ID: 907792981

View in Genome Browser
Species Human (GRCh38)
Location 1:57685487-57685509
Sequence CAGTGTTAGATCAACAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907792977_907792981 15 Left 907792977 1:57685449-57685471 CCAAACAATAATAGTCAGAGACT 0: 1
1: 2
2: 157
3: 1831
4: 5841
Right 907792981 1:57685487-57685509 CAGTGTTAGATCAACAAGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907792981 Original CRISPR CAGTGTTAGATCAACAAGGT AGG Intronic
902680750 1:18042248-18042270 CAGGCTTAGATGAACAGGGTGGG - Intergenic
904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG + Intergenic
907792981 1:57685487-57685509 CAGTGTTAGATCAACAAGGTAGG + Intronic
911796102 1:102078041-102078063 AAGTGTTAGACCAAAAAGATAGG + Intergenic
918521863 1:185423609-185423631 CAGTGTTCTGTGAACAAGGTAGG + Intergenic
918595972 1:186293509-186293531 CAGTGTGTGATCAACAAGGAAGG + Intergenic
918603821 1:186396937-186396959 CATTGATACATCAATAAGGTGGG - Intronic
920447045 1:206025422-206025444 CAGTGAAAGATCAACAAGACGGG - Intergenic
920564521 1:206962767-206962789 AAGTGTTAGCTTATCAAGGTGGG - Intronic
922224268 1:223631775-223631797 CAGAGGGAGATAAACAAGGTAGG + Intronic
1069111707 10:64455398-64455420 CAGTTTTAAGTCAACAAAGTAGG - Intergenic
1072831856 10:98666357-98666379 CAGTGTTAGATCATTGAGGCAGG + Intronic
1073517630 10:104091490-104091512 CAGCGCAAGATCAGCAAGGTTGG + Intergenic
1073886951 10:108050318-108050340 CAGTGTGAGCTCATCAAGGAAGG + Intergenic
1074651098 10:115525309-115525331 CATAATTAGATCAACAAGATTGG - Intronic
1074827343 10:117223943-117223965 CAGTGTTAGTTCCACGAGGCAGG + Intergenic
1080079485 11:28199268-28199290 CACAGTAAGATCAAGAAGGTTGG - Intronic
1091862043 12:3794388-3794410 CACTACTAGATCAAAAAGGTAGG - Intronic
1092111745 12:5969403-5969425 CAGAGTTAGTCCAACAAGCTGGG + Intronic
1095259214 12:40079665-40079687 CAGTGTTAGATCATCGAGGCAGG - Intronic
1099171982 12:79375893-79375915 TAGTGATAGAACTACAAGGTGGG - Intronic
1100205167 12:92340649-92340671 CAGTATTAGATTGGCAAGGTAGG + Intergenic
1103722569 12:122982521-122982543 CACAGAGAGATCAACAAGGTGGG + Exonic
1105802298 13:23917583-23917605 CAGCATTAGATCATCAAGGCAGG + Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1109299668 13:60577921-60577943 CATGGGTAGATCAACAATGTAGG + Intergenic
1109379049 13:61534660-61534682 CAGTCTTAAATTAACCAGGTGGG + Intergenic
1111355259 13:87091839-87091861 CAGTGTTGGATCAAGAGGCTGGG + Intergenic
1120532803 14:85654742-85654764 CAATGTTAATTTAACAAGGTAGG + Intergenic
1120790461 14:88576343-88576365 CAGTAGTATATAAACAAGGTTGG + Intronic
1126168765 15:45676444-45676466 AAGTGTTAGGGCAAGAAGGTAGG + Intronic
1126354218 15:47777825-47777847 CAGTGTTCGATCAGTAAGGATGG + Intergenic
1130667726 15:85884032-85884054 CAGAGTTAGATTAAGAAAGTGGG + Intergenic
1131801333 15:96072542-96072564 CAGTTTTACCTCATCAAGGTAGG + Intergenic
1135280200 16:21147636-21147658 AAGTGTTATTTCAACAATGTGGG + Intronic
1140868729 16:79087507-79087529 CTGTGCTAGAACAACAAGCTTGG + Intronic
1147570661 17:41568503-41568525 CAGTCTCAGCTCAGCAAGGTTGG - Exonic
1153107002 18:1539137-1539159 TTGTGTTAGAACAAGAAGGTAGG + Intergenic
1155936142 18:31756469-31756491 CAGTGTTAGTTCAACATGATTGG + Intergenic
1156104321 18:33639322-33639344 CAGCCTGAGTTCAACAAGGTTGG - Intronic
1157101982 18:44739170-44739192 CTGTCTTAGATCAAGCAGGTAGG - Intronic
1158608362 18:58916117-58916139 CAACTTTAGATCAACATGGTTGG + Intronic
925809543 2:7685683-7685705 CAGTGTCAGAACAAAAAGCTGGG + Intergenic
925838212 2:7966086-7966108 CAGTGTGAGCTCAAGGAGGTTGG - Intergenic
932119817 2:69088242-69088264 CAGAGTTGGTTCAAAAAGGTTGG + Intronic
933151446 2:78919830-78919852 ATGTGTTACATCAACAAGCTTGG - Intergenic
935864623 2:107373191-107373213 CAGTGCTAGATCTAGAAAGTGGG + Intergenic
937911319 2:127077009-127077031 CAGTGTGAGATCAGCTAGGAGGG - Intronic
