ID: 907805804

View in Genome Browser
Species Human (GRCh38)
Location 1:57818378-57818400
Sequence GATGCTTGCCCCTTCTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907805804_907805808 13 Left 907805804 1:57818378-57818400 CCTCCCTAGAAGGGGCAAGCATC 0: 1
1: 1
2: 0
3: 8
4: 76
Right 907805808 1:57818414-57818436 TACTAATTATACCTTTCACTTGG 0: 1
1: 0
2: 3
3: 15
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907805804 Original CRISPR GATGCTTGCCCCTTCTAGGG AGG (reversed) Intronic
901309294 1:8256923-8256945 GGTGCTTGCAGCTACTAGGGAGG - Intergenic
902733307 1:18383926-18383948 GAAGGCTGCCCCTTCCAGGGAGG + Intergenic
906777232 1:48540796-48540818 GATGCTGGCCTATTCTAGGGGGG - Intronic
907805804 1:57818378-57818400 GATGCTTGCCCCTTCTAGGGAGG - Intronic
911798662 1:102106882-102106904 AATCCCTGTCCCTTCTAGGGTGG - Intergenic
912786684 1:112610590-112610612 GCTGCTTGCCACTTCTACCGTGG - Intronic
1065109323 10:22424534-22424556 AATTCTTGCCCTTTCCAGGGTGG - Intronic
1067671102 10:48322415-48322437 GATGCTATCTCCTTCTAGAGAGG + Intronic
1069571329 10:69496023-69496045 GATCCTTGCCCATTGGAGGGTGG - Intronic
1072317993 10:94222312-94222334 GAAGCTTACCTCCTCTAGGGAGG - Intronic
1077836278 11:5930369-5930391 GATGGTTGCCCCTGCAGGGGAGG - Intronic
1082189516 11:49225815-49225837 GGTGCCTGCCAGTTCTAGGGTGG - Intergenic
1084572293 11:69966870-69966892 GATGCAAGCACCTTCTAGGGTGG + Intergenic
1086677008 11:89620689-89620711 GGTGCCTGCCAGTTCTAGGGTGG + Intergenic
1089567631 11:119380419-119380441 AATGCTTGGCCCCTCTGGGGTGG + Intronic
1091101797 11:132881370-132881392 GCTTCATGCCCCTTCTTGGGGGG - Intronic
1093019333 12:14188585-14188607 AATGCCTGCCCCTTCCATGGTGG + Intergenic
1096124718 12:49110722-49110744 GGTGCCTGCCCCTTTAAGGGCGG - Exonic
1099688568 12:85921703-85921725 TATCCTTGCTCCTTCTAGGAAGG + Intergenic
1104233959 12:126913374-126913396 GCTGCTTGTCACTTCAAGGGCGG + Intergenic
1104548865 12:129737515-129737537 GATGCATGCCCTTTCTAGGTGGG - Intronic
1107319064 13:39166529-39166551 AATCCATGCCCCTTCCAGGGTGG + Intergenic
1108549179 13:51526152-51526174 GATGCCTGCCCCTATTGGGGAGG + Intergenic
1111317111 13:86577613-86577635 GATGTTGGCCCATTGTAGGGTGG + Intergenic
1112037015 13:95506401-95506423 GATGCCTGCGTCTTCAAGGGCGG - Intronic
1115754546 14:36518811-36518833 GATGCTTCCCCCTGCTCGGCTGG - Intronic
1119945524 14:78689714-78689736 GCTGCTTCCTCCTTCTAGGCTGG + Intronic
1124064096 15:26323436-26323458 TATTCTTGCCCCTTCTGTGGGGG - Intergenic
1124240532 15:28024380-28024402 GAGGTTTGCCCCCTCTGGGGAGG - Intronic
1127397364 15:58553291-58553313 AATGCCTGCCCCTTCTGTGGGGG - Intronic
1129611276 15:77059940-77059962 GATGAGTGCCTCTTTTAGGGGGG - Intronic
1130106378 15:80931753-80931775 CATGTTTGCCCCTTCTGAGGTGG - Intronic
1132277394 15:100580687-100580709 GGTGTTTGCCCATTCTAAGGAGG + Exonic
1134639902 16:15822044-15822066 GAATCTTGGCCCTTCTAGGCAGG - Intronic
1140037152 16:71380138-71380160 GATGGTGGCACCTTGTAGGGGGG + Intronic
1142743746 17:1944799-1944821 GATGGTTGCCCAGACTAGGGTGG - Intronic
1144248796 17:13395061-13395083 GATGCAGGAACCTTCTAGGGCGG - Intergenic
1145883525 17:28368100-28368122 GAATCTTGCCCCTTCCAGCGGGG + Intronic
1147337554 17:39736798-39736820 CATTCGTGCCCCTTCCAGGGTGG + Intergenic
