352-6286374 CTCACAGGGTGGAAGGGGCAAGG - Intronic
969321052 4:6412854-6412876 CTCACATGGGGGAAGGGGCAAGG - Intronic
969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG + Intronic
969355867 4:6625265-6625287 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969361603 4:6667579-6667601 TTCACATGGCAGGAGGGGCGAGG - Intergenic
969368134 4:6712193-6712215 CTCACAGGATGGAAGGAGCAAGG + Intergenic
969672177 4:8595881-8595903 CACACATGACAACAGAGGCAGGG + Intronic
969965234 4:10987180-10987202 CTCATATGGTAGAAGGGGCAAGG - Intergenic
969981928 4:11166512-11166534 CTCCCATTAAAGATGGGGCAGGG - Intergenic
970162723 4:13205365-13205387 CTCACATGGCAGAAGGGGCAGGG + Intergenic
970207533 4:13669837-13669859 CTCATGTGACAGAAGGGACAAGG + Intergenic
970237712 4:13975403-13975425 CTCACATGGCGAAAGGGGAAGGG + Intergenic
970367353 4:15373245-15373267 CACACATGACAGAAGGGTAGAGG + Intronic
970408871 4:15788421-15788443 CTCCCAGGACTGAAGGTGCATGG - Intronic
970471347 4:16382231-16382253 TTCACATGGCAAATGGGGCAAGG - Intergenic
970550677 4:17177967-17177989 CTCACATGGAGGAAGGGGCAAGG + Intergenic
970559067 4:17265189-17265211 CTCACAAGGTGGAAGGGGCAAGG + Intergenic
970726651 4:19053740-19053762 CTTACATGGTAGAAAGGGCAAGG - Intergenic
970732068 4:19117463-19117485 CTCACATAGCAGAAGGGACAAGG + Intergenic
970964562 4:21913397-21913419 CTCACATGGCAGAAGGCAGAAGG - Intronic
971047178 4:22817783-22817805 CTCATATGGCAGAAGGGGCCAGG - Intergenic
971112612 4:23605880-23605902 CTCACATGGTGGAAGGGACAAGG + Intergenic
971246684 4:24935582-24935604 CTCACGTGATGGAAGGGGCAAGG - Intronic
971272749 4:25166045-25166067 CTCACATGGCAGAAGGTGGAAGG - Intronic
971412696 4:26391989-26392011 CTCACATGGCAGGAGGGACAAGG + Intronic
971504047 4:27347419-27347441 CTCATATGGCAGAAGGAGCAAGG + Intergenic
971515330 4:27479140-27479162 CTCACATGAGGGAAGGGGCAAGG - Intergenic
971520579 4:27545871-27545893 CTCACATGGCAGAAGGCAGAAGG + Intergenic
971536784 4:27762350-27762372 CTCATATGGCACAAGGAGCAAGG + Intergenic
971582616 4:28361954-28361976 CGCACATGGCAGAAGAAGCAAGG - Intergenic
971592349 4:28484273-28484295 CTCACATGTTGGAAGGGTCAAGG - Intergenic
971599583 4:28575321-28575343 CTCACATGGCAGAAGGGGAGAGG + Intergenic
971822775 4:31580233-31580255 CTCACATGAAGTAAGGGGCAGGG - Intergenic
971945671 4:33273530-33273552 CTCACATGGCAGAAGGTGGAAGG - Intergenic
971996524 4:33972554-33972576 CTCACATGACAGAAGGCAGAAGG - Intergenic
972097806 4:35370141-35370163 CTCACATGACATAAGGGGTAAGG + Intergenic
972142310 4:35976096-35976118 CTCACATGGCAGAAGGGGCAAGG + Intronic
972161573 4:36234300-36234322 CTCACATGGCAGAAGGGCAAGGG + Intronic
972563473 4:40248963-40248985 ATGACATGACAGAGGGGACAGGG + Intergenic
972803755 4:42506303-42506325 CTCACATGGTAGAAGGGGCAAGG - Intronic
972887225 4:43507615-43507637 CTCACATGGCAGATGAGGAAAGG - Intergenic
972990453 4:44817206-44817228 CTCACATGGTGGAAGGGGCAAGG + Intergenic
973009910 4:45060280-45060302 CAATCATGACAGAAGGGGAAGGG + Intergenic
973063625 4:45761576-45761598 CCCACATGACAGAAATGGCAGGG - Intergenic
973199924 4:47488870-47488892 CTCCCATGGTGGAAGGGGCAAGG - Intronic
973627283 4:52785425-52785447 CTCACATGGCAGAAGGGGCCAGG - Intergenic
973659571 4:53089002-53089024 CTCACATGATAGAAGAAGTAGGG - Intronic
974469080 4:62295919-62295941 CTCACATGGTAGAAGGTGAAGGG + Intergenic
974492539 4:62585658-62585680 CTCATGTTGCAGAAGGGGCAAGG - Intergenic
974658388 4:64854900-64854922 CTAACATGGTGGAAGGGGCAAGG + Intergenic
974677409 4:65111419-65111441 CTCACATGGCAGATGGGATAAGG - Intergenic
975028724 4:69585763-69585785 CTCACATGGTAGAAGTGGAATGG + Intergenic
975213206 4:71724709-71724731 CTCACATGGCAGGAGAGACAAGG + Intergenic
975313782 4:72929867-72929889 TTCCCTTGACATAAGGGGCATGG + Intergenic
975409023 4:74026174-74026196 CTCACATGGTGGATGGGGCAAGG - Intergenic
975421862 4:74174101-74174123 CTCACATGGCAGAAGGCACAAGG + Intronic
975531831 4:75407466-75407488 CTCACATGGTGGAAGAGGCAAGG + Intergenic
975684946 4:76910456-76910478 TTTACATGATAGAAGGGGCAAGG + Intergenic
975713927 4:77187689-77187711 CTCACATGGTAAAAGGAGCAGGG - Intronic
975740897 4:77427837-77427859 CTCACATGGCAGAAGGTAGAGGG + Intronic
975823644 4:78296753-78296775 AACACAAGACAGAAGGGGGAAGG - Intronic
976189875 4:82477680-82477702 TTCCCCTGACATAAGGGGCATGG - Intergenic
976334697 4:83871822-83871844 CTCACATGGTAGAAGGGGCAAGG + Intergenic
976425732 4:84901077-84901099 CTCACATGGCAGAAGGCGAAAGG + Intronic
976493870 4:85703584-85703606 CTCACATGGCAGAAGAGGCAAGG - Intronic
977358141 4:95972101-95972123 CTCACATGACTGAATGGATAAGG + Intergenic
977421311 4:96803318-96803340 CTCACATGGCAGAAGGGACAAGG - Intergenic
977490702 4:97706420-97706442 CTCACATGGCAGAAGGGCAAAGG - Intronic
977540068 4:98306364-98306386 CTCACATGACAGAAGGTGGAAGG + Intronic
977617979 4:99106421-99106443 TTCCCTTGACATAAGGGGCATGG + Intergenic
977651281 4:99472628-99472650 CTCACATGACAGAGTGTGGAAGG + Intergenic
977748463 4:100579857-100579879 CTCACATGGCAGAAGGGGCAAGG - Intronic
977748600 4:100581002-100581024 CTCACATGGCAGAAGGAGCAAGG - Intronic
977756548 4:100678381-100678403 TTCACATGGCAGAAAGGACAAGG + Intronic
977880498 4:102198949-102198971 CTCACATGGCAGAAGGGATAAGG + Intergenic
977954360 4:103010303-103010325 CTCACATGGCAGAAGGTATAAGG + Intronic
978050347 4:104191107-104191129 CTCACATGGTAGAAGGGACAAGG + Intergenic
978099138 4:104815269-104815291 CTCACATGACAGAAGGTGGAAGG - Intergenic
978138224 4:105289284-105289306 CTCAGATGCCAGTAGTGGCAGGG + Intergenic
978365770 4:107979729-107979751 CTCACGTGATAGAAGGGACAAGG - Intergenic
978494964 4:109348800-109348822 CTCACATGGTGGAAGGGGCAAGG - Intergenic
978586770 4:110282527-110282549 TTCCCATGCCATAAGGGGCATGG + Intergenic
978909590 4:114048477-114048499 TTCCCTTGACATAAGGGGCACGG - Intergenic
978964443 4:114724597-114724619 CTCACATGGCAGAAGGGAGGAGG - Intergenic
979157254 4:117412019-117412041 CTCACAGGGCTAAAGGGGCAGGG - Intergenic
979174392 4:117644497-117644519 CTCACATGGCAGAAGGGGCAAGG + Intergenic
979262576 4:118665805-118665827 CACTCATGGCAGAAGGGGAAGGG + Intergenic
979366503 4:119830799-119830821 TTCACATGGTAGAAGGGGTAAGG - Intergenic
979418214 4:120469836-120469858 CTCACATGGCAGAAGGCAGAAGG - Intergenic
979471359 4:121101339-121101361 CTCACATGGAAGAAGGTGGAAGG - Intergenic
980174844 4:129332202-129332224 CTCACATGGCAGAAGGGGTGAGG - Intergenic
980196757 4:129599468-129599490 GTCACATGACTGAAGGAGCAAGG + Intergenic
980206714 4:129729125-129729147 CTCACATGGAGGAAGAGGCAAGG - Intergenic
980267118 4:130531201-130531223 CTCAGATGACGGAAGAGGCAAGG + Intergenic
