ID: 907801699

View in Genome Browser
Species Human (GRCh38)
Location 1:57772535-57772557
Sequence GCATCTAGGAGTAGACTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907801699 Original CRISPR GCATCTAGGAGTAGACTCGC TGG Intronic
903596345 1:24498258-24498280 GCATCTAGGAGTGGAATTTCTGG + Intergenic
904217751 1:28936924-28936946 GTAACTAGGAGTAGAATTGCTGG + Intronic
905264443 1:36741418-36741440 ATATCTAGGAGTAGAATTGCTGG + Intergenic
906754387 1:48295218-48295240 ACATCTAGGAGTTGACTTGCTGG - Intergenic
906986742 1:50691081-50691103 ATATCTAGGAGTAGAATTGCTGG + Intronic
907370404 1:53999088-53999110 GCACCTAGGAGTGGAATCGCTGG - Intergenic
907801699 1:57772535-57772557 GCATCTAGGAGTAGACTCGCTGG + Intronic
911137799 1:94460123-94460145 GTATCTAGGAGTGGAATTGCTGG + Intronic
911537634 1:99119500-99119522 GTATCTGGGAGTAGATTAGCTGG - Intergenic
913008288 1:114656748-114656770 TTATCTAGGAGTAGAATTGCTGG + Intronic
916286985 1:163118429-163118451 ATATCTAGAAGTAGACTTGCTGG - Intronic
919345468 1:196370687-196370709 ATATCTAGGAGTAGAATTGCTGG - Intronic
921343122 1:214154254-214154276 ACATCCAGAAGTAAACTCGCAGG + Intergenic
922742804 1:228024151-228024173 GTATCTAGGAGTGGAATTGCTGG + Intronic
923357193 1:233170165-233170187 GTACCTAGGAGTAGAATTGCTGG + Intronic
1064182251 10:13128201-13128223 ACACCTAGGAGTGGAGTCGCTGG + Intronic
1069523334 10:69144066-69144088 GTATCTAGGAGTAGAACTGCTGG - Intronic
1069730065 10:70605292-70605314 ATATCTAGGAGTGGACTTGCTGG + Intergenic
1070460650 10:76666087-76666109 ACATCTAGGAGTAGAAATGCTGG - Intergenic
1071419157 10:85472799-85472821 GCACCCAGGAGTAGACTTGCAGG - Intergenic
1071735739 10:88297845-88297867 ACATCTAGGAGTGGAATTGCTGG + Intronic
1072582193 10:96749298-96749320 TTATCTAGGAGTGGACTGGCTGG - Intergenic
1073039647 10:100594382-100594404 ACACCTAGGAGTACACTTGCTGG - Intergenic
1073174770 10:101548217-101548239 TCAACTAGGAGTAGACTTGCTGG - Intronic
1073524056 10:104162827-104162849 GCATTTAGGAGGAGGCTCGTGGG + Intronic
1075431847 10:122390807-122390829 GTACCTAGGAGTAGAATGGCTGG + Intronic
1078120321 11:8501671-8501693 GGATCTAAGAGTAGAATTGCTGG - Intronic
1078725638 11:13928349-13928371 GCACCTAGGAGTGGAATTGCTGG + Intergenic
1079007019 11:16798780-16798802 GCTCCTAGGAGTGGACTTGCTGG - Intronic
1079015359 11:16864143-16864165 GCATCTAGGACCAGACTATCTGG + Intronic
1079819105 11:25102639-25102661 GTATATAGGAGTAGAATTGCTGG + Intergenic
1086310889 11:85535612-85535634 ATATCTAGGAGTAGAATTGCTGG - Intronic
1088520670 11:110695797-110695819 GTACCTAGGAGTAGAATTGCAGG - Intronic
1090466190 11:126936367-126936389 ACATCTAGGAGTGGAATTGCTGG - Intronic
1091952821 12:4609047-4609069 GCATCTAGGTGGGGACTAGCAGG + Intronic
1094254198 12:28402161-28402183 GCATCTAGGGGTAGACGTGACGG - Intronic