1147948407 17:44093250-44093272 GATGCCTGCCCCTGCCATGGGGG - Intronic
1150375195 17:64675691-64675713 GATGTTAGCCTCTTCTATGGTGG - Intergenic
1152685739 17:81693147-81693169 CCTGTTTGCCCCTTCTTGGGTGG + Intronic
1156985589 18:43347131-43347153 CATAGTTGCCCTTTCTAGGGAGG + Intergenic
1160991473 19:1862105-1862127 GGTGCTTGTCCCTTCCGGGGAGG - Intronic
1161456993 19:4374573-4374595 GCCGATTGCCCCATCTAGGGCGG - Intronic
1162474027 19:10889087-10889109 AATGCGTGCCCCATCTAGGTGGG - Intronic
1163315637 19:16538787-16538809 GCTGCTTTCCCTTTCTGGGGCGG - Intronic
925819276 2:7783642-7783664 ACTGCATGCTCCTTCTAGGGTGG + Intergenic
929442846 2:41978918-41978940 TCTGCTAGCCACTTCTAGGGTGG - Intergenic
940732633 2:157411401-157411423 GAAGTTTGCCACTTCTAGGCAGG - Intergenic
948261175 2:236605502-236605524 GATGCATTCCTCTGCTAGGGCGG + Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1177197831 21:17921418-17921440 GATGTGTGCCCCTTATAGGCAGG + Intronic
1178406675 21:32329934-32329956 GATGCTGGCCCCTTCTAGGGAGG + Intronic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1180245870 21:46546820-46546842 GCTGTTGGCCCCTTCTTGGGGGG + Intronic
1183117594 22:35703703-35703725 GATGCTTGGCCCTGCCAAGGCGG + Intergenic
1185163125 22:49241462-49241484 GATGCTGGCCCCTTCCCAGGAGG + Intergenic
952511682 3:34064410-34064432 GATGCTTGCCCCTAATAGGATGG + Intergenic
953238765 3:41129027-41129049 GATGCTTGCCCATACTGGTGAGG + Intergenic
953675374 3:44997347-44997369 GATGCTTTCAACTTATAGGGTGG + Intronic
955848282 3:63192208-63192230 GATTCTTCCCCCTACTAGGTGGG - Intergenic
961107469 3:124254168-124254190 GATGTTTGCTTCTTCAAGGGAGG + Intronic
964304409 3:155325380-155325402 GATGATGGCCCCTTCTATTGGGG + Intergenic
967861971 3:194159256-194159278 GATGCCTGCCCCTTGAATGGGGG + Intergenic
968003553 3:195224274-195224296 GATGCATGCCCCTCAGAGGGTGG + Intronic
970299550 4:14667129-14667151 TGGGCTTGCTCCTTCTAGGGGGG - Intergenic
978405411 4:108373387-108373409 GATGATGGCCCCTTCTCAGGGGG - Intergenic
986318060 5:6604423-6604445 GCTGGTTTCCCCTCCTAGGGGGG - Intronic
986519022 5:8594258-8594280 GATGGTTGCTGCTTCTGGGGAGG - Intergenic
994073259 5:95624107-95624129 GATGCTTGCCACCTCTGGTGAGG - Intergenic
1013621035 6:111889465-111889487 GATGCCTGCCCCATCCAAGGAGG + Intergenic
1013897706 6:115110763-115110785 GATGCTTGAACCATCTAGGAAGG + Intergenic
1024340133 7:48249384-48249406 GATGCTTTCCCCTTTTAGTGAGG + Intronic
1032067640 7:128783561-128783583 ACTGCCTGCCCCTTCTAGGATGG + Intergenic
1037371060 8:18179443-18179465 GATGCATGCCACTTCCAGGCTGG - Intronic
1041702694 8:60809098-60809120 GATGCTTTCATTTTCTAGGGTGG - Intronic
1043681198 8:83026788-83026810 TATGGCTGCCCATTCTAGGGAGG - Intergenic
1049464877 8:142746529-142746551 GATGCTTGCCCTGTCTGGGCTGG + Intergenic
1049473044 8:142784725-142784747 GCAGCCTGCCCCTTCCAGGGTGG + Intergenic
1049712828 8:144073998-144074020 GATGTCAGCCCCTTCCAGGGAGG + Intergenic
1050221437 9:3395049-3395071 GATGCATGCACCTTCCAGGCAGG - Intronic
1059376291 9:113884112-113884134 GCTACTTGCCCCTTTTAGAGAGG - Intronic
1061970505 9:134042220-134042242 GATGCATGCATCTTCTAGAGAGG - Intronic
1186688102 X:11946699-11946721 GATGCCTGCCCATACCAGGGAGG - Intergenic
1192560636 X:72125785-72125807 GTTGACTGCCCCTTCTAGGGAGG - Intergenic