980269172 4:130562296-130562318 CACTCATGGCAGAAGGGGAACGG - Intergenic
980310973 4:131128414-131128436 CTCACATGGCCGAAGGAGGAAGG - Intergenic
980444242 4:132885799-132885821 TTCCCTTGACATAAGGGGCATGG - Intergenic
980614584 4:135202325-135202347 CTCACATGGAGGAAGGGGCAAGG - Intergenic
980646361 4:135646845-135646867 CTCACATGGGAGAAATGGCAGGG - Intergenic
980763910 4:137273346-137273368 CTCACATAGCAGAAGGTGAAAGG + Intergenic
980972149 4:139576794-139576816 CTCACATGGCAGAAGGGGTATGG + Intronic
981038743 4:140199921-140199943 CTCACATGGTGGAAGGGGTAAGG + Intergenic
981052371 4:140321982-140322004 CTCACATGGCAGGAGGTGGAAGG - Intronic
981157141 4:141451807-141451829 CTTACATGGAAGAAGGGGCAGGG + Intergenic
981244010 4:142513370-142513392 CTCACATGGTAGGAGGGGCAAGG + Intronic
981248359 4:142567341-142567363 CTGACAGGAAAGGAGGGGCAGGG + Intronic
981274988 4:142888736-142888758 CTCACATGGCAGAAGGGGCAAGG - Intergenic
981301573 4:143192642-143192664 CTCACTTGGCAGAAAGAGCAGGG + Intronic
981356238 4:143792530-143792552 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981367765 4:143923164-143923186 CTCACATGGCAGAAGAAGGAAGG - Intergenic
981377556 4:144033412-144033434 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981535072 4:145791254-145791276 CTCACATGGCAGAAGAGGCAAGG + Intronic
981698358 4:147581523-147581545 CTCACATGGCAGAAGGTGGAAGG - Intergenic
981796756 4:148604470-148604492 ATCCCATGACAGAAGGAGGAAGG - Intergenic
982113458 4:152077090-152077112 CTCACATGGCAGAAGGGACCAGG - Intergenic
982219368 4:153111682-153111704 CTCACCTGGTAGAAGGGGCCAGG - Intergenic
982256363 4:153455200-153455222 CTCACATTGTAGAAGAGGCAAGG - Intergenic
982556782 4:156876534-156876556 TACACATGACTGCAGGGGCAGGG + Intronic
982617507 4:157658867-157658889 CTCACATGGTAGAAGAGGCCAGG + Intergenic
982743198 4:159079330-159079352 CTCACATGGTGGAAGGGGCAAGG - Intergenic
982951191 4:161698140-161698162 CTCACATGGCAGAAGGCAGAAGG - Intronic
982980507 4:162128457-162128479 CTCACATGGTGGAAGGGGCAAGG - Intronic
983477061 4:168226418-168226440 CTCACATGGTGGAAGGGGCAAGG - Intronic
983480150 4:168263654-168263676 CTCACATGGCAGAAGGGACAGGG - Intronic
983500635 4:168495390-168495412 CTCACATGGCAGAAGGTGGAAGG - Intronic
983656294 4:170088842-170088864 CTCACGTGGCAGAAGGGCCAAGG - Intronic
983666992 4:170193538-170193560 TTCCCTTGACATAAGGGGCATGG + Intergenic
983842625 4:172476260-172476282 CTAACATGGCAGAAGGAGCAAGG + Intronic
983849687 4:172565084-172565106 CTCACATGGAAGAAGGGGCAAGG + Intronic
983850025 4:172569273-172569295 TTCACATGATGGAAAGGGCAAGG + Intronic
983906640 4:173190078-173190100 GTAACAAGAGAGAAGGGGCATGG - Intronic
983972741 4:173894487-173894509 CTCACATGGCAGAAGGCAGAAGG - Intergenic
984031782 4:174613069-174613091 CTATCATGACAGAAGGTGAAAGG + Intergenic
984045727 4:174796180-174796202 CTCACATGGTGGAAGGGGCAAGG - Intronic
984176903 4:176430308-176430330 CTCACCTGGCAGAAGGGAAAAGG - Intergenic
984435962 4:179710427-179710449 CTCACATGGCAGAAGGGGCAAGG + Intergenic
984468888 4:180140071-180140093 TTCACATGATAGAAGGAGCAAGG + Intergenic
984633227 4:182082250-182082272 CTCACATGGCAGAAAGAGCAAGG + Intergenic
984723781 4:183001057-183001079 TTCCCTTGACATAAGGGGCATGG - Intergenic
984863383 4:184259180-184259202 CTCACATGGCAGAAGGGGCAAGG - Intergenic
984900647 4:184583223-184583245 CTCACATGGCAGAAGGCAGAAGG - Intergenic
984942223 4:184943027-184943049 CAAACATGATGGAAGGGGCAGGG + Intergenic
984983194 4:185302621-185302643 CTCACATGGCAGAAGGTGCAAGG - Intronic
985074914 4:186204822-186204844 CCCACCTGACAGATGGGGGAAGG + Intronic
985254738 4:188058480-188058502 CTCACATGGCAGAAGGCAGAAGG + Intergenic
985745102 5:1642403-1642425 CTCACATGGCGGACGGGGGAGGG + Intergenic
986174296 5:5338892-5338914 CTCACATGGCCGAAGGGGCAAGG - Intergenic
986613864 5:9597029-9597051 CTCCGAAGACAGCAGGGGCATGG + Intergenic
987096191 5:14552581-14552603 CTCACGTGGCAGAAGGGGTGAGG - Intergenic
987544177 5:19290886-19290908 TTCACATGACAGAAAGGACAAGG + Intergenic
987571062 5:19659709-19659731 CTCACATGGCAGAAGGCAGAAGG - Intronic
987700352 5:21390173-21390195 CTCACATGGCAGAAGGGGCAAGG - Intergenic
988133523 5:27137591-27137613 CTGCCATGAAAGAAGGGGCTAGG - Intergenic
988442979 5:31253136-31253158 CTCACATGCCAGAAGGGGTCAGG + Intronic
988457058 5:31395728-31395750 TTCCCTTGACATAAGGGGCATGG + Intergenic
988514849 5:31895375-31895397 CTCACATGACAGAGGAGATAAGG - Intronic
988545764 5:32156096-32156118 CTCACATGGCAGAAGGGCATAGG - Intronic
988588498 5:32528661-32528683 CTCACAAGGCAAAAGGGGCAAGG - Intergenic
988752056 5:34197892-34197914 CTCACATGGCAGAAGGGTCAAGG + Intergenic
988821227 5:34888122-34888144 CTCACATGGTGGAAGGGGCAAGG - Intronic
988858139 5:35249065-35249087 CTCACATGGCAGAAGGAGCAAGG + Intergenic
989098548 5:37803457-37803479 CTCACTTGATGGAAGGGGCAAGG - Intergenic
989340557 5:40369438-40369460 CTCACATGAAAGAAGGTGGAAGG + Intergenic
989381335 5:40812368-40812390 CTCACATGGTAGAAGAGGTAAGG + Intergenic
989450134 5:41577229-41577251 TTCACATGGTGGAAGGGGCAAGG + Intergenic
989703439 5:44298317-44298339 CTCAGATGACAGAAGGGAGGAGG - Intergenic
989753781 5:44926216-44926238 CTCACATGGCAGAAAGGGCCAGG - Intergenic
989980478 5:50637729-50637751 CTCACATGGTGGAAGGGACAAGG - Intergenic
990164724 5:52981920-52981942 CTCACATGACAAAAGATGCAAGG + Intergenic
990500884 5:56396275-56396297 CTCACATGTCAGAAGGGGCCAGG + Intergenic
990532043 5:56683814-56683836 TTCACATGGCAGAAGGGGCAAGG - Intergenic
990559256 5:56967153-56967175 CTCAAATGGTAGAAGGGACAAGG - Intronic
990700164 5:58466498-58466520 CTCACATGGTGGAAGGGGCAAGG - Intergenic
990755693 5:59066824-59066846 CTCACATGGTGGAAGGGGCAAGG - Intronic
990806224 5:59665804-59665826 CTCACTTGGAAGAAGGGGCAAGG - Intronic
991036655 5:62134407-62134429 CTCACATGGTGAAAGGGGCAAGG + Intergenic
991190621 5:63868764-63868786 CTCACATAACAGAAGGGTAAAGG - Intergenic
991194478 5:63916668-63916690 CTCACATGGCAGAAGGTGAAAGG - Intergenic
991221526 5:64224900-64224922 CTCACATGGCAGAAGGTGGAAGG - Intronic
991349150 5:65702597-65702619 CTCACATGGCAAGAGGGACAGGG + Intronic
991357517 5:65784534-65784556 CTCACATGGCAGAAGGGGGAAGG + Intronic
991445254 5:66692777-66692799 CTCACTTGGTGGAAGGGGCAAGG + Intronic
991671348 5:69051271-69051293 CTCACATGGTGGAAGGGGCAAGG - Intergenic
