ID: 907803169

View in Genome Browser
Species Human (GRCh38)
Location 1:57791762-57791784
Sequence GCATCTCTGGACTGTCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907803169_907803173 -3 Left 907803169 1:57791762-57791784 CCCCACTGACAGTCCAGAGATGC No data
Right 907803173 1:57791782-57791804 TGCTGAGATGTTATGCAATTTGG 0: 1
1: 0
2: 1
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907803169 Original CRISPR GCATCTCTGGACTGTCAGTG GGG (reversed) Intronic
No off target data available for this crispr