1098785941 12:74755799-74755821 GTACCTAGGAGTAGAATTGCTGG + Intergenic
1099628200 12:85104469-85104491 GCCTCTAGGAGTGGACTGACTGG - Intronic
1100049536 12:90430018-90430040 GAACCTAGGAGTAGACTTGGTGG + Intergenic
1102259113 12:111433015-111433037 ACATCTAGGAGTGGAATTGCTGG + Intronic
1104085199 12:125468120-125468142 GTATCTAGGAGTACAATTGCTGG + Intronic
1105893349 13:24698064-24698086 GGATCTAGAAGTAGAATTGCTGG + Intronic
1106085017 13:26534148-26534170 AGAGCTAGGTGTAGACTCGCTGG + Intergenic
1106093057 13:26616127-26616149 ATATCTAGGAGTAGAATGGCTGG + Intronic
1107479202 13:40771335-40771357 GCCTCTAGGACTACAATCGCGGG - Intergenic
1108459192 13:50648117-50648139 GTACCTAGGAGTAGAATTGCTGG + Intronic
1108664612 13:52617337-52617359 GCCTCTAGGAATAGAATCGCGGG + Intergenic
1110207672 13:72935554-72935576 ATATCTAGGAGTAGACTGGCCGG + Intronic
1112120299 13:96402923-96402945 ACACCTAGGAGTAGAATCACTGG + Intronic
1112347889 13:98607142-98607164 ACATCTAGGAGTAAAATAGCTGG + Intergenic
1112395368 13:99025681-99025703 GCATCTAGGAGTGGAATTGCTGG - Intronic
1114541614 14:23464526-23464548 ACATCTAGGAGTAGAGTTGCTGG - Intergenic
1118218197 14:63829496-63829518 GTATCTAGGAGTGGAATTGCTGG - Intergenic
1118583373 14:67327272-67327294 ACACCTAGGAGTAGAATTGCCGG + Intronic
1119686495 14:76636636-76636658 ATATCTAGGAGTAGAATGGCTGG - Intergenic
1120806660 14:88758653-88758675 ACATCTAGGAATAGAATTGCTGG - Intronic
1122456874 14:101860547-101860569 ATACCTAGGAGTAGAGTCGCTGG + Intronic
1124442973 15:29702561-29702583 GCATCTAGGGGTAGAGGCCCAGG + Intronic
1125785724 15:42316091-42316113 ATATCTAGGAGTAGAATTGCTGG - Intronic
1126316054 15:47371001-47371023 GCATCTAGGAACTGACTGGCGGG - Intronic
1128363662 15:66981750-66981772 GCATCTGGGAGGAGGCTGGCTGG + Intergenic
1128967529 15:72074650-72074672 TAATCTAGGGGTAGACTCGGAGG + Intronic
1130793940 15:87188571-87188593 ACATCTAGGAGTGGAATCACTGG - Intergenic
1134430320 16:14198334-14198356 TCACCTAGGAGTAGAATTGCTGG + Intronic
1135409568 16:22223191-22223213 GCACCTAGGAGTGGAATTGCTGG + Intronic
1138080850 16:54090012-54090034 ACATCTAGGAGTGGAATTGCTGG - Intronic
1140256531 16:73341550-73341572 ACATCTAGGAGTAGAATTTCTGG - Intergenic
1140693213 16:77504913-77504935 GGATCTAGGAGTAGAACTGCTGG + Intergenic
1141508945 16:84500315-84500337 ACACCTAGGAGTGGACTTGCTGG + Intronic
1143130382 17:4673619-4673641 TCATCAAGGAGGAGACTCACAGG - Exonic
1143922585 17:10342426-10342448 GTACCTAGGAGTAGAGTTGCTGG - Intronic
1149198913 17:54159581-54159603 ACATCTAAGAGTAGAATGGCTGG - Intergenic
1149938072 17:60829656-60829678 GTAACTAGGAGTGGACTTGCTGG + Intronic
1150063256 17:62086909-62086931 GTATCTAGGAGTAGAATTGTTGG - Intergenic
1150544837 17:66144882-66144904 GTATCTAGGAATAGAATTGCTGG + Intronic
1153845537 18:9046161-9046183 CTATCTAGGAGTGGACTTGCTGG - Intergenic