991739821 5:69658708-69658730 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991757678 5:69894469-69894491 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991791396 5:70238449-70238471 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991819284 5:70534833-70534855 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991837081 5:70770351-70770373 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991883845 5:71238791-71238813 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991953712 5:71971732-71971754 CTCACATGGGGGAAGGGGCAGGG + Intergenic
991972355 5:72153267-72153289 CTCACATGAGAGAGCGGGGAGGG + Intronic
992157934 5:73973074-73973096 CTCACATGGCAGAAGGGGCAAGG + Intergenic
992476278 5:77104502-77104524 CTCACATGGCAGAAGGCAGAAGG - Intergenic
992485924 5:77195200-77195222 CTCACATGGCAGAAGGCAGAAGG + Intergenic
992501062 5:77344550-77344572 CTCACATGGCAGAAAGTGCAAGG + Intronic
993023364 5:82618485-82618507 CTCACATGGCAGAAGGTTGAAGG + Intergenic
993309138 5:86307061-86307083 CTCACACGGTAGAAGGGGCTAGG + Intergenic
993701418 5:91123429-91123451 CTCACATGGCAGAAGAGCAAAGG + Intronic
993748291 5:91630239-91630261 CTCACATGGCAGAGGGTGAAAGG - Intergenic
993978354 5:94511092-94511114 CTCATGTGGTAGAAGGGGCAAGG - Intronic
994015748 5:94962988-94963010 CTCACATGGCAAAAGGTGAAAGG + Intronic
994260713 5:97655421-97655443 CTCACGTGGCAGAAGGGACAAGG - Intergenic
994663193 5:102677347-102677369 CTCACATGGTGAAAGGGGCAAGG - Intergenic
994665930 5:102705237-102705259 CTCATATGGCAGAAGGAGGAAGG - Intergenic
994690295 5:103010457-103010479 CTGAGAAGACAGAAGGGCCATGG - Intronic
994699310 5:103113408-103113430 TTCACATGAGGGAAGGGGAAAGG + Intronic
994719643 5:103366048-103366070 CTCACTGGACAGAAGGGTCCAGG + Intergenic
994979013 5:106848331-106848353 GACACATGACAGAAGTGGCAAGG - Intergenic
995058380 5:107787577-107787599 CTCACATGGCGAAAGGGGCAAGG - Intergenic
995058582 5:107789314-107789336 CTCACATGGTGGAAGGGACAAGG - Intergenic
995484025 5:112620786-112620808 CACTCATGACAGAAGGGGAGAGG + Intergenic
995593058 5:113719787-113719809 CTCACATGGCAGAAGGTAAAAGG - Intergenic
995755486 5:115499197-115499219 CTCACATGGCAGAAGGGGTGAGG + Intergenic
996182191 5:120432577-120432599 CTCACATGGCAGAAGGTGGAAGG - Intergenic
996478406 5:123947199-123947221 TTCACATGAAAGAACAGGCAAGG + Intergenic
996590404 5:125140460-125140482 CTCACATGACTGAAGGGCAAGGG + Intergenic
996643693 5:125790215-125790237 CTCACATGGCTGAAGGAGAAGGG - Intergenic
996647470 5:125833936-125833958 CTCACATAATAGAAGGTGGAAGG + Intergenic
996859876 5:128053268-128053290 TTTCCATGACAGGAGGGGCAGGG + Intergenic
996999393 5:129741213-129741235 CTGACATGGCAGAAGGGGTAAGG + Intergenic
997023131 5:130025697-130025719 CTCCCATAGCAGAAGGGCCAGGG + Intronic
997107835 5:131041533-131041555 CTCACATGGTAGAAAGGGCAAGG - Intergenic
997110117 5:131065640-131065662 CAATCATGACAGAAGGGGAAGGG - Intergenic
997559956 5:134837636-134837658 CTCACATGGCAGAAGGGGCAAGG - Intronic
997909389 5:137854963-137854985 CTCACATGGTAGAAGGGGCAAGG - Intergenic
998071430 5:139200866-139200888 CTTCCACGGCAGAAGGGGCAAGG - Intronic
998389539 5:141778722-141778744 CTAACCTGAGGGAAGGGGCATGG - Intergenic
998389775 5:141780126-141780148 CTAACCTGAGGGAAGGGGCATGG - Intergenic
998766269 5:145491292-145491314 CTCACATGGTGGAAGGGCCAAGG + Intronic
999198660 5:149800668-149800690 GTCATGTGACAGATGGGGCAGGG + Intronic
999499613 5:152133582-152133604 CACACATGACAGAAGGAAAAAGG + Intergenic
999805806 5:155080224-155080246 TTCCCATGGCAGAAGAGGCACGG + Intergenic
999895446 5:156027941-156027963 CTCATATGGCAGAAGGTGGAAGG + Intronic
999897853 5:156053892-156053914 CCCACATGGTGGAAGGGGCAAGG + Intronic
1000013603 5:157257439-157257461 CTCATATGGCAGAAGGGTAAAGG - Intergenic
1000308381 5:160017384-160017406 CCTACATGGCAGCAGGGGCAGGG + Intronic
1000423410 5:161062620-161062642 CTCACATGGCGGAAGGGGCAAGG - Intergenic
1000424974 5:161079913-161079935 CAATCATGACAGAAGGGGAATGG - Intergenic
1000927644 5:167213385-167213407 CTCACCAGGCAGAAGGGGTAAGG + Intergenic
1001117276 5:168950201-168950223 CTCACATGGAGGAAGGGACAAGG - Intronic
1001154377 5:169260357-169260379 GCCACATCACAGAAAGGGCAAGG + Intronic
1001541031 5:172539530-172539552 ATCACATGGCAGAACGGGCAAGG - Intergenic
1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG + Intronic
1001710796 5:173776331-173776353 CTCACATGGCAGAAGAGGCCAGG - Intergenic
1001814268 5:174654921-174654943 CTCACATGGCAGAAGGCGGAAGG - Intergenic
1001836827 5:174839679-174839701 CTCACATGGCGGAAGTGGCAAGG - Intergenic
1001947233 5:175789838-175789860 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1002065211 5:176648239-176648261 CTGACCTGCCAGGAGGGGCAGGG + Intronic
1002102923 5:176866241-176866263 CTCACATCAAAGATGGGGTAGGG + Intronic
1002381847 5:178836307-178836329 CTTGCATGGCAGAAGGGGCAAGG + Intergenic
1002400599 5:178989724-178989746 CTAACAGGAAAGAAGGAGCAGGG - Intronic
1002579932 5:180201816-180201838 CTCACATGGAGGAAGGGACAAGG - Intronic
1002592136 5:180298174-180298196 CTCACATGGCAGAAGGGACAAGG - Intergenic
1002613969 5:180438905-180438927 TTCTCATGGCAGAAGGGGCAAGG - Intergenic
1002737275 5:181404383-181404405 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1003118588 6:3300476-3300498 CTCACATGAGGGAAGGGGCAAGG - Intronic
1003183465 6:3811133-3811155 CTCACATGGGAGAAGGTGAAAGG - Intergenic
1003251274 6:4430967-4430989 CTCACATGGTGGAAGAGGCAAGG - Intergenic
1003318783 6:5034603-5034625 CGCTCATGGCAGAAGGCGCAGGG - Intergenic
1003349973 6:5307305-5307327 CTCAAATGAAAGAAGAGGCCTGG - Intronic
1003682709 6:8271773-8271795 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1003692056 6:8364724-8364746 CTCATATGGAAGAAGGGGCAAGG - Intergenic
1003692064 6:8364772-8364794 CTCATATGGAAGAAGGGGCAAGG - Intergenic
1003692070 6:8364807-8364829 CTCATACGGAAGAAGGGGCAAGG - Intergenic
1003798780 6:9637583-9637605 GTCACATGACAAAAAAGGCAGGG - Intronic
1003864040 6:10347557-10347579 CTCACATGGTGGAAAGGGCAAGG + Intergenic
1003877041 6:10447080-10447102 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1003878913 6:10462777-10462799 CTTACATGGCAGAAGAGCCAAGG + Intergenic
1003983572 6:11412902-11412924 GTCTGATGACAGGAGGGGCATGG + Intergenic
1004371763 6:15058943-15058965 CTCAAATGTCAGAAGGAGCAAGG + Intergenic
1004472072 6:15938414-15938436 CTAACATGGTAGAAAGGGCAAGG - Intergenic
1004522674 6:16377083-16377105 CTCACATGGTGGAAGGAGCAAGG - Intronic
1004791100 6:19027417-19027439 TTCACATGGCAGAAGGAGCAGGG - Intergenic
1004792983 6:19049792-19049814 CTCACATGATATAAGGTGGAAGG - Intergenic
1005323632 6:24679044-24679066 TTCCCTTGACATAAGGGGCATGG + Intronic
1005550217 6:26904606-26904628 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1005904882 6:30253590-30253612 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1006698095 6:35948913-35948935 CCCACATGGCAGAAGGTGGAAGG - Intronic
