ID: 907802074

View in Genome Browser
Species Human (GRCh38)
Location 1:57778949-57778971
Sequence GTGGAGTGAAGGAGGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2197
Summary {0: 1, 1: 1, 2: 17, 3: 208, 4: 1970}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907802074_907802079 -3 Left 907802074 1:57778949-57778971 CCTCTTTCCCTCCTTCACTCCAC 0: 1
1: 1
2: 17
3: 208
4: 1970
Right 907802079 1:57778969-57778991 CACAAATATTCTACAGAACATGG 0: 1
1: 0
2: 1
3: 24
4: 231
907802074_907802080 20 Left 907802074 1:57778949-57778971 CCTCTTTCCCTCCTTCACTCCAC 0: 1
1: 1
2: 17
3: 208
4: 1970
Right 907802080 1:57778992-57779014 AGAATCAGTAGCAAAGACCAAGG 0: 1
1: 0
2: 0
3: 16
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907802074 Original CRISPR GTGGAGTGAAGGAGGGAAAG AGG (reversed) Intronic
Too many off-targets to display for this crispr