1155083912 18:22437206-22437228 GTATTTAGGAGTAGAATTGCTGG + Intergenic
1156415327 18:36881955-36881977 GTATCTATGAGTAGAATTGCTGG + Intronic
1156896104 18:42247463-42247485 GCACCTAGGGGTGGAATCGCTGG + Intergenic
1158658357 18:59361298-59361320 GTAACTAGGAGTAGAGTTGCTGG + Intergenic
1159720713 18:71887177-71887199 CTATCTAGGAGTAGAATGGCTGG - Intergenic
1159978766 18:74750723-74750745 GTATATAGGAGTAGAATTGCTGG + Intronic
1163673647 19:18644413-18644435 ACATCTAGGAGCAGAATTGCTGG + Intronic
1163780079 19:19241723-19241745 GTATCTAGTAGTAGAATCGCTGG - Intronic
1168631189 19:57957560-57957582 ACACCTAGGAGTGGACTTGCTGG + Intergenic
926212600 2:10882128-10882150 TCCTCTAGGAGTAGAATGGCTGG + Intergenic
926791963 2:16582871-16582893 ACATCTAGGAGTGGAATAGCTGG + Intronic
927024941 2:19057529-19057551 GTTTCTAGAAGTAGACTTGCTGG - Intergenic
929558139 2:42938129-42938151 GCCTCTAGGGGTAGAGACGCAGG - Intergenic
933982554 2:87564622-87564644 ACATCTAGGAGTATGCTTGCTGG - Intergenic
935454173 2:103247049-103247071 ATATCTAGGATTAGACTTGCTGG + Intergenic
936052354 2:109234067-109234089 ACATTTAGGAGTAGAATTGCTGG + Intronic
936311287 2:111386170-111386192 ACATCTAGGAGTATGCTTGCTGG + Intergenic
938389753 2:130895434-130895456 ACATCTAGGAGCAGAATTGCTGG + Intronic
939233120 2:139455800-139455822 ACATCTAGGAGTGGAATCACTGG + Intergenic
939804756 2:146761150-146761172 GCATCTAGGCTTAGACTCTTTGG + Intergenic
939834702 2:147114470-147114492 ACATCTAGGAATAGAATGGCTGG + Intergenic
941172754 2:162159707-162159729 ATACCTAGGAGTAGAATCGCTGG + Intergenic
944777935 2:202988303-202988325 ACATCTAGGAGTAGAATGCCTGG + Intronic
946343587 2:219089217-219089239 GTACCTAGGAGTAGAATTGCTGG - Intronic
947687772 2:232105260-232105282 TCATATAGGAGTAGAATTGCTGG + Intronic
948285954 2:236785388-236785410 GAATTTAGGAGTAGATTGGCTGG - Intergenic
1170044882 20:12074424-12074446 GCATATAGGAGTAGAATCACTGG + Intergenic
1170896734 20:20421758-20421780 ACTTCTAGGAGTAGAATTGCTGG - Intronic
1173483743 20:43424620-43424642 ATATCTAGGAGTAGAATTGCAGG - Intergenic
1173883477 20:46436837-46436859 GTACCTAGGAGTAGAATCACTGG - Intergenic
1175509408 20:59513405-59513427 GCACCTAGCAGTAGAATCACGGG + Intergenic
1180994365 22:19958050-19958072 ACACCTAGGAGTAGAATTGCTGG + Intronic
1181757586 22:25035377-25035399 ACATCTAGGAGTAGAATGGCTGG + Intronic
1183987410 22:41577138-41577160 GCCACTAGGAGCAGACTGGCTGG + Exonic
950271741 3:11621675-11621697 GTACCTAGGAGTAGAATTGCTGG + Intronic
951458285 3:22918810-22918832 GCATCTAGCAGTAGGATGGCTGG - Intergenic
952023169 3:29047699-29047721 ACTTCTAGGAGTAGAGTTGCTGG + Intergenic
954940824 3:54371226-54371248 GTATCTAGGAGTCGAATTGCTGG + Intronic
955608874 3:60736267-60736289 ATACCTAGGAGTAGACTTGCTGG - Intronic