1006761252 6:36463650-36463672 CTCACATGATGGAAGGAGAAGGG - Intronic
1006826250 6:36938464-36938486 CTCACATTGCAGAAGGGGAGTGG + Intergenic
1006869025 6:37233480-37233502 CTCACATGGGAGAAGGTGGAAGG + Intronic
1007076444 6:39070034-39070056 CTCACATCACAGAAGGCAAAAGG + Intronic
1007116445 6:39346405-39346427 CTCACATGGTGGAAGGGGCAAGG - Intronic
1007159997 6:39782595-39782617 TTCACATGGCAGAAGGTGAAGGG + Intergenic
1007238582 6:40408971-40408993 CTCACATGGCAGCAGTGGAAGGG + Intronic
1007275391 6:40669565-40669587 CTCACGTGGCAGAAGGTGGAAGG - Intergenic
1007295913 6:40820388-40820410 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1007519378 6:42439654-42439676 CTCACATGGCGGAATGGGCCAGG - Intronic
1007928354 6:45668314-45668336 CTCACATGGCAGAAGGTGAAAGG + Intergenic
1008158507 6:48047728-48047750 CTCACATGATAGAAGGGGCAAGG - Intronic
1008170603 6:48201185-48201207 CTGAAATGCCTGAAGGGGCATGG + Intergenic
1008523923 6:52388577-52388599 CTCACATGGCAGAAGAGGCAAGG - Intronic
1008582340 6:52918317-52918339 TTCCCTTGACATAAGGGGCATGG + Intergenic
1008614808 6:53216465-53216487 CTCACATGGCAGAAGGGGCAGGG - Intergenic
1008668236 6:53738759-53738781 CTCACATGGTGGAAGGGGAAAGG + Intergenic
1008764870 6:54899642-54899664 TTCAGATGAGAGAAGGGGCGGGG + Intronic
1009026190 6:58003080-58003102 CTCACAAGGCAGAAGGGCAATGG - Intergenic
1009201739 6:60754553-60754575 CTCACAAGGCAGAAGGGCAAGGG - Intergenic
1009336902 6:62502325-62502347 CTCACATGGTAGAAGGGGCGAGG - Intergenic
1009338706 6:62526913-62526935 CTCATATGGTGGAAGGGGCAAGG - Intergenic
1009389226 6:63125779-63125801 CAATCATGACAGAAGGGGAAGGG - Intergenic
1009394824 6:63187488-63187510 CTTGCATGGCAGGAGGGGCAAGG - Intergenic
1009580721 6:65529802-65529824 CTCACATGATGGAAAGAGCAAGG - Intronic
1009845168 6:69125490-69125512 TTCACATGGCAGAAGGGGCAAGG - Intronic
1010056107 6:71567062-71567084 CTCACATGGCAGAAAGGGTGAGG - Intergenic
1010162973 6:72880346-72880368 CTCACATGGTGGAAGGGGCGAGG + Intronic
1010247451 6:73674777-73674799 TTCACATGATAGAAGGGGCAAGG - Intergenic
1010628309 6:78166588-78166610 CTCACATGAAAGAAGGGATAAGG + Intergenic
1010731026 6:79391512-79391534 CTCACATGATGGAAGGGGCAAGG + Intergenic
1010986965 6:82435696-82435718 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1011068748 6:83359105-83359127 CTCACATCCCAGACAGGGCAGGG + Intronic
1011072736 6:83403441-83403463 CTCACATGAGGGAAAGGGAAAGG + Intronic
1011076805 6:83447056-83447078 TTCCCTTGACATAAGGGGCATGG - Intergenic
1011189747 6:84716573-84716595 TTCCCTTGACATAAGGGGCATGG + Intronic
1011220824 6:85052880-85052902 CACTCATGACAGAGGGGGAAGGG + Intergenic
1011297199 6:85838557-85838579 CTCACATCCCAGATGGGGCGGGG - Intergenic
1011352803 6:86441162-86441184 CTCACATAGTAGAAGGGGCAGGG - Intergenic
1011539824 6:88417492-88417514 TTCCCTTGACATAAGGGGCATGG + Intergenic
1011574916 6:88786940-88786962 CCCACATGGCAGAAGGGGCAAGG - Intronic
1011890328 6:92151244-92151266 CTCATATGGCAGAAGAGGCAAGG + Intergenic
1012443227 6:99281664-99281686 CTCACATGGTAAAAGGGGGAAGG - Intronic
1012541678 6:100368511-100368533 CTAGCATGGCAGAATGGGCAAGG - Intergenic
1012599618 6:101079063-101079085 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1013014639 6:106150175-106150197 CTCACATCAGAAAAAGGGCAGGG + Intergenic
1013090888 6:106899984-106900006 CTCACATGGACAAAGGGGCAAGG + Intergenic
1013227239 6:108128874-108128896 CTCTCATGGCAGAAGGTGAAAGG - Intronic
1013675694 6:112459389-112459411 CTCATATGGTAGAAGGGACAAGG - Intergenic
1013688307 6:112610754-112610776 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1013693299 6:112670321-112670343 CTCACATGGTGAAAGGGGCAAGG + Intergenic
1013786712 6:113789448-113789470 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1013832588 6:114292320-114292342 CTCACGTGGCAGAAGGTGGAAGG + Intronic
1013850107 6:114504051-114504073 CTCACATGGCAGAAGTTGGAAGG + Intergenic
1014008132 6:116444707-116444729 CTCACATGTTGGAAGGGACAAGG - Intergenic
1014775907 6:125509625-125509647 CTCACGTGGTGGAAGGGGCAGGG - Intergenic
1014808942 6:125863799-125863821 CTCACATGGTAGAAGGGTGAGGG + Intronic
1015004770 6:128265945-128265967 CTCACAGTGCAGAAGAGGCAAGG - Intronic
1015019416 6:128454117-128454139 CTCACTTGGCTGAAGGGGCAAGG - Intronic
1015119314 6:129684125-129684147 CTCAGATGTCAGGAGTGGCAAGG + Intronic
1015187093 6:130430219-130430241 CTCACATGGTAGAAGGGGGAAGG + Intronic
1015210112 6:130687249-130687271 CTCACATGGCAGAAGGCACCAGG + Intergenic
1015494794 6:133869233-133869255 CTCATGAGGCAGAAGGGGCAAGG - Intergenic
1015797249 6:137025316-137025338 CTCACATGTTGGAAGGGGCAAGG - Intronic
1015971755 6:138749359-138749381 CTCATATGACAGAAGGAACAAGG - Intergenic
1015977028 6:138800969-138800991 CTCACATGGCAGAAGGTGGAAGG + Intronic
1016026686 6:139294572-139294594 CTCACATGGCAGAGGGGTAAGGG - Intergenic
1016029403 6:139322312-139322334 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1016343216 6:143084292-143084314 CTCCCTTGACATAAGGGGCATGG + Intronic
1016587536 6:145706991-145707013 CTCACATGGCAGAGGGGAAAAGG - Intronic
1016753454 6:147657732-147657754 CTCACATGGTAGAAGGGGCATGG + Intronic
1016782208 6:147971685-147971707 TTTACATGGCAGAAGGGGCAAGG - Intergenic
1016876572 6:148871187-148871209 CTCACATGACAGAAAGAGAGGGG - Intronic
1016881321 6:148915022-148915044 CTCACATGGTGGAGGGGGCATGG + Intronic
1016904640 6:149136765-149136787 CTCACATGGCAGAAGGGGAAGGG + Intergenic
1017054231 6:150423698-150423720 CCCGCATGGTAGAAGGGGCAGGG + Intergenic
1017187488 6:151616810-151616832 CTCACATGGTGGAAGGAGCAAGG + Intronic
1017282706 6:152640729-152640751 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1017284273 6:152656596-152656618 CTCACATGATGGTAGGGACAAGG + Intergenic
1017852349 6:158315797-158315819 CTCACATGGTGGAAGGGGCAAGG + Intronic
1017904274 6:158746089-158746111 CTCCCATGGTAGAAGGGACAAGG + Intronic
1018082576 6:160271072-160271094 CTCACATGGCAGCAAGGGCGAGG - Intronic
1018127018 6:160691637-160691659 CTCACATGGCAGAAGGCAGAGGG - Intergenic
1018149540 6:160925443-160925465 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1018154071 6:160969253-160969275 CTCACCTGGTAGAAGGGGTAAGG - Intergenic
1018520573 6:164645655-164645677 CTCACATGGTGGAAGGGCCAAGG - Intergenic
1018687554 6:166315821-166315843 TTCCCTTGACATAAGGGGCATGG - Intergenic
1018750557 6:166800521-166800543 CTCACATGACAGGAGGTGGAAGG - Intronic
1018756730 6:166856314-166856336 CTCACGTGGTGGAAGGGGCAAGG - Intronic