939482130 2:142762154-142762176 CAGTGTTAGTACATCCAGGTAGG - Intergenic
941941936 2:171048759-171048781 CAGTGTTTGAACAGCAATGTTGG + Intronic
943432745 2:187825039-187825061 CAAGGTTGGTTCAACAAGGTTGG + Intergenic
946118647 2:217489336-217489358 CAGTGTTGGAGCAATTAGGTAGG - Intronic
1177888711 21:26778655-26778677 CAGTCTGAGATCAAGAAGGAAGG + Intergenic
1185074892 22:48677864-48677886 CAGTGTTGGAGCAACATGGCAGG - Intronic
949651345 3:6163589-6163611 TACTGTTAGAACAACAGGGTGGG + Intergenic
950745699 3:15086629-15086651 CAATGTTAAATAAACAGGGTGGG + Intronic
950948190 3:16972548-16972570 CAATGTTAGATCATCAAGGCAGG - Intronic
952561004 3:34593317-34593339 CAGTCTTAGATCTAGAAGGGTGG + Intergenic
954439655 3:50514861-50514883 CAGTGATAGGTCAGCAAGGAGGG + Intergenic
956650692 3:71501921-71501943 CAGAGTGAGATCAGCAAGGCAGG + Intronic
958739593 3:98052663-98052685 CTGCTTTAGATCAACAAGGCAGG + Intergenic
960371523 3:116846731-116846753 CAATGTTAGGTGAACAAGCTTGG + Intronic
962956839 3:140274490-140274512 CAGTAATAGAACAAAAAGGTAGG + Intronic
963615057 3:147526454-147526476 CAGTATTAGATCATTAAGGCAGG - Intergenic
971506713 4:27374267-27374289 CAGTGTGAGAACAAAATGGTGGG + Intergenic
972894638 4:43604793-43604815 CAGTTTTAAATCAAGAAGCTAGG - Intergenic
972956833 4:44402990-44403012 CAGTGGAAGAGAAACAAGGTTGG + Intronic
976101619 4:81570040-81570062 CAGTTTGTGTTCAACAAGGTGGG - Intronic
977332663 4:95657267-95657289 CAGTATTAGATCATCAAGGCAGG - Intergenic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
988444224 5:31267275-31267297 CAGTGTTAGAGCAAATAGGCTGG - Intronic
994560313 5:101361746-101361768 TAGTGTGAGATCATTAAGGTGGG - Intergenic
995615276 5:113955643-113955665 CTTTGTTAGATCAACAACTTAGG + Intergenic
997487168 5:134241023-134241045 CAGTGTTAGGTACACAGGGTGGG - Intergenic
1003815427 6:9834998-9835020 CAGTGTTATAGCATCAAGGGTGG - Intronic
1004268166 6:14167779-14167801 TAGTTTTAGATCGACAAGGGAGG + Intergenic
1009533450 6:64850603-64850625 CAGTATTAGATAGAAAAGGTAGG + Intronic
1009600608 6:65792558-65792580 CAGTGTTAGTTCAGCATGATTGG - Intergenic
1009792654 6:68422910-68422932 TAGAGTTAGATCAACCAGTTAGG - Intergenic
1010564076 6:77387004-77387026 CAGTGTTATATCAAAATGCTTGG + Intergenic
1011354933 6:86464330-86464352 TAGTGTTAGAACAAAAAGGAAGG - Intergenic
1012445865 6:99306571-99306593 CAATGTGAGATGAACAGGGTGGG + Intronic
1014473857 6:121848801-121848823 AAGTGTAAGAAAAACAAGGTTGG + Intergenic
1017873829 6:158507245-158507267 CTGTGTTGGACCAACAAAGTAGG + Exonic
1020947477 7:14631168-14631190 CAGTGCTAGATCACCAAGATGGG + Intronic
1024266441 7:47610456-47610478 CAGAGTTAGATGAACAAGGAAGG - Intergenic
1024338154 7:48230541-48230563 CAGTGAGAGAACAACAAAGTTGG + Intronic
1030223341 7:107121417-107121439 CAGTGTTAAATGAAAAAAGTAGG + Intronic
1040682165 8:49825215-49825237 CATTTTCAGATGAACAAGGTAGG - Intergenic
1040697789 8:50023073-50023095 CAAGGGGAGATCAACAAGGTTGG + Intronic
1045070908 8:98503954-98503976 CAATATTAGATCAACAAGACAGG - Intronic
1050312923 9:4371588-4371610 CAGTGAGAGATCAGCAAGGAGGG - Intergenic
1051278394 9:15418379-15418401 AAGAGTTAGTTTAACAAGGTTGG - Intergenic
1053406620 9:37882321-37882343 CAGTGTTCGTTCAACATGATTGG + Intronic
1054905421 9:70410691-70410713 TGGTGTTAAATCAAGAAGGTGGG - Intronic
1057746159 9:97752925-97752947 GATTGTTAGATCAACATGGAGGG + Intergenic
1061285645 9:129620839-129620861 CAGTCTTAGAACAGCAAGCTCGG + Intronic
1062094274 9:134694948-134694970 CAGTGCTGGGTCAACAAGGCAGG - Intronic
1186724478 X:12342653-12342675 CAGTGTCAGATCAACCTGGTAGG + Intronic
1195998356 X:110754601-110754623 CAGTCTTAGATATTCAAGGTAGG - Intronic
1196491578 X:116273614-116273636 CAGTGCTAAAGCAACAAGGTGGG - Intergenic
1198840512 X:140852142-140852164 CAGTGTTCCTTCAACAAGTTTGG - Intergenic
1199206483 X:145154996-145155018 CAATTTTAGATCCCCAAGGTGGG - Intergenic