955676675 3:61456289-61456311 ATATTTAGGAGTAGACTAGCTGG + Intergenic
955881500 3:63551427-63551449 GTATCTAGGAGTGGAATTGCTGG + Intronic
956221533 3:66909201-66909223 ACATCTAGGAGCAGAATTGCTGG + Intergenic
959914808 3:111805111-111805133 ATATCTAGGAGTAGACTTGTTGG - Intronic
961071815 3:123937196-123937218 ATATCTAGGAGTGGACTGGCTGG + Intronic
961765797 3:129209761-129209783 ACACCTAGGAGTAGAATTGCTGG - Intergenic
961785106 3:129342937-129342959 GCCTCTAGGAGCAGGATCGCTGG - Intergenic
962499221 3:135972473-135972495 GTATCTAGGAATAGAATTGCTGG + Intronic
963809394 3:149760124-149760146 GTATCTAGGAGTAGAATTGTTGG - Intergenic
964283489 3:155092481-155092503 ACACCTAGGAGTAGAATTGCTGG - Intronic
964700900 3:159564970-159564992 ATATCTAGGAGTAGAATTGCTGG + Intronic
967127115 3:186434590-186434612 ACATCTAGGAGTGGAATTGCTGG + Intergenic
968165354 3:196460349-196460371 TCTTCTAGAAGTAGACTCACTGG + Intergenic
968536618 4:1134844-1134866 GGATCTAGGAGCAGAATTGCTGG + Intergenic
972284307 4:37633626-37633648 GCATCATGGAGAAGACTTGCAGG - Intronic
973923760 4:55716172-55716194 GCATCTAGGAGTGGGATTGCTGG + Intergenic
976051279 4:81013691-81013713 GCATCCAGGAGTAGGATTGCTGG - Intergenic
986772467 5:10986918-10986940 GTATTTAGGTGTAGACTGGCAGG - Intronic
987104965 5:14629533-14629555 ACATCTAGGAGTGGAATTGCTGG + Intergenic
987324203 5:16797458-16797480 GTATCTAGGAGTGGAATCGCTGG - Intronic
990392078 5:55333722-55333744 AAATCTAGGAGTAGAATTGCTGG - Intronic
993607697 5:90014362-90014384 ACATCTAGGAATAGTCTTGCAGG + Intergenic
996084693 5:119292492-119292514 ACATCTGGAAGTAGACTTGCTGG - Intronic
996698052 5:126420714-126420736 ATACCTAGGAGTAGACTTGCTGG - Intronic
996790186 5:127284214-127284236 GCATCTGGGAGGAGACTCATGGG + Intergenic
998429183 5:142055729-142055751 ACACCTAGGAGTAGAATTGCTGG - Intergenic
998496534 5:142595062-142595084 GCTTCTAGGAGTCAACTGGCTGG - Exonic
1002084255 5:176761763-176761785 ACATCTAGAAGTAGAATTGCTGG - Intergenic
1003364761 6:5461933-5461955 GCACCCAGGAGTAGAATTGCTGG + Intronic
1003471936 6:6444631-6444653 GTATCTAGGAGTAGAATAGCTGG - Intergenic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1007233857 6:40376453-40376475 GTACCTAGGAGTAGAATTGCGGG - Intergenic
1007524199 6:42477173-42477195 ATATCTAGGAGTAGACTTCCAGG + Intergenic
1008943823 6:57075401-57075423 GTATCTAGGAGTGGAATTGCTGG + Intergenic
1011023818 6:82844082-82844104 ATATCTAGGAGTAGAATTGCTGG + Intergenic
1015838301 6:137446320-137446342 ATATCTAGGAGTAGAATTGCTGG + Intergenic
1016091828 6:139988868-139988890 GTAACTAGGAGTAGAATTGCTGG + Intergenic
1019273663 7:164673-164695 GGATCTGAGAGGAGACTCGCTGG - Intergenic
1022144412 7:27522777-27522799 GCATCTAGGAGTGAAATTGCTGG + Intergenic
1022589348 7:31646382-31646404 GCACCTGGGAGCAGATTCGCAGG + Intronic