1018975682 6:168563660-168563682 CTCATGTGGCAGGAGGGGCAAGG - Intronic
1019064482 6:169285220-169285242 CTCACTTGAGGCAAGGGGCAGGG + Intergenic
1019242370 6:170679939-170679961 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1020187791 7:5972072-5972094 CTCACGTGGCAGAAGGGACTCGG - Intergenic
1020220628 7:6233931-6233953 CTCACTTGGTGGAAGGGGCAAGG + Intronic
1020295125 7:6752698-6752720 CTCACGTGGCAGAAGGGACTCGG + Intergenic
1020508128 7:9019226-9019248 CTCCCTTGACATAAGCGGCATGG - Intergenic
1020570267 7:9851418-9851440 TTCAAATGACAGAAGGGGTAGGG - Intergenic
1020590941 7:10136220-10136242 CTCACATAGCAGAAAGGGCAAGG - Intergenic
1020679618 7:11220607-11220629 CTCACTTGGCAGAAAGGGCAAGG + Intergenic
1020847695 7:13307751-13307773 CTTACATGACAAGAGAGGCAAGG + Intergenic
1020981028 7:15069479-15069501 CTTACATGGCAGAAAGGGCGAGG + Intergenic
1021250924 7:18323959-18323981 CTCATATGACTGAAGGGGTGAGG + Intronic
1021267515 7:18543377-18543399 CTCAGAAGACAGAAGCAGCAGGG - Intronic
1021367734 7:19801660-19801682 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1021487965 7:21187707-21187729 CCTACATGGTAGAAGGGGCAAGG - Intergenic
1021561561 7:21972689-21972711 CTCCCAACTCAGAAGGGGCAGGG + Intergenic
1021608353 7:22432120-22432142 CTTACATGGCAGAAGGGGTGAGG - Intronic
1021976935 7:26020216-26020238 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1022610113 7:31862583-31862605 CTCACATGGCAGAAGAGGGAAGG + Intronic
1022767615 7:33431565-33431587 CCCACATGGTAAAAGGGGCAAGG - Intronic
1023213130 7:37829994-37830016 ATCACAAGACAGAAGGAGCCTGG - Intronic
1023235958 7:38087504-38087526 CTCACATGGTAGAATTGGCAAGG - Intergenic
1023384999 7:39647728-39647750 CTCACATGGTGGAAGGAGCAAGG - Intronic
1023641052 7:42258706-42258728 CTCACATGACAGAATGGGTGAGG + Intergenic
1023988875 7:45115990-45116012 CTCACATGGCAGAAGGAGAAAGG - Intergenic
1024009098 7:45252608-45252630 CTCACATGATGGAGGGGACAAGG + Intergenic
1024031957 7:45468867-45468889 CTCACATCATGGGAGGGGCAAGG - Intergenic
1024196304 7:47062253-47062275 CTCACGTGGTGGAAGGGGCAAGG - Intergenic
1024338994 7:48238150-48238172 CTCACGTGGTAGAAGGGGTAAGG + Intronic
1024588320 7:50859861-50859883 TCCACATGAAGGAAGGGGCAAGG - Intergenic
1024617682 7:51129305-51129327 CTCACATGGTGGAAGGGGCGGGG + Intronic
1024964647 7:55013193-55013215 CTCACATGGCAGAAGGACCAAGG - Intergenic
1025285530 7:57657543-57657565 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1025300613 7:57817229-57817251 CTCACATGGTAGAAGGTGGAAGG - Intergenic
1026534929 7:71231661-71231683 CTCACATGACAGATAGAGCAAGG + Intronic
1026884764 7:73933699-73933721 CTCAAATGGCAGAAAGGGGAGGG + Intergenic
1027154864 7:75759708-75759730 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1027418166 7:77994413-77994435 CTCACATGATGGAAGGTGGAAGG + Intergenic
1027566241 7:79798763-79798785 ATCCCATGACAGAAGGTGGAAGG + Intergenic
1027624994 7:80533663-80533685 CTCACTTGGCAGAAGGTGGAAGG - Intronic
1027950495 7:84808955-84808977 CTCACATGGCAGAAGGGACCAGG + Intergenic
1028629069 7:92913841-92913863 TTCACATGGCAGTATGGGCAAGG - Intergenic
1028766766 7:94568795-94568817 CACACATGGTGGAAGGGGCAAGG - Intergenic
1028882379 7:95894330-95894352 CTGATATGATAGAAGGGGCAAGG + Intronic
1029029698 7:97454587-97454609 CTCATATCACAGAAGGGGCAAGG - Intergenic
1029859019 7:103549314-103549336 CTCACATGGTGGAAGAGGCAAGG + Intronic
1029863148 7:103597242-103597264 CCCACAGGACAGGAGGGTCAGGG - Intronic
1030203449 7:106929063-106929085 CTCACATGGCAGAAGGGACAAGG + Intergenic
1030206300 7:106955368-106955390 CTCATATGACAGAAGGGGCAAGG - Intergenic
1030225837 7:107149500-107149522 CTCACATGGTGGAAGGGGCAAGG + Intronic
1030353177 7:108512975-108512997 CTTAGATGGCAGAAGGGGCAAGG - Intronic
1030577247 7:111304230-111304252 ATCTCATGACAGAAATGGCAAGG - Intronic
1030649564 7:112102606-112102628 CTCACATGTTGGAAAGGGCAAGG - Intronic
1030662364 7:112234403-112234425 TTTACATGGCAGAAGGGACAAGG + Intronic
1030843459 7:114382414-114382436 TTCCCTTGACATAAGGGGCATGG + Intronic
1030874802 7:114800551-114800573 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1031020240 7:116620120-116620142 CTCACATGATGGAAGGAACAGGG + Intergenic
1031185942 7:118480519-118480541 CTCACATGACAGAAGAAAGAAGG + Intergenic
1031471557 7:122174334-122174356 TTCCCTTGACATAAGGGGCATGG - Intergenic
1031555885 7:123175554-123175576 CTCACATGATGGAAGGGGCAAGG - Intronic
1031642135 7:124178343-124178365 CTCACGTGATAGAAGAAGCAAGG + Intergenic
1031681057 7:124675203-124675225 CTCATATGGTGGAAGGGGCAAGG - Intergenic
1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG + Intergenic
1031906656 7:127467207-127467229 CTCACATAGCAGAAGGGGCGAGG - Intergenic
1032197267 7:129796583-129796605 CTCCCAGGACAGAAGGGACAGGG - Intergenic
1032222968 7:130008175-130008197 CTCAAGGGCCAGAAGGGGCAGGG + Intergenic
1032932082 7:136684499-136684521 CTTACATGGAAGAAGGGGCAAGG + Intergenic
1033366524 7:140676207-140676229 ATCACATGGTAGAAGGGGTAAGG + Intronic
1033980217 7:147155214-147155236 CTCACATGGCAGAAGGCTCAAGG - Intronic
1034232057 7:149538105-149538127 CTTACATCACAGAAGGCACAAGG - Intergenic
1034249221 7:149675087-149675109 TTCCCTTGACATAAGGGGCATGG - Intergenic
1034278741 7:149837292-149837314 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1034642769 7:152617943-152617965 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1034688472 7:152994943-152994965 CTCACATGATGGAAGGGATATGG - Intergenic
1034888934 7:154822360-154822382 CTCACATGGTGGAAGGGGCAAGG + Intronic
1034922211 7:155092756-155092778 CTCACATGGCAGAAGGCAAAGGG - Intergenic
1034931910 7:155169502-155169524 CCCACATGTCTGCAGGGGCAGGG + Intergenic
1034999910 7:155604282-155604304 CTTACATGGCAGAAGGGACGTGG + Intergenic
1035360428 7:158309959-158309981 CTCATGTGGCAGACGGGGCAAGG - Intronic
1035505747 8:128215-128237 CACTCATGGCAGAAGGGGAAGGG - Intergenic
1035897735 8:3422904-3422926 CTCACATGGCAGAAGGAAAAGGG + Intronic
1036026967 8:4919838-4919860 TTCACATGAAAGAAGGTGAAAGG - Intronic
1036119413 8:5999516-5999538 CTCACATGGCAAAAGGGGTGAGG - Intergenic
1036161797 8:6395879-6395901 CTCACATGGCAGAAGGGACAAGG + Intergenic
1036180665 8:6581879-6581901 CTCACATGGCAGAAGGGGTGAGG + Intronic
1036436067 8:8734604-8734626 CTCACATGGTGGGAGGGGCAGGG - Intergenic
1036542329 8:9729120-9729142 CTCACTTGGCAGAAGGCGGAAGG + Intronic
1036591233 8:10170360-10170382 CTCACATCACAGAAGGCGCAAGG - Intronic
1037508866 8:19561651-19561673 AGTACATGGCAGAAGGGGCAGGG + Intronic
1037603520 8:20418873-20418895 CCCACATGCCGGAAGGGGCCAGG - Intergenic
1037728204 8:21501474-21501496 CTCACATGGCAGAAGGCAGAGGG - Intergenic
1038174375 8:25166746-25166768 CTCACATGGCAGAAAGGCCCAGG - Intergenic
1038282499 8:26178652-26178674 CTCACATGGATGAAGCGGCAAGG - Intergenic
1038298249 8:26316738-26316760 TTGACATGATAGAAGGGACAAGG + Intronic
1038348043 8:26750158-26750180 CTCAGATAGCAGAAGGGACAAGG + Intronic
1038381272 8:27096605-27096627 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1038475682 8:27865327-27865349 CTCACATGACAGAAGAGGGGAGG + Intergenic
1038819645 8:30940711-30940733 ATCACATGACAGAAGGTCAAAGG + Intergenic
1038926872 8:32150502-32150524 CTCACATGGCAGAAGCAGAAGGG - Intronic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1039094010 8:33863856-33863878 CTCACATGGTGGAAGAGGCAAGG - Intergenic
1039099745 8:33928488-33928510 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1039141237 8:34391012-34391034 GTCACATGATAGAATGAGCAAGG + Intergenic
1039377060 8:37045160-37045182 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1039567625 8:38562812-38562834 CTCATATAACAGAAAGGGAAGGG - Intergenic
1039626710 8:39061692-39061714 ATCACATGACGGAAGGTGGATGG + Intronic
1039722967 8:40184662-40184684 CTCACATGGTGGAAAGGGCAAGG - Intergenic
1040071813 8:43194815-43194837 CTCACATGGTAGAAGAGGCAAGG - Intronic
1040433644 8:47368115-47368137 CTCACATGGTGGAAGGGACAAGG + Intronic
1040527715 8:48239246-48239268 TTCCCTTGACATAAGGGGCATGG + Intergenic
1040539773 8:48342142-48342164 CTCACTTGGTAGAAGGGGAAAGG - Intergenic
1040655512 8:49502981-49503003 CTCACATGGTAGGAAGGGCAAGG - Intergenic
1040673242 8:49717616-49717638 CTCACATGGCAGATGGGGCAAGG - Intergenic
1041036790 8:53799800-53799822 CTCAGATGGCAGAGGGGACAGGG - Intronic
1041257626 8:55992792-55992814 CTCACATGGAAGAAGGTGGAAGG + Intronic
1041258213 8:55997492-55997514 CTCACGTGGTGGAAGGGGCAAGG + Intronic
1041403663 8:57472474-57472496 CTCACATGGCAGAGGGTGGAAGG + Intergenic
1041422893 8:57689353-57689375 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1041454716 8:58045956-58045978 TTCACAAGGCAGAAGGGACAAGG + Intronic
1041663832 8:60423609-60423631 TTCCCTTGACATAAGGGGCATGG + Intergenic
1041716935 8:60941022-60941044 CTCACATGGAAGAAGGGCCATGG + Intergenic
1041815171 8:61962299-61962321 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1041871155 8:62635643-62635665 TTCACATGACAGGAGGGGCAAGG - Intronic
1041872602 8:62652041-62652063 CATACATGGCAAAAGGGGCAAGG + Intronic
1041931381 8:63291265-63291287 CTCACGTGACAGAAGAGGTCAGG + Intergenic
1042045936 8:64651695-64651717 CTCATATGGCAGAAGAGGTAAGG - Intronic
1042056150 8:64766690-64766712 TTCCCTTGACATAAGGGGCAAGG - Intronic
1042058780 8:64794560-64794582 CTCACATGGACAAAGGGGCAAGG + Intronic
1042096381 8:65220360-65220382 CTCACACGGCAGAAGGTGGAAGG - Intergenic
1042411413 8:68470746-68470768 CTCACATGGTGGAAGGGGCAAGG + Intronic
1042474687 8:69233818-69233840 CTCACATGACAGAGGGCAGAAGG + Intergenic
1042870200 8:73391139-73391161 CTCACATGGTGAAAGGGGCAAGG - Intergenic
1043011649 8:74888506-74888528 CTTACATGGTGGAAGGGGCAAGG + Intergenic
1043143631 8:76623162-76623184 TTCACATGACAGAAGGCAAAAGG - Intergenic
1043392059 8:79801374-79801396 CTCACATGGGAGAAGAGGCGAGG - Intergenic
1044076940 8:87833423-87833445 CTCACATGGTGGAAAGGGCAAGG - Intergenic
1044348161 8:91130886-91130908 CTCACATGGTAGAAGGGGCAAGG + Intronic
1044415560 8:91935343-91935365 CTCACATGGTGAAAGGGGCATGG + Intergenic
1044510635 8:93074344-93074366 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1044537486 8:93374207-93374229 CTCACATGGCAGAAGGGCTGAGG + Intergenic
1044631867 8:94288049-94288071 CTCACATGGCGGAAGGTGGAAGG + Intergenic
1044639605 8:94364981-94365003 CTCACATGGTGGAAGGGACAAGG - Intergenic
1045183280 8:99809962-99809984 CTCCCATGACAGAGTGGGCCTGG + Intronic
1045859772 8:106803102-106803124 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1045998776 8:108395218-108395240 CTTACATGGCAGAAGGTGAAGGG + Intronic
1046046135 8:108966941-108966963 CTCACATGGCAGAAAGGGTGAGG - Intergenic
1046074182 8:109297530-109297552 CTCACATGACAGAAGGCGGAGGG - Intronic
1046177190 8:110593172-110593194 CTCACATGGTAGAAGAGGCAAGG + Intergenic
1046334702 8:112770326-112770348 CTCATATGGCAGAAGGTGGAAGG - Intronic
1046359912 8:113137649-113137671 TTCACATGACAGAAGGCAGAAGG + Intronic
1046391919 8:113585723-113585745 CAATCATGGCAGAAGGGGCAGGG + Intergenic
1046430260 8:114115002-114115024 CTTACATGACAAAAGGGGCTTGG - Intergenic
1046646071 8:116787053-116787075 CTTGCATGCTAGAAGGGGCAAGG - Intronic
1046953378 8:120039185-120039207 CTCACATGGTAGAAGGGGCAAGG - Intronic
1047006376 8:120624343-120624365 ATCCCATGACAGAAGAAGCAAGG + Intronic
1047014641 8:120710653-120710675 CTCACATGGCAGAAGGCAGAAGG - Intronic
1047145352 8:122192667-122192689 CTCACATGATAGAAGGGTGAGGG + Intergenic
1047252868 8:123193779-123193801 CTCACATGGCAGAAGGAGTGAGG + Intronic
1047316621 8:123740708-123740730 CTCAGAGGTCACAAGGGGCAGGG + Intergenic
1047443843 8:124902260-124902282 TTCCCTTGACATAAGGGGCATGG + Intergenic
1047463621 8:125091777-125091799 GTCACATGACCGAAGCGGCTGGG + Exonic
1047735938 8:127765067-127765089 CACACCTAACAGAGGGGGCAGGG - Intergenic
1048465556 8:134662154-134662176 CTCACATGGTGGAAGGGGCAAGG + Intronic
1048476707 8:134749449-134749471 TTCACATGGTAGAAGGGGCAAGG + Intergenic
1048635121 8:136287055-136287077 CTCACATGTGTGAAGGGACAAGG - Intergenic
1048776242 8:137949781-137949803 CTCACATAGCAGAAAGAGCAAGG + Intergenic
1049111095 8:140643982-140644004 CTCATATGGTAGAAGGGGCAAGG - Intergenic
1049291220 8:141803345-141803367 CTCACATGATGGAAGGGGTAAGG + Intergenic
1049390874 8:142370071-142370093 CTCACGTGGCAGAAGGGTGAAGG - Intronic
1050093659 9:2041430-2041452 CTCACATGGCAGAAGAGACAAGG + Intronic
1050103939 9:2146194-2146216 CTCACATGGTAGAAGGGACATGG + Intronic
1050367277 9:4884264-4884286 CTCACATGGTAGAAGGGGTCTGG + Intronic
1050759681 9:9052159-9052181 CCCACATGGCAGAAGGGGCAAGG + Intronic
1051062148 9:13056933-13056955 CTCACATGCTGGAAGGGACAAGG + Intergenic
1051157904 9:14171258-14171280 TTCACATGGAAGAAGGGGAAAGG - Intronic
1051266735 9:15316511-15316533 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1051371121 9:16360074-16360096 CTCACATGGCAGAAGTGGTAAGG + Intergenic
1051589856 9:18766700-18766722 TCCACATGATGGAAGGGGCAAGG + Intronic
1051605692 9:18916047-18916069 CTCACATGACAGAAGGTAGAAGG - Intergenic
1051662681 9:19440494-19440516 CTCACATGGTAGAAGGGCCAAGG - Intronic
1051910703 9:22152190-22152212 CTCACATAGTAGAAGGGGCAAGG - Intergenic