1022857996 7:34335124-34335146 GTAACTAGGAGTAGAATTGCTGG + Intergenic
1023420342 7:39972810-39972832 ATATCTAGGAGTAGAATTGCTGG + Intronic
1023964948 7:44958733-44958755 GTATCTAGGAGTGGAATCTCTGG - Intergenic
1026435833 7:70396886-70396908 GTATCTAGGAGTAGAATGGCTGG + Intronic
1026554624 7:71395597-71395619 ATATCTAGGAGTAGAATTGCTGG + Intronic
1028372647 7:90111801-90111823 ACATCTAGGAGTGGAATTGCTGG - Intergenic
1029067238 7:97863114-97863136 ATATCTAGGAGTAGAATTGCTGG - Intronic
1030676156 7:112388024-112388046 ATATCTAGGAGTAGACTTGCTGG - Intergenic
1031019411 7:116611118-116611140 ATATCTAGGAGTAGAATTGCTGG + Intergenic
1031792340 7:126122269-126122291 ATATCTAGGAGTAGAATGGCTGG - Intergenic
1032152448 7:129441347-129441369 ATATCTAGGAGTAGACTTGTTGG - Intronic
1032308868 7:130763414-130763436 GGACCTAGGAGTAGAATTGCTGG + Intergenic
1034299047 7:149999100-149999122 GGATCTGGGAGCAGACTGGCTGG - Intergenic
1034477343 7:151293293-151293315 TCATTTAGGAGTAGAATGGCTGG - Intergenic
1034806970 7:154097673-154097695 GGATCTGGGAGCAGACTGGCTGG + Intronic
1035688380 8:1542749-1542771 GCACCTCGGAGTAGACTCACTGG + Intronic
1037652885 8:20855780-20855802 ACACCTAGGAGTAGAATTGCTGG + Intergenic
1037792749 8:21961171-21961193 GTATCTAGGAGTGGAATAGCTGG + Intronic
1037798201 8:22014610-22014632 ACATCTAGGAGTGGAATTGCTGG - Intergenic
1038631417 8:29248175-29248197 GTATCTAGGAGTGGAATTGCTGG - Intronic
1039084541 8:33766966-33766988 ATATCTAGGAGTAGAATTGCTGG - Intergenic
1040844032 8:51816929-51816951 ACATCTAGGAGTAGAATTACTGG - Intergenic
1049194906 8:141309533-141309555 GTATCTAGGAGCAGAATTGCTGG - Intergenic
1050279000 9:4031125-4031147 ACATCTAGGAGTAGAATTGTCGG - Intronic
1056187031 9:84145368-84145390 ATATCTAGGAGTAGAGTTGCTGG - Intergenic
1056343446 9:85663767-85663789 ATATCTAGGAGTAGAATGGCTGG - Intronic
1057574394 9:96230278-96230300 TTACCTAGGAGTAGAATCGCTGG - Intergenic
1058664174 9:107294801-107294823 GAAACTAGGAGTAGACACGATGG + Intronic
1058964665 9:110025549-110025571 GTACCTAGGAGTAGAATTGCTGG + Intronic
1061527758 9:131181368-131181390 GTATGTAGGAGTGGAATCGCTGG + Intronic
1186363816 X:8871106-8871128 GCTTCTAGGAGGAGATTGGCAGG - Intergenic
1186807948 X:13159031-13159053 ATATCTAGGAGTAGAATTGCTGG + Intergenic
1186891591 X:13964329-13964351 ACACCTAGGAGTAGAATTGCTGG + Intergenic
1189434322 X:40977913-40977935 CCATCTAGGAGTAGAATTGTTGG + Intergenic
1190155103 X:47984395-47984417 GTACCTAGGAGTAGAATTGCTGG - Intronic
1191636813 X:63387451-63387473 ATATCTAGGAGTAGAATAGCTGG + Intergenic
1193689240 X:84620317-84620339 ATATCTAGGAGTAGAATTGCTGG + Intergenic
1195902107 X:109809893-109809915 GTACCTAGGAGTAGAGTTGCTGG - Intergenic
1198221654 X:134608159-134608181 GTATCTAGGAATAGACTTGCTGG - Intronic
1202580914 Y:26379597-26379619 ACACCTAGGAGTAGAATTGCTGG + Intergenic