1051921345 9:22269603-22269625 ATCACATGATGGAAGAGGCAAGG - Intergenic
1052125419 9:24768740-24768762 CACTCATGACAGAAGGAGAAAGG + Intergenic
1052234310 9:26191619-26191641 CTCATATGACAAAAGGGCCAGGG + Intergenic
1052528960 9:29656919-29656941 TTCCCTTGACATAAGGGGCATGG + Intergenic
1052538485 9:29777352-29777374 TTCCCTTGACATAAGGGGCATGG + Intergenic
1052603429 9:30670090-30670112 CTCACATGACAGAAGAAATAAGG - Intergenic
1053375312 9:37601043-37601065 CTCACATGACAGAAGGTGGGAGG + Intronic
1053504014 9:38625159-38625181 CTCACATAACAGAAGGGGTGAGG - Intergenic
1053646544 9:40123224-40123246 CTCACATGACAGAAGAGATGAGG + Intergenic
1053759170 9:41340327-41340349 CTCACATGACAGAAGAGATGAGG - Intergenic
1053793212 9:41701451-41701473 CTCACATGGCAGAAGGCGGAAGG + Intergenic
1054151965 9:61613388-61613410 CTCACATGGCAGAAGGCGGAAGG - Intergenic
1054181621 9:61913463-61913485 CTCACATGGCAGAAGGCGGAAGG + Intergenic
1054327556 9:63721126-63721148 CTCACATGACAGAAGAGATGAGG + Intergenic
1054471737 9:65544518-65544540 CTCACATGGCAGAAGGCGGAAGG - Intergenic
1054538026 9:66252749-66252771 CTCACATGACAGAAGAGATGAGG - Intergenic
1054702237 9:68424406-68424428 CTCACATGGTGGAAGGGGCAAGG + Intronic
1054776775 9:69130618-69130640 CTTGCATGACGGAAGGGGCCGGG + Intronic
1054869431 9:70035801-70035823 CTCACATGGCAGAAGAGGCAAGG - Intergenic
1054919497 9:70527848-70527870 CTCACATGGGGGAAGGTGCAAGG - Intergenic
1055167148 9:73210821-73210843 ATAACATGGCAGAAGGGGCAAGG + Intergenic
1055618206 9:78095105-78095127 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1055700369 9:78938504-78938526 CTCACATAATGGAAGAGGCAAGG + Intergenic
1055893853 9:81152871-81152893 CTCACATAGCAGAAGGTGCAAGG + Intergenic
1055959167 9:81803705-81803727 ACCACATGGCAGAAGGGGCCAGG + Intergenic
1056365530 9:85900699-85900721 CTCACATGGCAGAAGACGGAAGG + Intergenic
1056423476 9:86453174-86453196 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1056594749 9:87997780-87997802 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1056704668 9:88941665-88941687 TTCTCTTGACATAAGGGGCATGG + Intergenic
1056987127 9:91373664-91373686 CTCACATGATAGAAGGGGCAGGG + Intergenic
1057010584 9:91597971-91597993 CTCACATAGGGGAAGGGGCAAGG - Intronic
1057035108 9:91806324-91806346 CTCACATGGCAGAAGGAGAAAGG + Intronic
1057330761 9:94112809-94112831 CTCACATGACAGAAAGTGGAAGG - Intergenic
1057468758 9:95339091-95339113 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1057522149 9:95768640-95768662 CTCACACGATGGAAGGGGCAAGG - Intergenic
1057565993 9:96166765-96166787 CTCACATGGCTGAAGGGGTGAGG - Intergenic
1058078600 9:100676595-100676617 CTCACGTGGTGGAAGGGGCAAGG + Intergenic
1058188424 9:101883896-101883918 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1058293897 9:103280498-103280520 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1058560336 9:106221766-106221788 CTCACTTGGCAGAAGGGGAGTGG - Intergenic
1058734044 9:107877806-107877828 ATTACATGAGAAAAGGGGCAGGG + Intergenic
1058783410 9:108362317-108362339 CTCACATGTTGGAACGGGCAAGG - Intergenic
1058940342 9:109807522-109807544 TTCACATGGTGGAAGGGGCAAGG + Intronic
1059038153 9:110781757-110781779 CTCACATGGCAGAACGGGCGAGG + Intronic
1059133912 9:111784814-111784836 CTCACATGGCAGAAAGGTCAAGG + Intronic
1059311536 9:113391746-113391768 CCCCCAGGACAGAAGGGGCAGGG + Intronic
1059465151 9:114464459-114464481 CTCACATGGTGGAAGGGGCGAGG + Intronic
1059489470 9:114655246-114655268 CTCACATAGCAGAAGGGGCAAGG - Intergenic
1059502680 9:114768473-114768495 CTCACATGGTAAAAGGGACAAGG - Intergenic
1059517390 9:114908500-114908522 CTCACCTGCCATAAGGGGTAAGG - Intronic
1059535221 9:115074368-115074390 CTCACAGGACAGAAGGGGCAAGG - Intronic
1059785602 9:117579362-117579384 CTCACCTGGCAAAAGAGGCAAGG - Intergenic
1059921060 9:119160209-119160231 CTCACATGGTGGAAGGGGCAAGG - Intronic
1060011600 9:120048329-120048351 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1060444105 9:123671446-123671468 CACACATGACTGAGGGGGCTGGG + Intronic
1060500379 9:124149267-124149289 CTCACATGGTGGAAGGGGCGAGG + Intergenic
1060607772 9:124932835-124932857 CTCACATGGTGGAAGGGGCAAGG + Intronic
1061806720 9:133141046-133141068 CCCATTTGACAGATGGGGCAAGG + Intronic
1202794331 9_KI270719v1_random:106659-106681 CTCACATGACAGAAGGGATGAGG + Intergenic
1203602561 Un_KI270748v1:29163-29185 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1185637646 X:1564843-1564865 CTCACATGGTGGAAGGGGCCAGG - Intergenic
1185758078 X:2668013-2668035 CTCACATGCTGGAAGGGGCGAGG - Intergenic
1185827381 X:3264902-3264924 CTCACACGGTGGAAGGGGCAAGG - Intergenic
1185828584 X:3276623-3276645 CTCACATGGTAGAAGGGGCAAGG - Intronic
1185842598 X:3406523-3406545 CTCACATGGTGGAAGGGGCGAGG - Intergenic
1185842780 X:3408527-3408549 CTCACATGGTGGAAGGGGCGAGG + Intergenic
1185869675 X:3653250-3653272 CTCACATGGTGGAAGGGGCGAGG - Intronic
1185913975 X:4014373-4014395 CACACATGGCAGAAGGGGAGGGG - Intergenic
1185938509 X:4286001-4286023 CTCACATGGAGGAAGGGGCAAGG - Intergenic
1186000095 X:5000013-5000035 CTCACCTGGCAGAAGGGGCGAGG + Intergenic
1186027014 X:5324270-5324292 CTCACATGGTGGAAGGGGTAAGG - Intergenic
1186035915 X:5423534-5423556 CTCACGTGGTAGAAGGGGCAAGG - Intergenic
1186054866 X:5639400-5639422 CTCACATGGTGGAAGGGACAAGG - Intergenic
1186066800 X:5775275-5775297 CTCACATGGTGGAAGGGGCCAGG + Intergenic
1186082788 X:5951693-5951715 CTCACATGATAAAAGGGACGAGG + Intronic
1186096825 X:6111324-6111346 CTCACATGTTGGAAGGGACAAGG - Intronic
1186146222 X:6626964-6626986 CTCACATAGTAGAAGGGGTAAGG + Intergenic
1186170551 X:6872016-6872038 CTCACATGGTGGAAGGGGAAAGG + Intergenic
1186174513 X:6910908-6910930 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1186254214 X:7701699-7701721 TTCCCTTGACATAAGGGGCATGG + Intergenic
1186268394 X:7857782-7857804 CTCACAGGGTGGAAGGGGCAAGG + Intergenic
1186275316 X:7931982-7932004 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1186281571 X:7998796-7998818 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1186482921 X:9909945-9909967 CTCACATGATGGAAGGGGAGAGG + Intronic
1186565184 X:10654732-10654754 CACACATGCCAGAGTGGGCAAGG + Intronic
1186987566 X:15033266-15033288 CTCACATGGCAGAAGCGTAAGGG - Intergenic
1186988168 X:15038734-15038756 CTCACATGGTGGAATGGGCAAGG - Intergenic
1187124744 X:16444727-16444749 CTCACACGACAGCAGCGGCAGGG + Intergenic
1187207416 X:17196500-17196522 CTCACATGATGGAAGGAGCAAGG - Intergenic
1187221243 X:17328162-17328184 CTCACATGGTAGAAAGAGCAAGG + Intergenic
1187316710 X:18202515-18202537 CTCACATGGCAGAAGGTAGAAGG - Intronic
1187426228 X:19179860-19179882 CTCACATGGCATAAGGGGCAGGG - Intergenic
1187569716 X:20488591-20488613 CTCACACGATGGAAGGGCCAAGG - Intergenic
1187768806 X:22672286-22672308 CTCACATGGCAGAAAAGGCATGG - Intergenic
1187795082 X:22994748-22994770 CTCACATCACAAAAAAGGCATGG + Intergenic
1187802787 X:23082667-23082689 CTCACATGGCAAAAGGGGTAAGG + Intergenic
1187974577 X:24692430-24692452 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1188172401 X:26943636-26943658 CTCACATGGTAGAAAGGGCAAGG - Intergenic
1188287139 X:28341488-28341510 CTCACATGAGGGAAGGTGGAAGG - Intergenic
1188293515 X:28417571-28417593 CTCACATGGCAGAAGGGGCGAGG + Intergenic
1188746445 X:33850640-33850662 CTCACATGTCAGAAGGGGCAAGG + Intergenic
1188827686 X:34856367-34856389 CTCACATGGCAGAAGGTGAAAGG + Intergenic
1188840754 X:35014146-35014168 TGCACATGGTAGAAGGGGCAGGG - Intergenic
1188936740 X:36185218-36185240 CTCCCATGGCAGAAGGGGTGAGG + Intergenic
1188956342 X:36438694-36438716 CTCACATGCCAGAAGGGAATGGG + Intergenic
1189025566 X:37390143-37390165 CTCACATGGCAAAAGGGGATGGG + Intronic
1189074158 X:37898165-37898187 CTCACGTGGGGGAAGGGGCAAGG + Intronic
1189145265 X:38649269-38649291 CTCACAAGTCAGAAGGGGGGTGG + Intronic
1189178467 X:38981215-38981237 CACACATGTCAGAAGGAGCAAGG - Intergenic
1189374764 X:40458401-40458423 TTCACGTGGCAGAAAGGGCAAGG + Intergenic
1189385945 X:40536993-40537015 CTCACATGGCAGAAAGGGCAAGG - Intergenic
1189569757 X:42283933-42283955 CTCACATGGCAGAAGGAGCAAGG - Intergenic
1189668678 X:43384630-43384652 CTCACATGGCACAAGGGGCAAGG - Intergenic
1189916163 X:45857749-45857771 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1190164025 X:48056706-48056728 CTCACATGGCAGAAGGCAGAAGG - Intronic
1190242422 X:48667843-48667865 CTCACATAGTGGAAGGGGCAAGG + Intergenic
1190973496 X:55376327-55376349 CTCACATTATGGAAGTGGCAAGG + Intergenic
1191167061 X:57402237-57402259 TTCCCTTGACATAAGGGGCATGG + Intronic
1191677664 X:63808604-63808626 GTTACATGGCAAAAGGGGCATGG + Intergenic
1192072376 X:67954613-67954635 CTCATATGACAGATAGGGAAGGG + Intergenic
1192481500 X:71490167-71490189 CTCACAAGACAGAGGTGGCAGGG - Intronic
1192939942 X:75901605-75901627 TTCCCTTGACATAAGGGGCATGG + Intergenic
1193136955 X:77983015-77983037 CTCACATGGTGGAAGGGACAGGG + Intronic
1193668455 X:84353424-84353446 CTCTCATGGCAGAAGGGGCAAGG - Intronic
1193698097 X:84734327-84734349 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1193903420 X:87212770-87212792 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1194592872 X:95821528-95821550 CTCACATGACAAAAGGAAGAAGG + Intergenic
1194812619 X:98404568-98404590 CTCACATGGCAGAAGGGACAAGG + Intergenic
1194973245 X:100367577-100367599 CTCACAAGACAGAAGATGGAAGG + Intronic
1195163959 X:102198905-102198927 CTCACATGGAGGAAGGGGAAAGG - Intergenic
1195194902 X:102488190-102488212 CTCACATGGAGGAAGGGGAAAGG + Intergenic
1195265920 X:103179643-103179665 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1195430320 X:104781978-104782000 CTCACATGGCAGAAGGGGCAAGG - Intronic
1195454755 X:105055221-105055243 CTCACATGGCAGAAAGAGCAAGG + Intronic
1195511755 X:105723743-105723765 CTCACATGGCAACAAGGGCAAGG + Intronic
1195808234 X:108799673-108799695 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1196058221 X:111378932-111378954 CTCACATGGCAGAAGGCAGAAGG - Intronic
1196130895 X:112155022-112155044 CTCACATGGCAGGAGGTGGAGGG - Intergenic
1196321373 X:114344385-114344407 CTCACATGGCAGAAGGTTGAAGG - Intergenic
1196327155 X:114420028-114420050 CTCACATGGTAGAAGGGCAAAGG - Intergenic
1196362190 X:114875125-114875147 CTCACATGGTAGAAGAGGTAAGG + Intronic
1196538182 X:116872470-116872492 CTCACATGACAGAAGGTGGATGG + Intergenic
1197168677 X:123407527-123407549 CTCACATGATGGAAAGGGTAAGG + Intronic
1197883063 X:131189634-131189656 CTAACATGGCAGAAGGGCAAAGG - Intergenic
1198036735 X:132808416-132808438 CTCCCATGACACATGGGGCTGGG - Intronic
1198078987 X:133220846-133220868 CTCTGATAACTGAAGGGGCAGGG - Intergenic
1198499171 X:137225602-137225624 CTCACATGATGGAAAGGGCAAGG - Intergenic
1198802483 X:140461701-140461723 CTCACATGGCAATAGGAGCAAGG - Intergenic
1199001321 X:142640400-142640422 CTCATATGGCAGAAGAGGCAAGG + Intergenic
1199187706 X:144936738-144936760 TTCACATATCAGAAGGGCCAAGG - Intergenic
1199234983 X:145481233-145481255 CCCACATGGCAGAAGGGGCAGGG + Intergenic
1199279838 X:145988414-145988436 TTCACATGGCAGAAGGGACAAGG - Intergenic
1199606614 X:149584097-149584119 CTCAGCTGACACAAGGGGCAGGG + Intronic
1199622855 X:149714853-149714875 CATAGCTGACAGAAGGGGCAGGG - Intronic
1199632509 X:149785271-149785293 CTCAGCTGACACAAGGGGCAGGG - Intronic
1199736062 X:150687759-150687781 CTCACATGGCAGAAGGTAAAAGG - Intergenic
1199765756 X:150940713-150940735 GTCACATTACAGAAGGGGTAAGG - Intergenic
1199884095 X:152001916-152001938 CTTACATGGTAGAAGGGGCAAGG - Intergenic
1199910914 X:152285764-152285786 CTCACATGATGGAAGGGGCTAGG + Intronic
1199949423 X:152695640-152695662 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1199951597 X:152711301-152711323 CTCACATGCAAGAAGGGATAAGG - Intergenic
1199954244 X:152730502-152730524 CTCGCATGGAGGAAGGGGCAAGG - Intronic
1199958086 X:152757147-152757169 CTCACATGCAAGAAGGGATAAGG + Intergenic
1199960253 X:152772809-152772831 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1200017055 X:153173920-153173942 CTCACATGGAAGACGGGGCAAGG - Intergenic
1200167807 X:154049421-154049443 CTCACATGCTAGGAGGAGCAGGG - Intronic
1200326003 X:155240024-155240046 CTCATGTGGCAGAAGGGGCAAGG + Intergenic
1200374418 X:155765002-155765024 CTCACATGATGGAAGTGCCAAGG + Intergenic
1200808262 Y:7454948-7454970 CTTACATGGTGGAAGGGGCAAGG - Intergenic
1201148987 Y:11084767-11084789 CTCACATGACAGAAGGGATGAGG - Intergenic
1201446686 Y:14064600-14064622 CTCACATGGTAGAAGGGGAAAGG - Intergenic
1201637365 Y:16139084-16139106 CTCACATGATGGAAGGGACAAGG + Intergenic
1201673836 Y:16557122-16557144 CTCACATGGTAGAAGGGGTGAGG - Intergenic
1201674382 Y:16562790-16562812 CTCATATGGTACAAGGGGCAAGG - Intergenic
1201676098 Y:16586103-16586125 CTCACATGGCAGAAGGGGCGAGG - Intergenic
1201688197 Y:16731440-16731462 CTCACATGGTAGAAGGGGCCAGG + Intergenic
1201746884 Y:17385945-17385967 CTCAAATGGTAGAAGGGGCAGGG - Intergenic
1201905614 Y:19083419-19083441 TTCCCTTGACATAAGGGGCATGG - Intergenic
1202384647 Y:24314261-24314283 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1202486137 Y:25355861-25355883 CACTCATGGCAGAAGGGGAAGGG - Intergenic